James, you know you can generate heat within the LAMP test, there’s chemistry
for that and very accurate, sufficient for 30 - 45 minutes “runtime"
But I enjoy reading your emails.
Jürgen
> On Dec 7, 2020, at 8:50 PM, James Holton <jmhol...@lbl.gov> wrote:
>
>
> Yes, I would like to congratulate all these authors for getting this out.
> Many of them are friends and colleagues, and it is great to see them doing
> well, and getting this kind of work in front of as many eyes as possible.
> The nice thing about this particular assay is that it is linear with time,
> and therefore much more quantitative than PCR. Makes it easier to measure
> viral load. Great progress!
>
> True, 488 nm laser diodes are not "cheap", but that is paying retail.
> Ostensibly, there is no reason why mass production couldn't be ramped up. The
> question is not how much it costs to build the first one, but how much it
> will cost to make the billionth one. We scientists are usually far more
> concerned with the first device than the 2nd or the last, but if we want to
> get ahead of this pandemic we need to start thinking on this scale. How many
> factories can make the parts you need? What is the actual per-unit
> incremental cost of manufacture? Are there critical materials or components
> that are or will be in short supply. If you need toilet paper, for example,
> forget about it.
>
> In my spare time, I've been thinking a lot about how to get to a billion
> tests/day. Why that many? Because (IMHO) that is the most cost-effective way
> to end a pandemic. It is interesting to note that the graph of cost/benefit
> vs testing rate has a maximum, and it currently lies between us and the
> minimum. The minimum is when you test the entire population at the same time.
> That is, if we all take a test before going to bed and get the result the
> following morning, then everyone who has the virus will know to stay home.
> Everyone else can go to work, school, brunch, etc. If the test is 99%
> accurate you only need to do this ~5 times, perhaps once a week, until the
> number of undetected cases on Earth is less than one (7e9*(1-0.99)^5 < 1).
> I.E. the virus is extinct. That is, you could end the pandemic in 5 weeks
> with only 35 billion tests and potentially no need for quarantine (R << 1).
> Even if the test is only 50% accurate, or if compliance with quarantine is
> only 50%, then you need to test the world 33 times, or 2.3e11 test. The
> problem is that at current prices of $150/test, the cost of doing that would
> be $35e12. This is most of the Gross World Product. Too much.
>
> The trick is achieving this scale at a cost the human race can afford. If we
> can achieve the billion test/day scale with only $1/test, then ending the
> pandemic in a month for only $35e9 would be a real bargain.
>
> So, how do we do that? Shipping alone will be a nightmare. Amazon delivers
> about 1 billion packages every year, so delivering that many tests from a
> central factory in less than a year is intractable. This means that not just
> distribution but manufacturing must be de-centralized as much as possible.
> The test kits, or their critical components will have to be robust enough to
> be dropped en masse from airplanes. The advantages of "pre-deployed"
> materials and equipment cannot be understated. Ideally, you'd like the test
> to be performed by anyone watching a YouTube video (on their smartphone)
> using things they already have in their kitchen. Now, not everyone has the
> same things in their kitchen, and that means just one test design won't do.
> We need a DIVERSITY of designs.
>
> What I've been trying to do is break down this problem into the most critical
> barriers. As we collectively find ways to remove these barriers, we get
> closer to this lofty goal.
>
> For example, if someone is lucky enough to own a sous vide, then they can
> maintain the 63 C +/- 3 C for 2 hours required to perform a LAMP assay.
> Problem is: not everyone owns a sous vide, including me. I could order one,
> but if a billion other people do the same it will be a while before all those
> orders are filled. So, I need to use what I have. My oven can't be set for
> less than 77 C (that will inactivate the polymerase), hot water out of the
> tap is only 50 C (too cold), and boiling water in a coffee mug cools off too
> fast (65->60 C in 5 min). A few things I have found around the house that can
> do a LAMP assay are: a candle-fired fondue set, a slow cooker ("crock pot")
> set on "keep warm", solidifying candle wax in a foam box (melting point is
> ~62 C), and (I think) the dishwasher.
>
> Now, I haven't actually been doing LAMP assays in my kitchen. What I've been
> doing is cooking eggs. A "63 degree egg" has a particular mayonaise-like
> consistency that is hard to achieve any other way. That was my assay for the
> above.
>
> I suppose I could buy some Bst polymerase, but then my price/test will
> definitely be > $1. There also won't be enough to go around. 7 billion units
> of Bst polymerase is about 1 kg of pure enzyme. That will take a while to
> make. Enzymes in general are a pain. They are expensive, delicate, must be
> kept sterile, refrigerated, and are complicated to ship. It would be great
> if we had a testing strategy that didn't need any enzymes. Oligonucleotides
> are much hardier, cheaper, more predictable, and faster to make.
> Manufacturing can be distributed over a fairly large number of locations, and
> the amount you need per test is tiny.
>
> The main hurdle to an enzyme-free test is sensitivity. You can get decent
> signal boost by labeling hundreds of different sites in the 30 kb genome (as
> I described earlier) but you're not going to get the billion-fold
> amplification you can get from PCR. Even at the peak of an active infection
> the concentration of virus in sputum could still be as low as 1e6 copies/mL.
> This is ~2e-15 M. A tall order, but not unprecedented for detection by a
> smartphone CMOS sensor. Truth be told, however, that detection limit was 1
> million bioluminescent particles/mL. That means zero background.
> Fluorescence detection is limited by background, and most of that background
> comes from excess probes. Even "black-hole" quenchers aren't completely
> black. They give you a factor of 50 or so, nothing more. It is tempting to
> only use an equimolar amount of probe, but at 2e-15 M target the on-rate will
> be very low. On the other hand, unless the probes are removed
> post-annealing, anything more than a 10:1 ratio of probe to target will have
> unacceptably high background.
>
> What is important to remember here, however, is that you can always get more
> signal by using more sample. How much material a swab picks up is variable,
> but I guess it is not more than tens of microliters. This is then diluted
> >100x by the "dip and spin" transfer into a solution you can put in a PCR
> tube. Saliva-based tests usually collect ~500 uL or so, but can be hampered
> by contamination. Yes, people are told not to eat before providing saliva
> samples, but at least some of them always do. Then again, it may be a
> foregone conclusion that any test done in the home by billions of people is
> going to have to be robust to contamination. Perhaps we should embrace it
> rather than fight it?
>
> The extreme case of high sample volume and high contaminant levels is sewage.
> I have been immensely impressed by how successful this has been! Arizona
> State University detected two asymptomatic cases in a dorm full of 330
> students by doing just one test: sampling the effluent from the building. How
> much virus is available by this route is not clear, as literature on recovery
> and complications from contaminants are sparse. However, since PCR false
> negatives become unacceptably high after pooling 5 or so patient samples, but
> 2 patient samples were pooled with >300 others at ASU, I'd say you should get
> at least 30x more virus from a stool sample than you would from a swab.
> Coronaviruses in general are enteric pathogens, making this kind of shedding
> their usual route. This is a stark contrast to flu, Ebola and other serious
> pathogens we have seen in recent memory. I personally wonder how many
> "asymptomatic" cases simply had diarrhea and didn't want to talk about it.
> As a result, I am now much more afraid of public lavatories than ever before.
>
> Typical effluent samples are ~ 50 mL. A concentration step is required. As
> biochemists we immediately think of centrifugation, but the closest thing in
> my kitchen to a centrifuge is our salad spinner, and it only gets up to about
> 15 g (according to my previous phone's accelerometer). That's not even
> enough to pellet yeast, let alone nucleic acids. Manu Prakash invented a
> very clever whirlygig centrifuge (the PaperFuge), but it is not really
> compatible with large volumes. In fact, large volumes and high g-forces mean
> quite a lot of stored energy, and therefore a dangerous device.
>
> These factors turned my attention to electrophoretic concentrators. Yes,
> they do exist, but they are slow:
> https://doi.org/10.1016/0003-2697(81)90375-4
> <https://doi.org/10.1016/0003-2697(81)90375-4>
> Convection will keep re-mixing the sample, and therefore must be avoided.
> That means, among other things, gas production at the electrodes must be kept
> low enough to dissipate by diffusion (no bubbles). However, for an at-home
> test it is OK if this takes overnight. Lower voltages are safer anyway. By
> proper selection of the pore size in the gel or membrane used to capture the
> RNA, it could also serve to remove any unhybridized primers, which will have
> much lower molecular weight than the viral genome.
>
> The trick here will be keeping the RNA genome intact long enough to do the
> whole assay. Good thing about not using any enzymes is that you can have tons
> of denaturant around. Oligos of sufficient length can still hybridize in 3-5
> M urea, and perhaps higher. The literature on that is a bit sparse. The
> other thing that kills RNAse but not RNA is heat. Once the sample cools down
> the RNAses can re-fold and start digesting the RNA again, but if you keep it
> hot, and at neutral pH, the RNA has a pretty good chance. Have I done this
> experiment? No. I need a way to detect the RNA in my kitchen.
>
> The make-or-break here comes down to the at-home fluorometer. Key question
> is: how many dye molecules can be detected by a device costing $1 (+
> smartphone) made of parts that can scale to 1 billion units? I've looked into
> this a bit. One very important thing I have learned is that Schott glass
> sucks. I had hoped that by using colored glass filters I could avoid the need
> for any lenses. The "flash" LED on a smartphone is very bright, but also
> highly divergent. The theoretically best combination of filters and dyes to
> use are a Hoya B-370 excitation filter, ATTO-465 dye and and Scott OG-515
> emission filter. However, the OG-515 glass is itself fluorescent. Degree of
> fluorescence varies from batch to batch, but it is bright enough to see by
> eye, and therefore useless. Maybe I can make some jewelry out of it.
>
> Since colored glass filters are out, that leaves interference filters. These
> need parallel light, and that means lenses. I have found, however, that ball
> lenses could do the trick. Spheres are easy to manufacture. A ~1 cm ball
> lens held in contact with the window of the "flash" LED of a smartphone
> renders the light parallel enough for an interference filter to work. A
> second ball lens then focuses the filtered blue light onto a ~1 mm wide
> sample ~2.5 mm from the ball's surface. A third ball lens after the sample
> picks up the fluorescent light and parallelizes it through the emission
> filter. A final, forth ball lens focuses the fluorescent photons into the
> smartphone camera. Now, scientific-grade ball lenses and interference filters
> are not the cheapest optical components, but then again, neither is anything
> else when you buy it from a scientific supply company. A 1 cm N-BK7 glass
> ball lens set me back $44, but I also got a bag of one thousand 3/8" acrylic
> ball bearings for $10. Both lens types work equally well in my hands. I'm
> still learning about how interference filters are manufactured, but all they
> really are is a glass plate with some coating on it. Lots of places can do
> optical coatings, I think. A billion test kits will require a total of 1
> km^2, but it doesn't have to ever be all one sheet.
>
> Then you need something to hold the optics together. My favorite right now
> is black rubber hose. It is light tight, the matte finish minimizes specular
> reflections, and with a little pressure the rubber forms good light-tight
> seals all by itself. You can also align the optics peristaltically. What's
> been a little difficult is finding the right way to cut a rubber tube and get
> a nice, smooth edge. Freezing in liquid nitrogen would do it, but I don't
> have any of that in my kitchen. Ordinary tubing cutters are OK, but not
> great. Anyone got a favorite trick for this?
>
> And in general, any suggestions or comments, or best of all home experiment
> results would be great to hear. I believe that if we collectively work the
> problem we will inspire more breakthroughs like the Fozouni et al. paper
> below, and that will have a strong positive impact on all of us.
>
> -James Holton
> MAD Scientist
>
>
> On 12/5/2020 8:05 AM, Eugene Osipov wrote:
>> Hi everyone,
>> I wanted to revive this discussion with a fresh paper from Cell journal:
>> https://www.cell.com/cell/fulltext/S0092-8674(20)31623-8
>> <https://www.cell.com/cell/fulltext/S0092-8674(20)31623-8>
>> So one could use a smartphone camera for SARS-CoV-2 detection but you still
>> need some extra tools, like 488 nm laser.
>>
>> пт, 10 апр. 2020 г. в 20:14, James Holton <jmhol...@lbl.gov
>> <mailto:jmhol...@lbl.gov>>:
>>
>> It looks to me that in this norovirus test the phone is acting as nothing
>> more than a camara attached to a conventional microscope. Light source is
>> 3rd party, and the microscope body is 3D printed. 3D printing is cool and
>> all, but it does not scale well. Antibodies are also expensive to make.
>> You will go through a lot of rabbits to make the 1 kg needed for a billion
>> tests. This isn't quite the price point I had in mind.
>>
>> I agree that agglomeration of fluorescent beads is very sensitive. However,
>> my experience with beads and other small objects is that they love to stick
>> together for all kinds of reasons. And once they do it is hard to get them
>> to separate. Assaying for virus particles in otherwise pure water is one
>> thing, it is quite another when there is other stuff around.
>>
>> Personally, I've tried several different phone-based microscopes and the
>> hardest thing about them is aligning the camera. I'm a beamline scientist,
>> so aligning things is second nature, but your average person might have a
>> hard time. The most annoying part is if you bump it you have to start over.
>> Image quality is also never all that great, I expect because the optics of a
>> smartphone camera are wide-angle, and you are fighting against that.
>> Eventually I bought a self-contained wifi microscope for $50, and that works
>> MUCH better. In fact, I'd say its competitive with the $5k microscope we
>> use to look at crystals. However, $50 is a lot in the third world. I've
>> heard that drugs that cost more than $1/pill are essentially unobtainable in
>> many countries.
>>
>> I'm still thinking that using the camera as nothing more than a big
>> photodiode is the right way to go. By positioning the sample right in front
>> of the camera lens you will get maximum light-collection efficiency. In
>> fact, one might be able to get excellent time resolution out of the
>> rolling-shutter mode. That is, unlike the CCD or PAD detectors we are used
>> to these CMOS sensors read out one row of pixels while the others are still
>> exposing. This means that the whole image is acutally one big time series
>> with individual pixels only a few nanoseconds apart. It should be possible
>> to differentiate the light from a long-lived fluorophore from background.
>> However, I don't think anyone has tried that yet.
>>
>> -James Holton
>> MAD Scientist
>>
>>
>> On 4/4/2020 5:48 PM, Jurgen Bosch wrote:
>>> Here’s another link I found that should make this project feasible:
>>>
>>> https://physicsworld.com/a/smartphone-based-device-detects-norovirus/
>>> <https://physicsworld.com/a/smartphone-based-device-detects-norovirus/>
>>>
>>> Jürgen
>>>
>>>> On Apr 2, 2020, at 3:52 PM, Patrick Shaw Stewart <patr...@douglas.co.uk
>>>> <mailto:patr...@douglas.co.uk>> wrote:
>>>>
>>>> Jurgen, that was interesting. (Strange how your hair came and went during
>>>> the talk, leaving you bald sometimes - but of course that didn't matter !
>>>> ;)
>>>>
>>>> Did you know that coronavirus was first isolated at 33C and that this
>>>> temperature may be required for isolation?
>>>> https://www.bmj.com/content/3/5568/767
>>>> <https://www.bmj.com/content/3/5568/767>
>>>> https://www.sciencedirect.com/science/article/pii/S019665531730901X
>>>> <https://www.sciencedirect.com/science/article/pii/S019665531730901X>
>>>>
>>>> We don't know why the virus stays in the throat in many people, but at
>>>> other times it goes to the lungs. ACE2 is predicted to be highly
>>>> expressed in the mouth and nose as well as the lungs.
>>>> https://www.researchsquare.com/article/rs-16992/v1
>>>> <https://www.researchsquare.com/article/rs-16992/v1>
>>>>
>>>> A recent Nature paper noted that "sequence-distinct virus populations were
>>>> consistently detected in throat and lung samples from the same patient,
>>>> proving independent replication"
>>>> https://www.nature.com/articles/s41586-020-2196-x
>>>> <https://www.nature.com/articles/s41586-020-2196-x>
>>>>
>>>> It would be very interesting to know whether the lung samples were less
>>>> temperature-sensitive than the throat
>>>> ones, and whether this could explain the observed divergent tropism -
>>>> (which you also noted).
>>>> https://oldwivesandvirologists.blog/predicting-the-seasonality-of-covid/
>>>> <https://oldwivesandvirologists.blog/predicting-the-seasonality-of-covid/>
>>>>
>>>> Thx and stay warm (see my blog)
>>>>
>>>> Patrick
>>>>
>>>>
>>>>
>>>> On Thu, Apr 2, 2020 at 4:57 PM Jurgen Bosch <jxb...@case.edu
>>>> <mailto:jxb...@case.edu>> wrote:
>>>> I’m sharing a laymen’s talk I recently gave on some aspects of Corona. I’m
>>>> not claiming to be an expert, but there is useful information in the
>>>> presentation. I skipped the intro and zoomed directly to the start of my
>>>> presentation.
>>>>
>>>> https://www.youtube.com/watch?v=B00tJnbktVo&feature=youtu.be&t=204
>>>> <https://www.youtube.com/watch?v=B00tJnbktVo&feature=youtu.be&t=204>
>>>>
>>>> I can make the slides available if anybody wants them.
>>>>
>>>> Jürgen
>>>>
>>>>> On Apr 2, 2020, at 11:27 AM, James Holton <jmhol...@lbl.gov
>>>>> <mailto:jmhol...@lbl.gov>> wrote:
>>>>>
>>>>> Personally, if I were infected with SARS-CoV-1 instead of SARS-CoV-2 I'd
>>>>> still like to know that.
>>>>>
>>>>> It is most certainly true that the primer design must be done right:
>>>>> checking for self-annealing, low genomic variability, cross-reactivity to
>>>>> potential contaminants etc. Fortunately, we have tools for this that can
>>>>> be used at home.
>>>>>
>>>>> I agree the CRISPR-based tests are very exciting, as are many of the
>>>>> other new tests being rolled out. Assay times of 15 minutes, 5 minutes,
>>>>> and now 2 minutes have been claimed. The problem I see is they all rely
>>>>> on specialized equipment, skilled technicians and expensive reagents.
>>>>> Ramping up production to the billion-test scale may not be feasible.
>>>>> Even if it were, all the PPE needed to extract those samples safely would
>>>>> be prohibitive, as would be the sample-tracking logistics.
>>>>>
>>>>> For reasons such as this, I am curious to see if an at-home
>>>>> do-it-yourself test is possible. It may serve no purpose other than to
>>>>> satisfy indiviual curiosity, but I think it would go a long way to
>>>>> defusing the fear that comes from not knowing. This would not just be
>>>>> for sputum, but possibly doorknobs, packages, and, yes, mobile phones.
>>>>>
>>>>> And for those wondering about those nasal swabs: I've done a little
>>>>> research on them and I think the reason for going full "Total Recall" and
>>>>> sticking it way up inside your head is not because the virus is more
>>>>> concentrated there (we don't even know what the concentration is), but
>>>>> rather because potential contaminants are minimized. Think about it: PCR
>>>>> is a very sensitive technique, and you want to make sure the sample came
>>>>> from the intended patient, not the other patient who walked through the
>>>>> door just before you did after sneezing in their hand and touching the
>>>>> doorknob. If you touched that same doorknob and then <ahem> "scratched"
>>>>> your nose, then a swab of your nostrils might pick up a virus or two.
>>>>> That would be a false positive.
>>>>>
>>>>> I expect there are many aspects of current test that don't have to be the
>>>>> way they are, but nonetheless are "required" because they were inherited
>>>>> from previous tests. I expect we all have learned the hard way that in
>>>>> biological science when you are handed a protocol you follow that
>>>>> protocol to the letter. How many times have you had to teach a student
>>>>> that? It is not a bad policy, but eventually there comes a time for
>>>>> "assay development". This is when
>>>>> you start asking "why do we do it that way, again?"
>>>>>
>>>>> For example, swabs with calcium alginate are not allowed becuase they
>>>>> can "kill the virus". If all we want is genomic RNA, then why do we
>>>>> care? Possibly because the traditional method of identifying most
>>>>> pathogens is to culture them. The CDC protocol also recommends against
>>>>> cotton swabs with wood handles. Why? Perhaps because they contain DNA,
>>>>> and for PCR you always worry about contamination. Is there any chance
>>>>> the probes will anneal to something in the cotton or pine genomes? I
>>>>> doubt it, but I also doubt that anyone has checked.
>>>>>
>>>>> Thank you for the suggestions so far! Very interesting and helpful!
>>>>>
>>>>> -James Holton
>>>>> MAD Scientist
>>>>>
>>>>>
>>>>> On 3/31/2020 11:46 PM, Sahil Batra wrote:
>>>>>> Dear Prof. Holton,
>>>>>>
>>>>>> An innovative idea; however all of the 30 kb genome may not be useful
>>>>>> for specific detection - SARS-CoV1 and SARS-CoV2 share 80% identity.
>>>>>>
>>>>>> A similar fluorescent detection approach for SARS Cov2 -- using the
>>>>>> indiscriminate collateral activity of Cas12 nuclease -- has been
>>>>>> reported here:
>>>>>> https://www.biorxiv.org/content/10.1101/2020.02.29.971127v1.full.pdf
>>>>>> <https://www.biorxiv.org/content/10.1101/2020.02.29.971127v1.full.pdf>
>>>>>> Although not tested on samples from patients.
>>>>>>
>>>>>> Regards,
>>>>>> Sahil Batra
>>>>>> PhD candidate, IIT Kanpur
>>>>>>
>>>>>> On Wed, Apr 1, 2020 at 12:07 PM Jurgen Bosch <jxb...@case.edu
>>>>>> <mailto:jxb...@case.edu>> wrote:
>>>>>> One problem I see is the sputum, there’s a reason why swabs are made to
>>>>>> get sufficient viral material.
>>>>>>
>>>>>> Since stool samples test PCR positive that might be an easier approach
>>>>>> to get sufficient viral material. As a side note, these are not
>>>>>> infectious anymore, or at least one has not been able to infect tissue
>>>>>> cultures from stool samples.
>>>>>>
>>>>>> It’s worth a thought, I’ll need to read those papers you referenced.
>>>>>>
>>>>>> I believe I read a suitable preprint for viral load, will search for it
>>>>>> tomorrow.
>>>>>>
>>>>>> Jürgen
>>>>>>
>>>>>>
>>>>>>
>>>>>>
>>>>>> __________________________________________
>>>>>> Jürgen Bosch, Ph.D.
>>>>>> Division of Pediatric Pulmonology and Allergy/Immunology
>>>>>> Case Western Reserve University
>>>>>> 2109 Adelbert Rd <>, BRB 835
>>>>>> Cleveland, OH 44106 <>
>>>>>> Phone: 216.368.7565 <tel:216.368.7565>
>>>>>> Fax: 216.368.4223 <tel:216.368.4223>
>>>>>> CEO & Co-Founder at InterRayBio, LLC
>>>>>>
>>>>>> Johns Hopkins University
>>>>>> Bloomberg School of Public Health
>>>>>> Department of Biochemistry & Molecular Biology
>>>>>>
>>>>>>> On Apr 1, 2020, at 00:50, James Holton <jmhol...@lbl.gov
>>>>>>> <mailto:jmhol...@lbl.gov>> wrote:
>>>>>>>
>>>>>>> In order to do global survelinace of this new virus I figure we're
>>>>>>> going
>>>>>>> to need billions of tests. The biggest barriers I believe are
>>>>>>> logistical. Shipping back and forth to a central labs isn't going to
>>>>>>> cut it, and neither are test kits that cost $800 each.
>>>>>>>
>>>>>>> I think I may have a plausible way forward to a low-cost and easily
>>>>>>> mass-produced test for the SARS-CoV-2 virus using mostly items people
>>>>>>> already have, such as smartphones. The most expensive reagent required
>>>>>>> will be labeled oligos, but those scale very well.
>>>>>>>
>>>>>>> The key observation is that smartphones can detect as few as 1e6
>>>>>>> particles/mL if they do long exposures (180s). This was using
>>>>>>> bioluminescence. Reported here:
>>>>>>> https://www.nature.com/articles/srep40203.pdf
>>>>>>> <https://www.nature.com/articles/srep40203.pdf>
>>>>>>>
>>>>>>> The other side of that coin is the expected titer of the virus in
>>>>>>> sputum. I don't know of any reports for SARS-CoV-2 itself, but for
>>>>>>> four
>>>>>>> other respiratory viruses, including one coronavirus, it ranges from
>>>>>>> 1e6
>>>>>>> to 1e8 particles/mL :
>>>>>>> https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4187748/
>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4187748/>
>>>>>>>
>>>>>>> This is encouraging! The challenge will be to detect viral genomes in
>>>>>>> "the field" without sophisticated lab equipment like a PCR machine,
>>>>>>> lasers, 3D printers, etc. The concentration will be 1e-15 M, a
>>>>>>> challenge, but then again we can detect single molecules using
>>>>>>> fluorescence. The questions are:
>>>>>>> 1) can we get the background low enough so that the dark current of the
>>>>>>> camera dominates
>>>>>>> 2) can we make the signal high enough to overcome the dark current.
>>>>>>>
>>>>>>> 1) will depend on the availability of mass-produced filter technology.
>>>>>>> However, the best filter may simply be time. Provided the fluorophore
>>>>>>> lifetime is long enough and the camera synchronization tight enough one
>>>>>>> could simply measure the "afterglow" after the
>>>>>>> camera flash has turned
>>>>>>> off. An interesting candidate is europium. Most fluorophores decay in
>>>>>>> nanoseconds, but lanthanides can be microseconds to milliseconds. In
>>>>>>> fact, "glow-in-the-dark" toys usually use europium-doped ZnS or SrAl04.
>>>>>>> Those decay over minutes to hours. What I'm not sure about is using
>>>>>>> them for FRET. I would appreciate input on experience with this.
>>>>>>>
>>>>>>> 2) I believe signal could be enhanced by using very luminous tags (such
>>>>>>> as quantum dots), and/or by using multiple tags per genome. This virus
>>>>>>> has the largest RNA genome known to date at 30 kbases. That means there
>>>>>>> is room for up to 2000 15-mer tags, each with its own label. The set-up
>>>>>>> cost for doing ~2000 oligo synthesis reactions will be high, but it can
>>>>>>> be done at scale. You only need ~2 fmol of each oligo, 10 umol
>>>>>>> synthesis is about $1k, so I estimate about $1 per test using 1000
>>>>>>> different oligos. This price point will be important if we want to make
>>>>>>> billions of tests to be used all over the world. In some countries $1
>>>>>>> is a lot.
>>>>>>>
>>>>>>> The detection strategy I am focusing on is FRET. That is, oligos would
>>>>>>> be made in pairs, recognizing abutting sections of the viral genome.
>>>>>>> Like this:
>>>>>>> 5' atttcgctgattttggggtc-ATTO465 ATTO550-cattatcagacattttagt 3'
>>>>>>> which would anneal to one of the current CDC
>>>>>>> test primer sites:
>>>>>>> 3' taaagcgactaaaaccccaggtaatagtctgtaaaatca 5'
>>>>>>> The result in this case would be maximum FRET efficiency only when both
>>>>>>> oligos are bound. From what I can tell, the ATTO465 dye is one that is
>>>>>>> most sensitive to the blue peak in the iPhone "flash" LED spectrum, and
>>>>>>> ATTO550 should give maximum contrast between the green and red channels
>>>>>>> of the iPhone camera. That way you would discriminate presence/absence
>>>>>>> by color. Red=virus, Green=clear. That is just an example. Other tags
>>>>>>> might work better. Maybe quantum dots.
>>>>>>>
>>>>>>> Additional aparatus would be required, of course, and at least a few
>>>>>>> reagents to crack open the capsids (DTT and guanidine). These could be
>>>>>>> shipped dry in foil packs. The end user would
>>>>>>> simply tear it open and
>>>>>>> spit into it. If the intersted party is performing the test on
>>>>>>> themselves, then there is no biohazard. Heating to 70C (cup of
>>>>>>> coffee?)
>>>>>>> should kill the virus, and these reagents will make it even more dead.
>>>>>>> I'm not sure how much purification would be required. The assay volume
>>>>>>> in the Nature paper above was 1 mL. I expect signal would be improved
>>>>>>> by concentrating the RNA as close to the camera as possible. It may
>>>>>>> even be possible to absorb the nucleic acid directly onto the cover
>>>>>>> glass of the smartphone camera. RNA sticks to glass at pH < 7.5, and
>>>>>>> not much else does. Quiagen EZ1 nucleic acid purificaiton columns are
>>>>>>> nothing but silica glass beads after all.
>>>>>>>
>>>>>>> There are still details to work out, but I am intruiged by the fact
>>>>>>> that
>>>>>>> this seems physically possible and the potential of being very cheap,
>>>>>>> rugged, portable and scaled up rapidly. It would be nice to be able to
>>>>>>> leverage a device that is in already in the hand of half the people on
>>>>>>> the planet.
>>>>>>>
>>>>>>> Comments? Insights?
>>>>>>>
>>>>>>> -James Holton
>>>>>>> MAD Scientist
>>>>>>>
>>>>>>> ########################################################################
>>>>>>>
>>>>>>> To unsubscribe from the CCP4BB list, click the following link:
>>>>>>> https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB&A=1
>>>>>>> <https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB&A=1>
>>>>>>
>>>>>> To unsubscribe from the CCP4BB list, click the following link:
>>>>>> https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB&A=1
>>>>>> <https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB&A=1>
>>>>>> To unsubscribe from the CCP4BB list, click the following link:
>>>>>> https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB&A=1
>>>>>> <https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB&A=1>
>>>>>
>>>>> To unsubscribe from the CCP4BB list, click the following link:
>>>>> https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB&A=1
>>>>> <https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB&A=1>
>>>>
>>>> To unsubscribe from the CCP4BB list, click the following link:
>>>> https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB&A=1
>>>> <https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB&A=1>
>>>>
>>>> --
>>>> patr...@douglas.co.uk <mailto:patr...@douglas.co.uk> Douglas
>>>> Instruments Ltd.
>>>> Douglas House, East Garston, Hungerford, Berkshire, RG17 7HD, UK
>>>> Directors: Patrick Shaw Stewart, Peter Baldock, Stefan Kolek
>>>>
>>>> http://www.douglas.co.uk <http://www.douglas.co.uk/>
>>>> Tel: 44 (0) 148-864-9090 US toll-free 1-877-225-2034
>>>> Regd. England 2177994, VAT Reg. GB 480 7371 36
>>>
>>>
>>> To unsubscribe from the CCP4BB list, click the following link:
>>> https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB&A=1
>>> <https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB&A=1>
>>
>> To unsubscribe from the CCP4BB list, click the following link:
>> https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB&A=1
>> <https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB&A=1>
>>
>> --
>> Evgenii Osipov
>> Laboratory for Biocrystallography,
>> Department of Pharmaceutical Sciences,
>> KU Leuven O&N2
>>
>> To unsubscribe from the CCP4BB list, click the following link:
>> https://www.jiscmail.ac.uk/cgi-bin/WA-JISC.exe?SUBED1=CCP4BB&A=1
>> <https://www.jiscmail.ac.uk/cgi-bin/WA-JISC.exe?SUBED1=CCP4BB&A=1>
>
> To unsubscribe from the CCP4BB list, click the following link:
> https://www.jiscmail.ac.uk/cgi-bin/WA-JISC.exe?SUBED1=CCP4BB&A=1
> <https://www.jiscmail.ac.uk/cgi-bin/WA-JISC.exe?SUBED1=CCP4BB&A=1>
########################################################################
To unsubscribe from the CCP4BB list, click the following link:
https://www.jiscmail.ac.uk/cgi-bin/WA-JISC.exe?SUBED1=CCP4BB&A=1
This message was issued to members of www.jiscmail.ac.uk/CCP4BB, a mailing list
hosted by www.jiscmail.ac.uk, terms & conditions are available at
https://www.jiscmail.ac.uk/policyandsecurity/
