Jurgen, that *was *interesting. (Strange how your hair came and went during the talk, leaving you bald sometimes - but of course that didn't matter ! ;)
Did you know that coronavirus was first isolated at 33C and that this temperature may be required for isolation? https://www.bmj.com/content/3/5568/767 https://www.sciencedirect.com/science/article/pii/S019665531730901X We don't know why the virus stays in the throat in many people, but at other times it goes to the lungs. ACE2 is predicted to be highly expressed in the mouth and nose as well as the lungs. https://www.researchsquare.com/article/rs-16992/v1 A recent Nature paper noted that "sequence-distinct virus populations were consistently detected in throat and lung samples from the same patient, proving independent replication" https://www.nature.com/articles/s41586-020-2196-x It would be very interesting to know whether the lung samples were less temperature-sensitive than the throat ones, and whether this could explain the observed divergent tropism - (which you also noted). https://oldwivesandvirologists.blog/predicting-the-seasonality-of-covid/ Thx and stay warm (see my blog) Patrick On Thu, Apr 2, 2020 at 4:57 PM Jurgen Bosch <jxb...@case.edu> wrote: > I’m sharing a laymen’s talk I recently gave on some aspects of Corona. I’m > not claiming to be an expert, but there is useful information in the > presentation. I skipped the intro and zoomed directly to the start of my > presentation. > > https://www.youtube.com/watch?v=B00tJnbktVo&feature=youtu.be&t=204 > > I can make the slides available if anybody wants them. > > Jürgen > > On Apr 2, 2020, at 11:27 AM, James Holton <jmhol...@lbl.gov> wrote: > > Personally, if I were infected with SARS-CoV-1 instead of SARS-CoV-2 I'd > still like to know that. > > It is most certainly true that the primer design must be done right: > checking for self-annealing, low genomic variability, cross-reactivity to > potential contaminants etc. Fortunately, we have tools for this that can > be used at home. > > I agree the CRISPR-based tests are very exciting, as are many of the other > new tests being rolled out. Assay times of 15 minutes, 5 minutes, and now > 2 minutes have been claimed. The problem I see is they all rely on > specialized equipment, skilled technicians and expensive reagents. Ramping > up production to the billion-test scale may not be feasible. Even if it > were, all the PPE needed to extract those samples safely would be > prohibitive, as would be the sample-tracking logistics. > > For reasons such as this, I am curious to see if an at-home do-it-yourself > test is possible. It may serve no purpose other than to satisfy indiviual > curiosity, but I think it would go a long way to defusing the fear that > comes from not knowing. This would not just be for sputum, but possibly > doorknobs, packages, and, yes, mobile phones. > > And for those wondering about those nasal swabs: I've done a little > research on them and I think the reason for going full "Total Recall" and > sticking it way up inside your head is not because the virus is more > concentrated there (we don't even know what the concentration is), but > rather because potential contaminants are minimized. Think about it: PCR > is a very sensitive technique, and you want to make sure the sample came > from the intended patient, not the other patient who walked through the > door just before you did after sneezing in their hand and touching the > doorknob. If you touched that same doorknob and then <ahem> "scratched" > your nose, then a swab of your nostrils might pick up a virus or two. That > would be a false positive. > > I expect there are many aspects of current test that don't have to be the > way they are, but nonetheless are "required" because they were inherited > from previous tests. I expect we all have learned the hard way that in > biological science when you are handed a protocol you follow that protocol > to the letter. How many times have you had to teach a student that? It is > not a bad policy, but eventually there comes a time for "assay > development". This is when you start asking "why do we do it that way, > again?" > > For example, swabs with calcium alginate are not allowed becuase they can > "kill the virus". If all we want is genomic RNA, then why do we care? > Possibly because the traditional method of identifying most pathogens is to > culture them. The CDC protocol also recommends against cotton swabs with > wood handles. Why? Perhaps because they contain DNA, and for PCR you > always worry about contamination. Is there any chance the probes will > anneal to something in the cotton or pine genomes? I doubt it, but I also > doubt that anyone has checked. > > Thank you for the suggestions so far! Very interesting and helpful! > > -James Holton > MAD Scientist > > > On 3/31/2020 11:46 PM, Sahil Batra wrote: > > Dear Prof. Holton, > > An innovative idea; however all of the 30 kb genome may not be useful for > specific detection - SARS-CoV1 and SARS-CoV2 share 80% identity. > > A similar fluorescent detection approach for SARS Cov2 -- using the > indiscriminate collateral activity of Cas12 nuclease -- has been reported > here: https://www.biorxiv.org/content/10.1101/2020.02.29.971127v1.full.pdf > Although not tested on samples from patients. > > Regards, > Sahil Batra > PhD candidate, IIT Kanpur > > On Wed, Apr 1, 2020 at 12:07 PM Jurgen Bosch <jxb...@case.edu> wrote: > >> One problem I see is the sputum, there’s a reason why swabs are made to >> get sufficient viral material. >> >> Since stool samples test PCR positive that might be an easier approach to >> get sufficient viral material. As a side note, these are not infectious >> anymore, or at least one has not been able to infect tissue cultures from >> stool samples. >> >> It’s worth a thought, I’ll need to read those papers you referenced. >> >> I believe I read a suitable preprint for viral load, will search for it >> tomorrow. >> >> Jürgen >> >> >> >> >> __________________________________________ >> Jürgen Bosch, Ph.D. >> Division of Pediatric Pulmonology and Allergy/Immunology >> Case Western Reserve University >> 2109 Adelbert Rd, BRB 835 >> Cleveland, OH 44106 >> Phone: 216.368.7565 >> Fax: 216.368.4223 >> >> CEO & Co-Founder at InterRayBio, LLC >> >> Johns Hopkins University >> Bloomberg School of Public Health >> Department of Biochemistry & Molecular Biology >> >> On Apr 1, 2020, at 00:50, James Holton <jmhol...@lbl.gov> wrote: >> >> In order to do global survelinace of this new virus I figure we're >> going >> to need billions of tests. The biggest barriers I believe are >> logistical. Shipping back and forth to a central labs isn't going to >> cut it, and neither are test kits that cost $800 each. >> >> I think I may have a plausible way forward to a low-cost and easily >> mass-produced test for the SARS-CoV-2 virus using mostly items people >> already have, such as smartphones. The most expensive reagent required >> will be labeled oligos, but those scale very well. >> >> The key observation is that smartphones can detect as few as 1e6 >> particles/mL if they do long exposures (180s). This was using >> bioluminescence. Reported here: >> https://www.nature.com/articles/srep40203.pdf >> >> The other side of that coin is the expected titer of the virus in >> sputum. I don't know of any reports for SARS-CoV-2 itself, but for four >> other respiratory viruses, including one coronavirus, it ranges from 1e6 >> to 1e8 particles/mL : >> https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4187748/ >> >> This is encouraging! The challenge will be to detect viral genomes in >> "the field" without sophisticated lab equipment like a PCR machine, >> lasers, 3D printers, etc. The concentration will be 1e-15 M, a >> challenge, but then again we can detect single molecules using >> fluorescence. The questions are: >> 1) can we get the background low enough so that the dark current of the >> camera dominates >> 2) can we make the signal high enough to overcome the dark current. >> >> 1) will depend on the availability of mass-produced filter technology. >> However, the best filter may simply be time. Provided the fluorophore >> lifetime is long enough and the camera synchronization tight enough one >> could simply measure the "afterglow" after the camera flash has turned >> off. An interesting candidate is europium. Most fluorophores decay in >> nanoseconds, but lanthanides can be microseconds to milliseconds. In >> fact, "glow-in-the-dark" toys usually use europium-doped ZnS or SrAl04. >> Those decay over minutes to hours. What I'm not sure about is using >> them for FRET. I would appreciate input on experience with this. >> >> 2) I believe signal could be enhanced by using very luminous tags (such >> as quantum dots), and/or by using multiple tags per genome. This virus >> has the largest RNA genome known to date at 30 kbases. That means there >> is room for up to 2000 15-mer tags, each with its own label. The set-up >> cost for doing ~2000 oligo synthesis reactions will be high, but it can >> be done at scale. You only need ~2 fmol of each oligo, 10 umol >> synthesis is about $1k, so I estimate about $1 per test using 1000 >> different oligos. This price point will be important if we want to make >> billions of tests to be used all over the world. In some countries $1 >> is a lot. >> >> The detection strategy I am focusing on is FRET. That is, oligos would >> be made in pairs, recognizing abutting sections of the viral genome. >> Like this: >> 5' atttcgctgattttggggtc-ATTO465 ATTO550-cattatcagacattttagt 3' >> which would anneal to one of the current CDC test primer sites: >> 3' taaagcgactaaaaccccaggtaatagtctgtaaaatca 5' >> The result in this case would be maximum FRET efficiency only when both >> oligos are bound. From what I can tell, the ATTO465 dye is one that is >> most sensitive to the blue peak in the iPhone "flash" LED spectrum, and >> ATTO550 should give maximum contrast between the green and red channels >> of the iPhone camera. That way you would discriminate presence/absence >> by color. Red=virus, Green=clear. That is just an example. Other tags >> might work better. Maybe quantum dots. >> >> Additional aparatus would be required, of course, and at least a few >> reagents to crack open the capsids (DTT and guanidine). These could be >> shipped dry in foil packs. The end user would simply tear it open and >> spit into it. If the intersted party is performing the test on >> themselves, then there is no biohazard. Heating to 70C (cup of coffee?) >> should kill the virus, and these reagents will make it even more dead. >> I'm not sure how much purification would be required. The assay volume >> in the Nature paper above was 1 mL. I expect signal would be improved >> by concentrating the RNA as close to the camera as possible. It may >> even be possible to absorb the nucleic acid directly onto the cover >> glass of the smartphone camera. RNA sticks to glass at pH < 7.5, and >> not much else does. Quiagen EZ1 nucleic acid purificaiton columns are >> nothing but silica glass beads after all. >> >> There are still details to work out, but I am intruiged by the fact that >> this seems physically possible and the potential of being very cheap, >> rugged, portable and scaled up rapidly. It would be nice to be able to >> leverage a device that is in already in the hand of half the people on >> the planet. >> >> Comments? Insights? >> >> -James Holton >> MAD Scientist >> >> ######################################################################## >> >> To unsubscribe from the CCP4BB list, click the following link: >> https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB&A=1 >> >> >> ------------------------------ >> >> To unsubscribe from the CCP4BB list, click the following link: >> https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB&A=1 >> > > ------------------------------ > > To unsubscribe from the CCP4BB list, click the following link: > https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB&A=1 > > > > ------------------------------ > > To unsubscribe from the CCP4BB list, click the following link: > https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB&A=1 > > > > ------------------------------ > > To unsubscribe from the CCP4BB list, click the following link: > https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB&A=1 > -- patr...@douglas.co.uk Douglas Instruments Ltd. Douglas House, East Garston, Hungerford, Berkshire, RG17 7HD, UK Directors: Patrick Shaw Stewart, Peter Baldock, Stefan Kolek http://www.douglas.co.uk Tel: 44 (0) 148-864-9090 US toll-free 1-877-225-2034 Regd. England 2177994, VAT Reg. GB 480 7371 36 ######################################################################## To unsubscribe from the CCP4BB list, click the following link: https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB&A=1
