Re: [R] geoRglm with factor variable as covariable
Thank you Ruben. You were absolutly right. I'm using trend option now to specify my model. Thank for the help, Phil -- View this message in context: http://r.789695.n4.nabble.com/geoRglm-with-factor-variable-as-covariable-tp4645067p4645310.html Sent from the R help mailing list archive at Nabble.com. __ R-help@r-project.org mailing list https://stat.ethz.ch/mailman/listinfo/r-help PLEASE do read the posting guide http://www.R-project.org/posting-guide.html and provide commented, minimal, self-contained, reproducible code.
Re: [R] two indirect effects of path analysis
On 10/07/2012 02:17 AM, Elaine Kuo wrote: Hello, This is Elaine. I am trying a path analysis using lavaan Package. There are three explanatory variables: X, Z, and M. The response variable is Y. A, b, and c have direct effects on Y. On the other hand, X and Z also have direct effects on M. In other words, X and Z have indirect effects on Y. I found the code example of lavaan package describes only one indirect effect as below. Please kindly advise how to modify it as two indirect effects. You need to write down all the regressions that are involved in your model. For each 'dependent' variable, there is a regression formula: model - ' Y ~ X + Z + M M ~ X + Z ' Optionally, you can label the parameters, and define some indirect effects: model - ' Y ~ c1*X + c2*Z + b*M M ~ a1*X + a2*Z ab1 := a1*b ab2 := a2*b totalx := ab1 + c1 totalz := ab2 + c2 ' Hope this helps, Yves. __ R-help@r-project.org mailing list https://stat.ethz.ch/mailman/listinfo/r-help PLEASE do read the posting guide http://www.R-project.org/posting-guide.html and provide commented, minimal, self-contained, reproducible code.
Re: [R] vector is not assigned correctly in for loop
Thank you all for helping me out. As Michael points out, I abused the rounding and formatting of print() while debugging. The default number of digits to print is 7 according to ?print.default, which makes floating point numbers to be somewhat plausible for index vector subsetting at first glance: -- print(0.0001) [1] 1e-12 print(0.) [1] 1 -- However, since ?[ mentioned that numerics are coerced to integers in fact, it turns out to be an floating point issue. As Berend and Rui noted, it can be revealed by: -- print(0.0001, digits = 17) [1] 9.9998e-13 print(formatC(0.0001, format=f, 17)) [1] 0.00010 print(0., digits = 17) [1] 0.2 print(formatC(0., format=f, 17)) [1] 0.2 -- As we can see above, floating point number is a miracle, and there is still some magic with print(). :) BTW, I think this is a general issue, which should be carefully considered regardless of R or other languages. Have a nice day. Cheers, Guo [[alternative HTML version deleted]] __ R-help@r-project.org mailing list https://stat.ethz.ch/mailman/listinfo/r-help PLEASE do read the posting guide http://www.R-project.org/posting-guide.html and provide commented, minimal, self-contained, reproducible code.
Re: [R] Test for Random Points on a Sphere
Hi Lorenzo, Just a quick thought, the uniform probability density on a unit sphere is 1 / (4pi), what about binning those random points according to their directions and do a chi-square test? Regards, Guo On Sun, Oct 7, 2012 at 2:16 AM, cbe...@tajo.ucsd.edu wrote: Lorenzo Isella lorenzo.ise...@gmail.com writes: Dear All, I implemented an algorithm for (uniform) random rotations. In order to test it, I can apply it to a unit vector (0,0,1) in Cartesian coordinates. The result is supposed to be a set of random, uniformly distributed, points on a sphere (not the point of the algorithm, but a way to test it). This is what the points look like when I plot them, but other then eyeballing them, can anyone suggest a test to ensure that I am really generating uniform random points on a sphere? There is a substantial literature on this topic and more than one (metaphorical?) direction you could follow. I suggest you Google 'directional statistics' and start reading. Visit http://www.rseek.org and enter 'directional statistics' in the search box and click on the search button to see if there is something in R to meet your needs. A post to r-sig-geo might get more helpful responses once you can focus the question a bit more. HTH, Chuck Many thanks Lorenzo -- Charles C. BerryDept of Family/Preventive Medicine cberry at ucsd edu UC San Diego http://famprevmed.ucsd.edu/faculty/cberry/ La Jolla, San Diego 92093-0901 __ R-help@r-project.org mailing list https://stat.ethz.ch/mailman/listinfo/r-help PLEASE do read the posting guide http://www.R-project.org/posting-guide.html and provide commented, minimal, self-contained, reproducible code. [[alternative HTML version deleted]] __ R-help@r-project.org mailing list https://stat.ethz.ch/mailman/listinfo/r-help PLEASE do read the posting guide http://www.R-project.org/posting-guide.html and provide commented, minimal, self-contained, reproducible code.
[R] get: problem with environments
Dear R users, I am running R-2.15.1 in Linux Slackware64-14.0. Here is my minimal working example: testfun - function (x) { a - 0; sapply(X=a, FUN=get, envir=sys.frame(which=x)); } Inside R, that is R called from within a Linux terminal, the following code works: testfun(x=5) print(testfun(x=6)) But within rkward the above code fails and the following works: testfun(x=1) print(testfun(x=2)) As you can see, the number of contexts up the call stack that contain the variable a varies depending on the implementation. If I call testfun() from within print(), I have to go one context up the call stack than if I call testfun() alone by itself. This implies some inherent instability of my code. Actually I need to provide get() access to the calling environment of sapply(). According to the documentation of parent.frame(), The parent frame of a function evaluation is the environment in which the function was called. I tried to use parent.frame() instead of sys.frame() above, but the variable a is never found, regardless of what value I give to the parameter n of parent.frame(). I have basically three questions: 1. Do You have an idea how I could implement the code more stably, so that the variable a is always visible to get, regardless of whether testfun is used alone by itself or called from within another function? 2. Why does the implementation with parent.frame() not work? 3. Why does the number of contexts in the call stack differ in R and in rkward? It seems that when R is called from within the Linux terminal the call stack contains 4 contexts more that it does when is called from rkward. This also points to the instability of the code which I would like to solve. Any suggestions on any on the above questions will be greatly appreciated. Best regards, Martin __ R-help@r-project.org mailing list https://stat.ethz.ch/mailman/listinfo/r-help PLEASE do read the posting guide http://www.R-project.org/posting-guide.html and provide commented, minimal, self-contained, reproducible code.
Re: [R] get: problem with environments
On Sun, Oct 7, 2012 at 10:16 AM, Martin Ivanov tra...@abv.bg wrote: Dear R users, I am running R-2.15.1 in Linux Slackware64-14.0. Here is my minimal working example: testfun - function (x) { a - 0; sapply(X=a, FUN=get, envir=sys.frame(which=x)); } Inside R, that is R called from within a Linux terminal, the following code works: testfun(x=5) print(testfun(x=6)) But within rkward the above code fails and the following works: testfun(x=1) print(testfun(x=2)) As you can see, the number of contexts up the call stack that contain the variable a varies depending on the implementation. If I call testfun() from within print(), I have to go one context up the call stack than if I call testfun() alone by itself. This implies some inherent instability of my code. Unlike you, I don't get testfun(x = 5) to work in a terminal emulator. As expected, I only get x =1 and print(... x = 2) to work and I just tried this with R 2.15.0 and R devel, both in Terminal and by way of ESS. It could be a buglet introduced later into the 2.15 branch, but that seems unlikely. As expected, testfun(5) Error in sys.frame(which = x) : not that many frames on the stack Can someone else confirm the behavior you see? Cheers, Michael __ R-help@r-project.org mailing list https://stat.ethz.ch/mailman/listinfo/r-help PLEASE do read the posting guide http://www.R-project.org/posting-guide.html and provide commented, minimal, self-contained, reproducible code.
Re: [R] get: problem with environments
Hello, No, I can't confirm the behavior the op sees. I've tried it in an R terminal on ubuntu 12.04, rkward on ubuntu, and RGui on Windows 7. R version 2.15.1. Here's the rkward sessionInfo. sessionInfo() R version 2.15.1 (2012-06-22) Platform: x86_64-pc-linux-gnu (64-bit) locale: [1] LC_CTYPE=pt_PT.UTF-8 LC_NUMERIC=C [3] LC_TIME=pt_PT.UTF-8 LC_COLLATE=pt_PT.UTF-8 [5] LC_MONETARY=pt_PT.UTF-8 LC_MESSAGES=pt_PT.UTF-8 [7] LC_PAPER=pt_PT.UTF-8 LC_NAME=pt_PT.UTF-8 [9] LC_ADDRESS=pt_PT.UTF-8LC_TELEPHONE=pt_PT.UTF-8 [11] LC_MEASUREMENT=pt_PT.UTF-8LC_IDENTIFICATION=pt_PT.UTF-8 attached base packages: [1] stats graphics grDevices utils datasets methods base other attached packages: [1] rkward_0.5.6 loaded via a namespace (and not attached): [1] tools_2.15.1 Rui Barradas Em 07-10-2012 10:34, R. Michael Weylandt escreveu: On Sun, Oct 7, 2012 at 10:16 AM, Martin Ivanov tra...@abv.bg wrote: Dear R users, I am running R-2.15.1 in Linux Slackware64-14.0. Here is my minimal working example: testfun - function (x) { a - 0; sapply(X=a, FUN=get, envir=sys.frame(which=x)); } Inside R, that is R called from within a Linux terminal, the following code works: testfun(x=5) print(testfun(x=6)) But within rkward the above code fails and the following works: testfun(x=1) print(testfun(x=2)) As you can see, the number of contexts up the call stack that contain the variable a varies depending on the implementation. If I call testfun() from within print(), I have to go one context up the call stack than if I call testfun() alone by itself. This implies some inherent instability of my code. Unlike you, I don't get testfun(x = 5) to work in a terminal emulator. As expected, I only get x =1 and print(... x = 2) to work and I just tried this with R 2.15.0 and R devel, both in Terminal and by way of ESS. It could be a buglet introduced later into the 2.15 branch, but that seems unlikely. As expected, testfun(5) Error in sys.frame(which = x) : not that many frames on the stack Can someone else confirm the behavior you see? Cheers, Michael __ R-help@r-project.org mailing list https://stat.ethz.ch/mailman/listinfo/r-help PLEASE do read the posting guide http://www.R-project.org/posting-guide.html and provide commented, minimal, self-contained, reproducible code. __ R-help@r-project.org mailing list https://stat.ethz.ch/mailman/listinfo/r-help PLEASE do read the posting guide http://www.R-project.org/posting-guide.html and provide commented, minimal, self-contained, reproducible code.
Re: [R] get: problem with environments
Hi, I am getting the same error message as Michael got (R terminal (R 2.15) on Ubuntu 12.04). testfun(x=5) #Error in sys.frame(which = x) : not that many frames on the stack print(testfun(x=6)) #Error in sys.frame(which = x) : not that many frames on the stack A.K. - Original Message - From: R. Michael Weylandt michael.weyla...@gmail.com To: Martin Ivanov tra...@abv.bg Cc: r-help@r-project.org Sent: Sunday, October 7, 2012 5:34 AM Subject: Re: [R] get: problem with environments On Sun, Oct 7, 2012 at 10:16 AM, Martin Ivanov tra...@abv.bg wrote: Dear R users, I am running R-2.15.1 in Linux Slackware64-14.0. Here is my minimal working example: testfun - function (x) { a - 0; sapply(X=a, FUN=get, envir=sys.frame(which=x)); } Inside R, that is R called from within a Linux terminal, the following code works: testfun(x=5) print(testfun(x=6)) But within rkward the above code fails and the following works: testfun(x=1) print(testfun(x=2)) As you can see, the number of contexts up the call stack that contain the variable a varies depending on the implementation. If I call testfun() from within print(), I have to go one context up the call stack than if I call testfun() alone by itself. This implies some inherent instability of my code. Unlike you, I don't get testfun(x = 5) to work in a terminal emulator. As expected, I only get x =1 and print(... x = 2) to work and I just tried this with R 2.15.0 and R devel, both in Terminal and by way of ESS. It could be a buglet introduced later into the 2.15 branch, but that seems unlikely. As expected, testfun(5) Error in sys.frame(which = x) : not that many frames on the stack Can someone else confirm the behavior you see? Cheers, Michael __ R-help@r-project.org mailing list https://stat.ethz.ch/mailman/listinfo/r-help PLEASE do read the posting guide http://www.R-project.org/posting-guide.html and provide commented, minimal, self-contained, reproducible code. __ R-help@r-project.org mailing list https://stat.ethz.ch/mailman/listinfo/r-help PLEASE do read the posting guide http://www.R-project.org/posting-guide.html and provide commented, minimal, self-contained, reproducible code.
Re: [R] (no subject)
Hello, You must install the appropriate package(s). Try, for instance, install.packages('rugarch') # do this only once And then, every time you start an R session, if you want to use it, library(rugarch) # do this every R session To know more, try help('rugarch') vignette(package = 'rugarch') vignette('Introduction_to_the_rugarch_package', package = 'rugarch') The first 'vignette' instruction gives you a list of available vignettes, the second one opens the vignette file in a new window. Hope this helps, Rui Barradas Em 07-10-2012 11:05, mina izadi escreveu: Dear r-helper I am pleased to send you this email. I have the R 2.11.1 and R 2.15.1 versions but they dose't have GARCH models. May you please guide me in which version can i find GARCH models. Best. M.Izadi [[alternative HTML version deleted]] __ R-help@r-project.org mailing list https://stat.ethz.ch/mailman/listinfo/r-help PLEASE do read the posting guide http://www.R-project.org/posting-guide.html and provide commented, minimal, self-contained, reproducible code. __ R-help@r-project.org mailing list https://stat.ethz.ch/mailman/listinfo/r-help PLEASE do read the posting guide http://www.R-project.org/posting-guide.html and provide commented, minimal, self-contained, reproducible code.
[R] Computing for Data Analysis ~ R
Do to work schedules, I may have to discontinue. I really like this course and wish to finish. When is this course offered again, and if so, can I take again? Or, do we have to submit my even the hard deadlines? I can continue if we do not have to submit even by the hard deadline. I am the type of person, I have to understand what I am doing, but just memorizing and then performing. Thanks, Dr. Brenda Nelson-Porter [[alternative HTML version deleted]] __ R-help@r-project.org mailing list https://stat.ethz.ch/mailman/listinfo/r-help PLEASE do read the posting guide http://www.R-project.org/posting-guide.html and provide commented, minimal, self-contained, reproducible code.
Re: [R] get: problem with environments
On Sun, Oct 7, 2012 at 12:33 PM, Rui Barradas ruipbarra...@sapo.pt wrote: Hello, No, I can't confirm the behavior the op sees. I've tried it in an R terminal on ubuntu 12.04, rkward on ubuntu, and RGui on Windows 7. R version 2.15.1. Here's the rkward sessionInfo. sessionInfo() R version 2.15.1 (2012-06-22) Platform: x86_64-pc-linux-gnu (64-bit) On Sun, Oct 7, 2012 at 1:28 PM, arun smartpink...@yahoo.com wrote: I am getting the same error message as Michael got (R terminal (R 2.15) on Ubuntu 12.04). testfun(x=5) #Error in sys.frame(which = x) : not that many frames on the stack print(testfun(x=6)) #Error in sys.frame(which = x) : not that many frames on the stack From: R. Michael Weylandt michael.weyla...@gmail.com To: Martin Ivanov tra...@abv.bg Cc: r-help@r-project.org Sent: Sunday, October 7, 2012 5:34 AM Subject: Re: [R] get: problem with environments On Sun, Oct 7, 2012 at 10:16 AM, Martin Ivanov tra...@abv.bg wrote: Dear R users, I am running R-2.15.1 in Linux Slackware64-14.0. Here is my minimal working example: testfun - function (x) { a - 0; sapply(X=a, FUN=get, envir=sys.frame(which=x)); } Inside R, that is R called from within a Linux terminal, the following code works: testfun(x=5) print(testfun(x=6)) But within rkward the above code fails and the following works: testfun(x=1) print(testfun(x=2)) As you can see, the number of contexts up the call stack that contain the variable a varies depending on the implementation. If I call testfun() from within print(), I have to go one context up the call stack than if I call testfun() alone by itself. This implies some inherent instability of my code. Unlike you, I don't get testfun(x = 5) to work in a terminal emulator. As expected, I only get x =1 and print(... x = 2) to work and I just tried this with R 2.15.0 and R devel, both in Terminal and by way of ESS. It could be a buglet introduced later into the 2.15 branch, but that seems unlikely. As expected, testfun(5) Error in sys.frame(which = x) : not that many frames on the stack So this all suggests something very strange has happened to your setup, Martin. Does this persist after a new session (perhaps running as R --vanilla) and/or reinstall? To your original questions: 1. Do You have an idea how I could implement the code more stably, so that the variable a is always visible to get, regardless of whether testfun is used alone by itself or called from within another function? Well, you can do it without get() and just trust in the scoping rules to make it work. Depending on your application, this might simplify the code nicely. If you really do need to compute something on the fly, tricks like eval(parse(text = )), as.name(), call() etc might work, but they're occasionally difficult to get right. a - 54 eval(as.name(a)) + 2 testfun2 - function(n, letter) eval(as.name(letter)) + n testfun2(3, a) # 57 2. Why does the implementation with parent.frame() not work? You didn't show us how you tried to use parent.frame() 3. Why does the number of contexts in the call stack differ in R and in rkward? It shouldn't. This is an issue that needs further sorting out. Cheers, Michael __ R-help@r-project.org mailing list https://stat.ethz.ch/mailman/listinfo/r-help PLEASE do read the posting guide http://www.R-project.org/posting-guide.html and provide commented, minimal, self-contained, reproducible code.
Re: [R] Presence/ absence data from matrix to single column
The problem with that, is that I just wrote an example of my database, but I have around 250 species and more than 500 sites. In the approach you show me, it looks like I have to enter every species name and sites individually, right? -- View this message in context: http://r.789695.n4.nabble.com/Presence-absence-data-from-matrix-to-single-column-tp4645271p4645331.html Sent from the R help mailing list archive at Nabble.com. __ R-help@r-project.org mailing list https://stat.ethz.ch/mailman/listinfo/r-help PLEASE do read the posting guide http://www.R-project.org/posting-guide.html and provide commented, minimal, self-contained, reproducible code.
[R] a merge() problem
I know it does not look very good - using the same column names to mean different things in different data frames, but here you go: --8---cut here---start-8--- x - data.frame(a=c(1,2,3),b=c(4,5,6)) y - data.frame(b=c(1,2),a=c(a,b)) merge(x,y,by.x=a,by.y=b,all.x=TRUE,suffixes=c(,y)) a ba 1 1 4a 2 2 5b 3 3 6 NA Warning message: In merge.data.frame(x, y, by.x = a, by.y = b, all.x = TRUE) : column name 'a' is duplicated in the result --8---cut here---end---8--- why is the suffixes argument ignored? I mean, I expected that the second a to be a.y. (when I omit suffixes, the result is the same). Thanks. -- Sam Steingold (http://sds.podval.org/) on Ubuntu 12.04 (precise) X 11.0.11103000 http://www.childpsy.net/ http://palestinefacts.org http://honestreporting.com http://truepeace.org http://openvotingconsortium.org My name is Deja Vu. Have we met before? __ R-help@r-project.org mailing list https://stat.ethz.ch/mailman/listinfo/r-help PLEASE do read the posting guide http://www.R-project.org/posting-guide.html and provide commented, minimal, self-contained, reproducible code.
[R] Problem with national characters in main, xlab, ylab with pdf{grDevices} / postscript {grDevices}
Hello. I'm trying to make some graphics with nationalized labels (pdf for use in LaTeX document). On console (displayed on screen) using all looks ok: \/ data-rnorm(100) hist(data,main='Rozkład gęstości punktów', xlab='Wartość na osi y', ylab='Częstość występowania') ---/\ But using: ---\/ data-rnorm(100) pdf('plik.pdf',encoding=CP1250.enc) hist(data,main='Rozkład gęstości punktów', xlab='Wartość na osi y', ylab='Częstość występowania') dev.off() /\ It does not look fine ... Without specifying encoding: ---\/ pdf('plik-wo-enc.pdf') hist(data,main='Rozkład gęstości punktów', xlab='Wartość na osi y', ylab='Częstość występowania') dev.off() -/\ Almost does not have national characters. (Almost, because ó letter appears) Exemplary pdf file are here: https://www.drivehq.com/file/df.aspx/shareID10318887/fileID1167942261/plik.pdf https://www.drivehq.com/file/df.aspx/shareID10318887/fileID1167945977/plik-wo-enc.pdf I have read Non-Standard Fonts in PostScript and PDF Graphics by Paul Murrell and Brian Ripley in Rnews. I have also tried option with ---\/ Sys.setlocale(category=LC_CTYPE, locale=pl_PL.utf8) ---/\ but even in admin (run R as admin) in Win7 I received warning: ---\/ In Sys.setlocale(category = LC_CTYPE, locale = pl_PL.utf8) : Żądania raportów OS aby ustawić lokalizację na pl_PL.utf8 nie mogą zostać wykonane ---/\ (translated in short : OS report request to set locale to pl_PL.utf8 can not be done) Does anyone knows how to obtain pdf documents with acceptable quality? Thanks in advance, Regards -- /|/| _ _ _/_ /_ _ / / _ __ / |(/(/(/(/((-/)(/ ( /((/( /_ _/ Magdalena Tkacz __ R-help@r-project.org mailing list https://stat.ethz.ch/mailman/listinfo/r-help PLEASE do read the posting guide http://www.R-project.org/posting-guide.html and provide commented, minimal, self-contained, reproducible code.
Re: [R] get: problem with environments
Thank You very much for Your replies. Dear Michael, Does this persist after a new session (perhaps running as R --vanilla) and/or reinstall? Yes, it does. After running R --vanilla, still there are 4 contexts more on the call stack. You didn't show us how you tried to use parent.frame() I did it like this: testfun1 - function (x1) { a1 - 1; sapply(X=a1, FUN=get, envir=parent.frame(x1)); } testfun1(x1=1); The above code never succeeds no matter what a number I give to x1. 3. Why does the number of contexts in the call stack differ in R and in rkward? It shouldn't. This is an issue that needs further sorting out. Here is some more info on my setup: sessionInfo() R version 2.15.1 (2012-06-22) Platform: x86_64-slackware-linux-gnu (64-bit) locale: [1] LC_CTYPE=en_US LC_NUMERIC=C LC_TIME=en_US [4] LC_COLLATE=C LC_MONETARY=en_USLC_MESSAGES=en_US [7] LC_PAPER=C LC_NAME=CLC_ADDRESS=C [10] LC_TELEPHONE=C LC_MEASUREMENT=en_US LC_IDENTIFICATION=C attached base packages: [1] stats graphics grDevices utils datasets methods base loaded via a namespace (and not attached): [1] tools_2.15.1 Best regards, Martin __ R-help@r-project.org mailing list https://stat.ethz.ch/mailman/listinfo/r-help PLEASE do read the posting guide http://www.R-project.org/posting-guide.html and provide commented, minimal, self-contained, reproducible code.
Re: [R] Computing for Data Analysis ~ R
This is not the mailing list for any course. -- On Oct 7, 2012, at 12:27 AM, brigettebre...@aol.com wrote: Do to work schedules, I may have to discontinue. I really like this course and wish to finish. When is this course offered again, and if so, can I take again? Or, do we have to submit my even the hard deadlines? I can continue if we do not have to submit even by the hard deadline. I am the type of person, I have to understand what I am doing, but just memorizing and then performing. Thanks, Dr. Brenda Nelson-Porter [[alternative HTML version deleted]] -- David Winsemius, MD Alameda, CA, USA __ R-help@r-project.org mailing list https://stat.ethz.ch/mailman/listinfo/r-help PLEASE do read the posting guide http://www.R-project.org/posting-guide.html and provide commented, minimal, self-contained, reproducible code.
Re: [R] a merge() problem
On 2012-10-07 08:34, Sam Steingold wrote: I know it does not look very good - using the same column names to mean different things in different data frames, but here you go: --8---cut here---start-8--- x - data.frame(a=c(1,2,3),b=c(4,5,6)) y - data.frame(b=c(1,2),a=c(a,b)) merge(x,y,by.x=a,by.y=b,all.x=TRUE,suffixes=c(,y)) a ba 1 1 4a 2 2 5b 3 3 6 NA Warning message: In merge.data.frame(x, y, by.x = a, by.y = b, all.x = TRUE) : column name 'a' is duplicated in the result --8---cut here---end---8--- why is the suffixes argument ignored? I mean, I expected that the second a to be a.y. The 'suffixes' argument refers to _non-by_ names only (as per ?merge). Peter Ehlers (when I omit suffixes, the result is the same). Thanks. __ R-help@r-project.org mailing list https://stat.ethz.ch/mailman/listinfo/r-help PLEASE do read the posting guide http://www.R-project.org/posting-guide.html and provide commented, minimal, self-contained, reproducible code.
Re: [R] Problem with national characters in main, xlab, ylab with pdf{grDevices} / postscript {grDevices}
'National': not my nation, and none is stated. Somewhere in Eastern Europe ... Poland? Short answer: you need to use a family which contains those glyphs (try family='NimbusSan': the default 'Helvetica' does not) *and* a viewer that uses fonts that do. Longer answer: read ?pdf and ?postscript carefully, as they told you this and more. Your example works correctly with that family for me on Linux, but not with OS X viewers. It does not with the default family. For people on Unix I would suggest the cairo_pdf() device as a possibly easier alternative since it usually embeds fonts. On Windows and OS X you are at the mercy of what fonts cairo has access to. That's all in the help, too. On Sun, 7 Oct 2012, Magdalena A. Tkacz wrote: Hello. I'm trying to make some graphics with nationalized labels (pdf for use in LaTeX document). On console (displayed on screen) using all looks ok: \/ data-rnorm(100) hist(data,main='Rozkład gęstości punktów', xlab='Wartość na osi y', ylab='Częstość występowania') ---/\ But using: ---\/ data-rnorm(100) pdf('plik.pdf',encoding=CP1250.enc) hist(data,main='Rozkład gęstości punktów', xlab='Wartość na osi y', ylab='Częstość występowania') dev.off() /\ It does not look fine ... Actually it is just a binary file, and no viewer has been mentioned. Without specifying encoding: ---\/ pdf('plik-wo-enc.pdf') hist(data,main='Rozkład gęstości punktów', xlab='Wartość na osi y', ylab='Częstość występowania') dev.off() -/\ Almost does not have national characters. (Almost, because ó letter appears) Exemplary pdf file are here: https://www.drivehq.com/file/df.aspx/shareID10318887/fileID1167942261/plik.pdf https://www.drivehq.com/file/df.aspx/shareID10318887/fileID1167945977/plik-wo-enc.pdf I have read Non-Standard Fonts in PostScript and PDF Graphics by Paul Murrell and Brian Ripley in Rnews. I have also tried option with ---\/ Sys.setlocale(category=LC_CTYPE, locale=pl_PL.utf8) ---/\ but even in admin (run R as admin) in Win7 I received warning: ---\/ In Sys.setlocale(category = LC_CTYPE, locale = pl_PL.utf8) : Żądania raportów OS aby ustawić lokalizację na pl_PL.utf8 nie mogą zostać wykonane ---/\ (translated in short : OS report request to set locale to pl_PL.utf8 can not be done) Does anyone knows how to obtain pdf documents with acceptable quality? Thanks in advance, Regards -- /|/| _ _ _/_ /_ _ / / _ __ / |(/(/(/(/((-/)(/ ( /((/( /_ _/ Magdalena Tkacz __ R-help@r-project.org mailing list https://stat.ethz.ch/mailman/listinfo/r-help PLEASE do read the posting guide http://www.R-project.org/posting-guide.html and provide commented, minimal, self-contained, reproducible code. -- Brian D. Ripley, rip...@stats.ox.ac.uk Professor of Applied Statistics, http://www.stats.ox.ac.uk/~ripley/ University of Oxford, Tel: +44 1865 272861 (self) 1 South Parks Road, +44 1865 272866 (PA) Oxford OX1 3TG, UKFax: +44 1865 272595__ R-help@r-project.org mailing list https://stat.ethz.ch/mailman/listinfo/r-help PLEASE do read the posting guide http://www.R-project.org/posting-guide.html and provide commented, minimal, self-contained, reproducible code.
[R] Testing volatility cluster (heteroscedasticity) in stock return?
Dear All, i want to use garch model in return of stock. and the data should presence volatility cluster (Heteroscedasticity). Do you know how to test volatility cluster (the presence of heteroscedasticity) in series data of stock return in R? Is it using Langrange Multiplier (LM) ARCH test? what package i should use? I really need the help. Thanks for the attention. Eko A P __ R-help@r-project.org mailing list https://stat.ethz.ch/mailman/listinfo/r-help PLEASE do read the posting guide http://www.R-project.org/posting-guide.html and provide commented, minimal, self-contained, reproducible code.
Re: [R] a merge() problem
Hi, Though, this does give the result you wanted when the column names are the same. y1-y colnames(y1)-c(a,b) merge(x,y1,by=a,all=TRUE,suffixes=c(,.y)) # a b b.y #1 1 4 a #2 2 5 b #3 3 6 NA A.K. - Original Message - From: Sam Steingold s...@gnu.org To: r-help@r-project.org Cc: Sent: Sunday, October 7, 2012 11:34 AM Subject: [R] a merge() problem I know it does not look very good - using the same column names to mean different things in different data frames, but here you go: --8---cut here---start-8--- x - data.frame(a=c(1,2,3),b=c(4,5,6)) y - data.frame(b=c(1,2),a=c(a,b)) merge(x,y,by.x=a,by.y=b,all.x=TRUE,suffixes=c(,y)) a b a 1 1 4 a 2 2 5 b 3 3 6 NA Warning message: In merge.data.frame(x, y, by.x = a, by.y = b, all.x = TRUE) : column name 'a' is duplicated in the result --8---cut here---end---8--- why is the suffixes argument ignored? I mean, I expected that the second a to be a.y. (when I omit suffixes, the result is the same). Thanks. -- Sam Steingold (http://sds.podval.org/) on Ubuntu 12.04 (precise) X 11.0.11103000 http://www.childpsy.net/ http://palestinefacts.org http://honestreporting.com http://truepeace.org http://openvotingconsortium.org My name is Deja Vu. Have we met before? __ R-help@r-project.org mailing list https://stat.ethz.ch/mailman/listinfo/r-help PLEASE do read the posting guide http://www.R-project.org/posting-guide.html and provide commented, minimal, self-contained, reproducible code. __ R-help@r-project.org mailing list https://stat.ethz.ch/mailman/listinfo/r-help PLEASE do read the posting guide http://www.R-project.org/posting-guide.html and provide commented, minimal, self-contained, reproducible code.
Re: [R] Testing volatility cluster (heteroscedasticity) in stock return?
Hi Eko, Please don't cross-post to both R-Help and R-SIG-Finance. Michael On Sun, Oct 7, 2012 at 6:49 PM, Eko andryanto Prakasa eko.prak...@yahoo.com wrote: Dear All, i want to use garch model in return of stock. and the data should presence volatility cluster (Heteroscedasticity). Do you know how to test volatility cluster (the presence of heteroscedasticity) in series data of stock return in R? Is it using Langrange Multiplier (LM) ARCH test? what package i should use? I really need the help. Thanks for the attention. Eko A P __ R-help@r-project.org mailing list https://stat.ethz.ch/mailman/listinfo/r-help PLEASE do read the posting guide http://www.R-project.org/posting-guide.html and provide commented, minimal, self-contained, reproducible code. __ R-help@r-project.org mailing list https://stat.ethz.ch/mailman/listinfo/r-help PLEASE do read the posting guide http://www.R-project.org/posting-guide.html and provide commented, minimal, self-contained, reproducible code.
Re: [R] a merge() problem
On 2012-10-07 10:50, arun wrote: Hi, Though, this does give the result you wanted when the column names are the same. y1-y colnames(y1)-c(a,b) merge(x,y1,by=a,all=TRUE,suffixes=c(,.y)) # a b b.y #1 1 4a #2 2 5b #3 3 6 NA A.K. Yes, because 'b' is _not_ a 'by'-name. Peter Ehlers - Original Message - From: Sam Steingold s...@gnu.org To: r-help@r-project.org Cc: Sent: Sunday, October 7, 2012 11:34 AM Subject: [R] a merge() problem I know it does not look very good - using the same column names to mean different things in different data frames, but here you go: --8---cut here---start-8--- x - data.frame(a=c(1,2,3),b=c(4,5,6)) y - data.frame(b=c(1,2),a=c(a,b)) merge(x,y,by.x=a,by.y=b,all.x=TRUE,suffixes=c(,y)) a ba 1 1 4a 2 2 5b 3 3 6 NA Warning message: In merge.data.frame(x, y, by.x = a, by.y = b, all.x = TRUE) : column name 'a' is duplicated in the result --8---cut here---end---8--- why is the suffixes argument ignored? I mean, I expected that the second a to be a.y. (when I omit suffixes, the result is the same). Thanks. __ R-help@r-project.org mailing list https://stat.ethz.ch/mailman/listinfo/r-help PLEASE do read the posting guide http://www.R-project.org/posting-guide.html and provide commented, minimal, self-contained, reproducible code.
Re: [R] Presence/ absence data from matrix to single column
Hello, I haven't been following this thread but apparently the answer to your worries is no. You can use a combination of names() and grep() to sort it out. something like #nms - names(adat) nms - c(Year, Route, Point, paste0(Sp, 1:250)) pattern - ^Sp[[:digit:]]+$ whichCols - grep(pattern, nms) whichNames - nms[whichCols] reshape(..., varying = whichCols, times = whichNames, ...) Hope this helps, Rui Barradas Em 07-10-2012 15:35, agoijman escreveu: The problem with that, is that I just wrote an example of my database, but I have around 250 species and more than 500 sites. In the approach you show me, it looks like I have to enter every species name and sites individually, right? -- View this message in context: http://r.789695.n4.nabble.com/Presence-absence-data-from-matrix-to-single-column-tp4645271p4645331.html Sent from the R help mailing list archive at Nabble.com. __ R-help@r-project.org mailing list https://stat.ethz.ch/mailman/listinfo/r-help PLEASE do read the posting guide http://www.R-project.org/posting-guide.html and provide commented, minimal, self-contained, reproducible code. __ R-help@r-project.org mailing list https://stat.ethz.ch/mailman/listinfo/r-help PLEASE do read the posting guide http://www.R-project.org/posting-guide.html and provide commented, minimal, self-contained, reproducible code.
Re: [R] Testing volatility cluster (heteroscedasticity) in stock return?
Hi Michael, I'm sorry for the mistake.. i don't know if it's not permitted to sent the same message to both (r-help and r-sig) Thank's a lot for the information... Eko - Original Message - From: R. Michael Weylandt michael.weyla...@gmail.com To: Eko andryanto Prakasa eko.prak...@yahoo.com Cc: r-help@R-project.org r-help@r-project.org Sent: Monday, October 8, 2012 12:56 AM Subject: Re: [R] Testing volatility cluster (heteroscedasticity) in stock return? Hi Eko, Please don't cross-post to both R-Help and R-SIG-Finance. Michael On Sun, Oct 7, 2012 at 6:49 PM, Eko andryanto Prakasa eko.prak...@yahoo.com wrote: Dear All, i want to use garch model in return of stock. and the data should presence volatility cluster (Heteroscedasticity). Do you know how to test volatility cluster (the presence of heteroscedasticity) in series data of stock return in R? Is it using Langrange Multiplier (LM) ARCH test? what package i should use? I really need the help. Thanks for the attention. Eko A P __ R-help@r-project.org mailing list https://stat.ethz.ch/mailman/listinfo/r-help PLEASE do read the posting guide http://www.R-project.org/posting-guide.html and provide commented, minimal, self-contained, reproducible code. __ R-help@r-project.org mailing list https://stat.ethz.ch/mailman/listinfo/r-help PLEASE do read the posting guide http://www.R-project.org/posting-guide.html and provide commented, minimal, self-contained, reproducible code.
Re: [R] Presence/ absence data from matrix to single column
Hi, I guess you are not talking about the melt() method. dat1-read.table(text= Year Route Point Sp1 Sp2 Sp3 2004 123 123-1 0 1 0 2004 123 123-2 0 1 1 2004 123 123-10 1 1 0 ,header=TRUE,sep=,stringsAsFactors=FALSE) #If all the Sp columns are located next to another as shown in your example dataset, then you can also try this: name1-unlist(strsplit(paste(colnames(dat1)[4:6],collapse= ), )) reshape(dat1,varying=4:6,v.name=Sp-value,times=name1,timevar=Sp-name,idvar=c(Year,Route,Point),direction=long) A.K. - Original Message - From: Rui Barradas ruipbarra...@sapo.pt To: agoijman agoij...@cnia.inta.gov.ar Cc: r-help@r-project.org Sent: Sunday, October 7, 2012 2:32 PM Subject: Re: [R] Presence/ absence data from matrix to single column Hello, I haven't been following this thread but apparently the answer to your worries is no. You can use a combination of names() and grep() to sort it out. something like #nms - names(adat) nms - c(Year, Route, Point, paste0(Sp, 1:250)) pattern - ^Sp[[:digit:]]+$ whichCols - grep(pattern, nms) whichNames - nms[whichCols] reshape(..., varying = whichCols, times = whichNames, ...) Hope this helps, Rui Barradas Em 07-10-2012 15:35, agoijman escreveu: The problem with that, is that I just wrote an example of my database, but I have around 250 species and more than 500 sites. In the approach you show me, it looks like I have to enter every species name and sites individually, right? -- View this message in context: http://r.789695.n4.nabble.com/Presence-absence-data-from-matrix-to-single-column-tp4645271p4645331.html Sent from the R help mailing list archive at Nabble.com. __ R-help@r-project.org mailing list https://stat.ethz.ch/mailman/listinfo/r-help PLEASE do read the posting guide http://www.R-project.org/posting-guide.html and provide commented, minimal, self-contained, reproducible code. __ R-help@r-project.org mailing list https://stat.ethz.ch/mailman/listinfo/r-help PLEASE do read the posting guide http://www.R-project.org/posting-guide.html and provide commented, minimal, self-contained, reproducible code. __ R-help@r-project.org mailing list https://stat.ethz.ch/mailman/listinfo/r-help PLEASE do read the posting guide http://www.R-project.org/posting-guide.html and provide commented, minimal, self-contained, reproducible code.
Re: [R] Problem with national characters in main, xlab, ylab with pdf{grDevices} / postscript {grDevices}
Hello. Yes, you're right -Poland, Central/Eastern Europe. My apologies - my fault - not to state it directly in post. Than you for your advice, especially concerning viewer (when OS is Win). Under Windows (checked both on english and polish version of OS) works fine with font family you proposed, previewed with Sumatra PDF or TeXworks internal viewer (Adobe Reader does NOT display generated pdf correctly ). On my Linux workstation, cairo_pdf(fileName.pdf) works OK without any additional parameters, both Okular and Document Viewer also works fine as a viewers. Thank You very much. Problem solved. Regards Magdalena Tkacz 2012/10/7 Prof Brian Ripley rip...@stats.ox.ac.uk: 'National': not my nation, and none is stated. Somewhere in Eastern Europe ... Poland? Short answer: you need to use a family which contains those glyphs (try family='NimbusSan': the default 'Helvetica' does not) *and* a viewer that uses fonts that do. Longer answer: read ?pdf and ?postscript carefully, as they told you this and more. Your example works correctly with that family for me on Linux, but not with OS X viewers. It does not with the default family. For people on Unix I would suggest the cairo_pdf() device as a possibly easier alternative since it usually embeds fonts. On Windows and OS X you are at the mercy of what fonts cairo has access to. That's all in the help, too. On Sun, 7 Oct 2012, Magdalena A. Tkacz wrote: Hello. I'm trying to make some graphics with nationalized labels (pdf for use in LaTeX document). On console (displayed on screen) using all looks ok: \/ data-rnorm(100) hist(data,main='Rozkład gęstości punktów', xlab='Wartość na osi y', ylab='Częstość występowania') ---/\ But using: ---\/ data-rnorm(100) pdf('plik.pdf',encoding=CP1250.enc) hist(data,main='Rozkład gęstości punktów', xlab='Wartość na osi y', ylab='Częstość występowania') dev.off() /\ It does not look fine ... Actually it is just a binary file, and no viewer has been mentioned. Without specifying encoding: ---\/ pdf('plik-wo-enc.pdf') hist(data,main='Rozkład gęstości punktów', xlab='Wartość na osi y', ylab='Częstość występowania') dev.off() -/\ Almost does not have national characters. (Almost, because ó letter appears) Exemplary pdf file are here: https://www.drivehq.com/file/df.aspx/shareID10318887/fileID1167942261/plik.pdf https://www.drivehq.com/file/df.aspx/shareID10318887/fileID1167945977/plik-wo-enc.pdf I have read Non-Standard Fonts in PostScript and PDF Graphics by Paul Murrell and Brian Ripley in Rnews. I have also tried option with ---\/ Sys.setlocale(category=LC_CTYPE, locale=pl_PL.utf8) ---/\ but even in admin (run R as admin) in Win7 I received warning: ---\/ In Sys.setlocale(category = LC_CTYPE, locale = pl_PL.utf8) : Żądania raportów OS aby ustawić lokalizację na pl_PL.utf8 nie mogą zostać wykonane ---/\ (translated in short : OS report request to set locale to pl_PL.utf8 can not be done) Does anyone knows how to obtain pdf documents with acceptable quality? Thanks in advance, Regards -- /|/| _ _ _/_ /_ _ / / _ __ / |(/(/(/(/((-/)(/ ( /((/( /_ _/ Magdalena Tkacz __ R-help@r-project.org mailing list https://stat.ethz.ch/mailman/listinfo/r-help PLEASE do read the posting guide http://www.R-project.org/posting-guide.html and provide commented, minimal, self-contained, reproducible code. -- Brian D. Ripley, rip...@stats.ox.ac.uk Professor of Applied Statistics, http://www.stats.ox.ac.uk/~ripley/ University of Oxford, Tel: +44 1865 272861 (self) 1 South Parks Road, +44 1865 272866 (PA) Oxford OX1 3TG, UKFax: +44 1865 272595 -- /|/| _ _ _/_ /_ _ / / _ __ / |(/(/(/(/((-/)(/ ( /((/( /_ _/ Magdalena Tkacz __ R-help@r-project.org mailing list https://stat.ethz.ch/mailman/listinfo/r-help PLEASE do read the posting guide http://www.R-project.org/posting-guide.html and provide commented, minimal, self-contained, reproducible code.
[R] gam error message: matrix not +ve definite
Hello, I'm running a multimodel analysis which involves fitting several GAM models as implemented in package mgcv. The issue I'm having is that when I try to fit my model, gam gives me the following error message: 'Error in initial.sp(w * X, S, off) : S[[2]] matrix is not +ve definite.' The strange part of this is that the error message stops my model fitting function when run on a linux platform, but not on my local windows machine. Ordinarily I would just run the analysis on my local machine, but I need to run this from the linux machine to take advantage of the much larger computing capacity. The version of mgcv(1.7-21) and R (2.15.1) is the same on both machines. The data set to which the model if fitted is too large to post here but it contains 2209 observations, and the model is of the form: gam(Response~Year + s(Dayofyear,k=5,bs='cc') + s(Longitude,Latitude,k=4) + s(Coast_distance,k=4), family=Gamma('log'), data=dat, gamma=1.4) I realize this is a very particular question, but any help would be really appreciated. Thanks, Dan. -- View this message in context: http://r.789695.n4.nabble.com/gam-error-message-matrix-not-ve-definite-tp4645329.html Sent from the R help mailing list archive at Nabble.com. __ R-help@r-project.org mailing list https://stat.ethz.ch/mailman/listinfo/r-help PLEASE do read the posting guide http://www.R-project.org/posting-guide.html and provide commented, minimal, self-contained, reproducible code.
[R] BioConductor package: 'oligo'
Dear Help, After loading the pd.Citrus library and checking the DataFrame, I ran the R code for: 1) 'oligo' { library(pd.citrus) Loading required package: RSQLite Loading required package: DBI data(pmSequence) show(pmSequence) DataFrame with 341730 rows and 2 columns fid sequence integer DNAStringSet 1 990 GCGGAACGATGGCGATGGCTA 2 991 CGACGGGTTGCCTTCGGAGCTAAAT 3 992 TACTGCAGAAGACCATTACCCTACA 4 993 TCACATAGCTGTGCAAGGACCGTAT 5 994 TCGCCTAGCAAAGCTGCCAGCATGT 6 995 TTACGTCTACGTGGTGGTGCTAAGA 7 996 CCGAACGACCTGTTGGACCAAAGCA 8 999 AAGCTAGTCTAGCTCCACCGACGGC 9 1000 CACCGGTGACGTGCCGGTCGC ... ... ... 341722 963599 AAATTCGACACTTTACTGAGA 341723 963790 GGATGCCCTCCGGTAATTGAATCAT 341724 963802 GTTCAGCTCAAACCCTACATAGAGA 341725 963818 GGATGTCTCAACCAGCTGGTT 341726 963841 GAGAAGATGTTCAGAGGGCCCTACA 341727 963859 GGTGCAGTTCGACTCTAAGTTTGCT 341728 963863 AAACACGGTTATTCATCTGCGAAAC 341729 963874 GATGCTCTTCATTGGGAGGCAGCGA 341730 963889 ATTGATACAGCCTTCTCTGCAGTAA getwd() [1] C:/Users/franklin.johnson.PW50-WEN/Desktop/GSE33964_citrus epi cells/exData} {library(oligo) celFiles-list.celfiles(exData, full.names=TRUE) affyCit-read.celfiles(GSM839728_GF_28mm_EC-1.CEL, GSM839729_GF_28mm_EC-2.CEL, GSM839730_GF_28mm_EC-3.CEL, GSM839731_GF_28mm_PC-1.CEL, GSM839732_GF_28mm_PC-2.CEL, GSM839733_GF_28mm_PC-3.CEL, GSM839734_GF_41mm_EC-1.CEL, GSM839735_GF_41mm_EC-2.CEL, GSM839736_GF_41mm_EC-3.CEL, GSM839737_GF_41mm_PC-1.CEL, GSM839738_GF_41mm_PC-2.CEL, GSM839739_GF_41mm_PC-3.CEL, pkgname=pd.citrus) Platform design info loaded. Reading in : GSM839728_GF_28mm_EC-1.CEL Reading in : GSM839729_GF_28mm_EC-2.CEL Reading in : GSM839730_GF_28mm_EC-3.CEL Reading in : GSM839731_GF_28mm_PC-1.CEL Reading in : GSM839732_GF_28mm_PC-2.CEL Reading in : GSM839733_GF_28mm_PC-3.CEL Reading in : GSM839734_GF_41mm_EC-1.CEL Reading in : GSM839735_GF_41mm_EC-2.CEL Reading in : GSM839736_GF_41mm_EC-3.CEL Reading in : GSM839737_GF_41mm_PC-1.CEL Reading in : GSM839738_GF_41mm_PC-2.CEL Reading in : GSM839739_GF_41mm_PC-3.CEL pmSeq-pmSequence(affyCit) pmSeq[1:10] A DNAStringSet instance of length 10 width seq [1] 25 GCGGAACGATGGCGATGGCTA [2] 25 CGACGGGTTGCCTTCGGAGCTAAAT [3] 25 TACTGCAGAAGACCATTACCCTACA [4] 25 TCACATAGCTGTGCAAGGACCGTAT [5] 25 TCGCCTAGCAAAGCTGCCAGCATGT [6] 25 TTACGTCTACGTGGTGGTGCTAAGA [7] 25 CCGAACGACCTGTTGGACCAAAGCA [8] 25 AAGCTAGTCTAGCTCCACCGACGGC [9] 25 CACCGGTGACGTGCCGGTCGC [10] 25 GGTTAAGCCCGGCACTATCCGGGCA pmsLog2-log2(pm(affyCit)) plot(pmsLog2) #the plots looks good across arrays (object=affyCit) However, still get: coefs-getAffinitySplineCoefficients(pmsLog2, pmSeq) Error in model.frame.default(formula = intensities ~ design, drop.unused.levels = TRUE) : variable lengths differ (found for 'design') sessionInfo() R version 2.15.1 (2012-06-22) Platform: i386-pc-mingw32/i386 (32-bit) locale: [1] LC_COLLATE=English_United States.1252 [2] LC_CTYPE=English_United States.1252 [3] LC_MONETARY=English_United States.1252 [4] LC_NUMERIC=C [5] LC_TIME=English_United States.1252 attached base packages: [1] stats graphics grDevices utils datasets methods base other attached packages: [1] oligo_1.22.0Biobase_2.18.0 oligoClasses_1.20.0 [4] BiocInstaller_1.8.1 BiocGenerics_0.4.0 loaded via a namespace (and not attached): [1] affxparser_1.30.0 affyio_1.26.0 Biostrings_2.26.1 [4] bit_1.1-8 codetools_0.2-8 DBI_0.2-5 [7] ff_2.2-7 foreach_1.4.0 GenomicRanges_1.10.1 [10] IRanges_1.16.2iterators_1.0.6 parallel_2.15.1 [13] preprocessCore_1.20.0 splines_2.15.1stats4_2.15.1 [16] tools_2.15.1 zlibbioc_1.4.0 I have been working on the issue for two weeks already. For example, above I loaded the Citrus.pd, additionally, I tried working with library(citruscdf), although this did not work either? Moreover, I used R 2.6 with the devel 'affyio' package version 1.27.1, but cannot run 'oligo' with R 2.6 for some reason (i.e. error in list.celFiles and read.celfiles commands), although R version for 'oligo' is 2.15 or greater, so cannot use the list matrix generated in 'affyio' version 1.27 on R 2.6 cause is does not seem compatible with 'oligo' version 1.22 on R 2.6. I am also using the recently updated BioC version 2.11. In oligo using R v. 2.15, I am able to view the .CEL images, make boxplots, MAplots of the data, but cannot proceed beyond this point (as indicated above). In summary, is this a bug in the 'oligo' package?? Any assistance is greatly appreciated. If you have questions or need additional information, please feel free to contact me. Best Regards, Franklin [[alternative HTML version deleted]] __ R-help@r-project.org mailing list https://stat.ethz.ch/mailman/listinfo/r-help PLEASE do read the posting guide http://www.R-project.org/posting-guide.html and provide
Re: [R] Format of numbers in plotmath expressions.
In-line comments below. Bill Dunlap Spotfire, TIBCO Software wdunlap tibco.com -Original Message- From: r-help-boun...@r-project.org [mailto:r-help-boun...@r-project.org] On Behalf Of Rolf Turner Sent: Friday, October 05, 2012 5:02 PM To: Uwe Ligges Cc: r-help@r-project.org Subject: Re: [R] Format of numbers in plotmath expressions. Thanks Uwe. I think your recipe is substantially sexier than mine. However I will, I believe, ***NEVER*** understand how to put together plotmath constructs. They seem to require some subset of: * expression() * bquote() * substitute() * parse() Note that using parse was one source of your original problem. You did the equivalent of parse(text=paste(theta, 1., sep===)) which gives the same result as parse(text=paste(theta, 1, sep===)) because x==1. and x==1 should be parsed to be the same expression. If you wanted the string 1. to come out of parse then you would have to quote it, as in legend(topleft,pch=1:5,legend=parse(text=paste0(theta == \,TH,\))) instead of your original legend(topleft,pch=1:5,legend=parse(text=paste0(theta == , TH))) This works because plotmath does not render the quotes in strings. I would recommend taking parse(), paste(), substitute(), and even expression() off your list of things to try when using plotmath. For single chunks of plotmath text, isn't bquote() sufficient? For multiple chunks (e.g., the strings given to legend or axis) I think you can restrict yourself to the idiom as.expression(lapply(data, function(d)bquote(...))) mapply would be fine here also, but I would avoid sapply, as its simplification algorithm can surprise you. expression() is good when you have a fixed (parameterless) expression you want to display, but bquote is just as good, so don't bother thinking about using expression() in plotmath. Here is an example of mapply used to make axis tick labels of the form num * pi / den, leaving out unneeded 1's, and related legend labels: curve(sin, from=0, to=6.5, axes=FALSE) num - 0:8 ; den - 4 # want labels num * pi / den, simplified when possible labs - as.expression(mapply(num, den, SIMPLIFY=FALSE, FUN=function(n, d) { gcd - function(a,b) ifelse (b==0, a, gcd(b, a %% b)) div - gcd(n, d) if (div 1) { n - n / div ; d - d / div } if (n==0) { bquote(0) } else if (d==1) { if (n==1) { bquote(pi) } else { bquote(.(n)*pi) } } else { if (n==1) { bquote(pi/.(d)) } else { bquote(.(n)*pi/.(d)) } } } )) axis(side=1, at=num*pi/den, lab=labs) # Now put theta= on the front of each label for the legend legend(bottomleft, as.expression(lapply(labs, function(lab)bquote(theta==.(lab) I am not an expert on plotmath, but my feeling from watching people use it is that they tend to lose track of the boundary between standard R functions and the functions by the same name used by plotmath for different purposes By sticking to using bquote() for creating single plotmath exressions and as.expression(lapply(..., function(x)bquote(.(x for collections of plotmath expressions, you can concentrate on the learning the plotmath language itself. Are there plotmath expressions that cannot be made with bquote instead of parse(text=paste(...))? Perhaps not, but some with a variable number of components may be more easily done with parse. * paste() * as.expression() * .(...) (and quite possibly other things that I have forgotten) in a bewildering variety of combinations with no perceptible rationale as what combination is required in what circumstances. It makes quantum mechanics look simple by comparison. cheers, Rolf On 06/10/12 06:58, Uwe Ligges wrote: On 05.10.2012 09:30, Rolf Turner wrote: I want to do something like: TH - sprintf(%1.1f,c(0.3,0.5,0.7,0.9,1)) plot(1:10) legend(bottomright,pch=1:5,legend=parse(text=paste(theta ==,TH))) Notice that the final 1 comes out in the legend as just plain 1 and NOT as 1.0 although TH is [1] 0.3 0.5 0.7 0.9 1.0 I can get plotmath to preserve 1.0 as 1.0 and NOT convert it to 1 if I use substitute, as in text(2,5,labels=substitute(list(theta == a),list(a=TH[5]))) but substitute doesn't work appropriately with vectors. Can anyone tell me how to get a 1.0 rather than 1 in the legend? Ta. cheers, Rolf Turner P.S. Just figured out a way using sapply(): leg - sapply(TH,function(x){substitute(list(theta == a),list(a=x))}) plot(1:10) legend(bottomright,pch=1:5,legend=parse(text=leg)) Note that the use of parse (pace Thomas Lumley! :-) ) is required --- legend=leg does NOT work. Getting here required an enormous amount of trial and error. And it
Re: [R] BioConductor package: 'oligo'
Hi Franklin, As you note, this is a bioconductor package, and they have a separate mailing list for support (fully of terribly knowledgeable and responsive folks) I know it's somewhat unpleasant to be told to look elsewhere after you've spent a good amount of time on it already, but I think it's worth your time to repost to that list: http://www.bioconductor.org/help/mailing-list/mailform/ Cheers, Michael On Sun, Oct 7, 2012 at 5:22 PM, Johnson, Franklin Theodore franklin.john...@email.wsu.edu wrote: Dear Help, After loading the pd.Citrus library and checking the DataFrame, I ran the R code for: 1) 'oligo' { library(pd.citrus) Loading required package: RSQLite Loading required package: DBI data(pmSequence) show(pmSequence) DataFrame with 341730 rows and 2 columns fid sequence integer DNAStringSet 1 990 GCGGAACGATGGCGATGGCTA 2 991 CGACGGGTTGCCTTCGGAGCTAAAT 3 992 TACTGCAGAAGACCATTACCCTACA 4 993 TCACATAGCTGTGCAAGGACCGTAT 5 994 TCGCCTAGCAAAGCTGCCAGCATGT 6 995 TTACGTCTACGTGGTGGTGCTAAGA 7 996 CCGAACGACCTGTTGGACCAAAGCA 8 999 AAGCTAGTCTAGCTCCACCGACGGC 9 1000 CACCGGTGACGTGCCGGTCGC ... ... ... 341722 963599 AAATTCGACACTTTACTGAGA 341723 963790 GGATGCCCTCCGGTAATTGAATCAT 341724 963802 GTTCAGCTCAAACCCTACATAGAGA 341725 963818 GGATGTCTCAACCAGCTGGTT 341726 963841 GAGAAGATGTTCAGAGGGCCCTACA 341727 963859 GGTGCAGTTCGACTCTAAGTTTGCT 341728 963863 AAACACGGTTATTCATCTGCGAAAC 341729 963874 GATGCTCTTCATTGGGAGGCAGCGA 341730 963889 ATTGATACAGCCTTCTCTGCAGTAA getwd() [1] C:/Users/franklin.johnson.PW50-WEN/Desktop/GSE33964_citrus epi cells/exData} {library(oligo) celFiles-list.celfiles(exData, full.names=TRUE) affyCit-read.celfiles(GSM839728_GF_28mm_EC-1.CEL, GSM839729_GF_28mm_EC-2.CEL, GSM839730_GF_28mm_EC-3.CEL, GSM839731_GF_28mm_PC-1.CEL, GSM839732_GF_28mm_PC-2.CEL, GSM839733_GF_28mm_PC-3.CEL, GSM839734_GF_41mm_EC-1.CEL, GSM839735_GF_41mm_EC-2.CEL, GSM839736_GF_41mm_EC-3.CEL, GSM839737_GF_41mm_PC-1.CEL, GSM839738_GF_41mm_PC-2.CEL, GSM839739_GF_41mm_PC-3.CEL, pkgname=pd.citrus) Platform design info loaded. Reading in : GSM839728_GF_28mm_EC-1.CEL Reading in : GSM839729_GF_28mm_EC-2.CEL Reading in : GSM839730_GF_28mm_EC-3.CEL Reading in : GSM839731_GF_28mm_PC-1.CEL Reading in : GSM839732_GF_28mm_PC-2.CEL Reading in : GSM839733_GF_28mm_PC-3.CEL Reading in : GSM839734_GF_41mm_EC-1.CEL Reading in : GSM839735_GF_41mm_EC-2.CEL Reading in : GSM839736_GF_41mm_EC-3.CEL Reading in : GSM839737_GF_41mm_PC-1.CEL Reading in : GSM839738_GF_41mm_PC-2.CEL Reading in : GSM839739_GF_41mm_PC-3.CEL pmSeq-pmSequence(affyCit) pmSeq[1:10] A DNAStringSet instance of length 10 width seq [1] 25 GCGGAACGATGGCGATGGCTA [2] 25 CGACGGGTTGCCTTCGGAGCTAAAT [3] 25 TACTGCAGAAGACCATTACCCTACA [4] 25 TCACATAGCTGTGCAAGGACCGTAT [5] 25 TCGCCTAGCAAAGCTGCCAGCATGT [6] 25 TTACGTCTACGTGGTGGTGCTAAGA [7] 25 CCGAACGACCTGTTGGACCAAAGCA [8] 25 AAGCTAGTCTAGCTCCACCGACGGC [9] 25 CACCGGTGACGTGCCGGTCGC [10] 25 GGTTAAGCCCGGCACTATCCGGGCA pmsLog2-log2(pm(affyCit)) plot(pmsLog2) #the plots looks good across arrays (object=affyCit) However, still get: coefs-getAffinitySplineCoefficients(pmsLog2, pmSeq) Error in model.frame.default(formula = intensities ~ design, drop.unused.levels = TRUE) : variable lengths differ (found for 'design') sessionInfo() R version 2.15.1 (2012-06-22) Platform: i386-pc-mingw32/i386 (32-bit) locale: [1] LC_COLLATE=English_United States.1252 [2] LC_CTYPE=English_United States.1252 [3] LC_MONETARY=English_United States.1252 [4] LC_NUMERIC=C [5] LC_TIME=English_United States.1252 attached base packages: [1] stats graphics grDevices utils datasets methods base other attached packages: [1] oligo_1.22.0Biobase_2.18.0 oligoClasses_1.20.0 [4] BiocInstaller_1.8.1 BiocGenerics_0.4.0 loaded via a namespace (and not attached): [1] affxparser_1.30.0 affyio_1.26.0 Biostrings_2.26.1 [4] bit_1.1-8 codetools_0.2-8 DBI_0.2-5 [7] ff_2.2-7 foreach_1.4.0 GenomicRanges_1.10.1 [10] IRanges_1.16.2iterators_1.0.6 parallel_2.15.1 [13] preprocessCore_1.20.0 splines_2.15.1stats4_2.15.1 [16] tools_2.15.1 zlibbioc_1.4.0 I have been working on the issue for two weeks already. For example, above I loaded the Citrus.pd, additionally, I tried working with library(citruscdf), although this did not work either? Moreover, I used R 2.6 with the devel 'affyio' package version 1.27.1, but cannot run 'oligo' with R 2.6 for some reason (i.e. error in list.celFiles and read.celfiles commands), although R version for 'oligo' is 2.15 or greater, so cannot use the list matrix generated in 'affyio' version 1.27 on R 2.6 cause is does not seem compatible with 'oligo' version 1.22 on R 2.6. I am also using the recently updated BioC version 2.11. In oligo using R v. 2.15, I am able to view the .CEL images, make boxplots, MAplots of the data,
Re: [R] gam error message: matrix not +ve definite
On Sun, Oct 7, 2012 at 3:00 PM, garth dbo...@dal.ca wrote: Hello, I'm running a multimodel analysis which involves fitting several GAM models as implemented in package mgcv. The issue I'm having is that when I try to fit my model, gam gives me the following error message: 'Error in initial.sp(w * X, S, off) : S[[2]] matrix is not +ve definite.' The strange part of this is that the error message stops my model fitting function when run on a linux platform, but not on my local windows machine. Ordinarily I would just run the analysis on my local machine, but I need to run this from the linux machine to take advantage of the much larger computing capacity. The version of mgcv(1.7-21) and R (2.15.1) is the same on both machines. The data set to which the model if fitted is too large to post here but it contains 2209 observations, and the model is of the form: gam(Response~Year + s(Dayofyear,k=5,bs='cc') + s(Longitude,Latitude,k=4) + s(Coast_distance,k=4), family=Gamma('log'), data=dat, gamma=1.4) I realize this is a very particular question, but any help would be really appreciated. Thanks, Dan. It's a bit of a shot in the dark, but might it reflect data that is close to not being non-positive-definite and differences in BLAS? The only other think I'd try would be a update.packages(checkBuilt = TRUE, ask = FALSE) to just update every package you've got installed. It might not be that the error is from mgcv proper, but rather a dependency thereof which is in different versions between the machines. Also, I note you're posting through Nabble. Nabble actually only mirrors the R-Help mailing list, so we (the majority of respondents who don't use Nabble) don't get a forum view, but rather only emails of individual posts. The net result of this is that we don't see context of your follow-up postings unless you specifically include it, but it's much appreciated if you do. I believe there might also be a button which does so automatically, but I'll leave finding that to you. Cheers, Michael __ R-help@r-project.org mailing list https://stat.ethz.ch/mailman/listinfo/r-help PLEASE do read the posting guide http://www.R-project.org/posting-guide.html and provide commented, minimal, self-contained, reproducible code.
Re: [R] Testing volatility cluster (heteroscedasticity) in stock return?
On Sun, Oct 7, 2012 at 7:59 PM, Eko andryanto Prakasa eko.prak...@yahoo.com wrote: Hi Michael, I'm sorry for the mistake.. i don't know if it's not permitted to sent the same message to both (r-help and r-sig) Thank's a lot for the information... Eko No worries, it's a common enough first mistake. In the future, this (and most of your previous postings) is definitely a finance-specific question, so it should go there only. Cheers, Michael __ R-help@r-project.org mailing list https://stat.ethz.ch/mailman/listinfo/r-help PLEASE do read the posting guide http://www.R-project.org/posting-guide.html and provide commented, minimal, self-contained, reproducible code.
Re: [R] Presence/ absence data from matrix to single column
You should keep the context of your thread intact for those of us using email instead of Nabble. The locations were not listed individually anywhere in the reshape() command. I listed Point as the id variable so reshape would use that to create row names, but if you delete idvar=Point, reshape will give each row a consecutive number followed by the species name or number. I did list the species names individually in the times= argument to make things a bit clearer since reshape() can be a confusing command at first. But this would work as well: reshape(adat, varying=4:6, v.name=Sp-value, times=names(adat)[4:6], idvar=Point, timevar=Sp-name, direction=long) -- David L Carlson Associate Professor of Anthropology Texas AM University College Station, TX 77843-4352 Date: Sun, 7 Oct 2012 07:35:42 -0700 (PDT) From: agoijman agoij...@cnia.inta.gov.ar To: r-help@r-project.org Subject: Re: [R] Presence/ absence data from matrix to single column The problem with that, is that I just wrote an example of my database, but I have around 250 species and more than 500 sites. In the approach you show me, it looks like I have to enter every species name and sites individually, right? -- View this message in context: http://r.789695.n4.nabble.com/Presence-absence-data-from-matrix-to-single-co lumn-tp4645271p4645331.html Sent from the R help mailing list archive at Nabble.com. _ R-help@r-project.org mailing list https://stat.ethz.ch/mailman/listinfo/r-help PLEASE do read the posting guide http://www.R-project.org/posting-guide.html and provide commented, minimal, self-contained, reproducible code. -Original Message- From: r-help-boun...@r-project.org [mailto:r-help-bounces@r- project.org] On Behalf Of David L Carlson Sent: Saturday, October 06, 2012 10:25 PM To: 'Jim Lemon'; 'agoijman' Cc: r-help@r-project.org Subject: Re: [R] Presence/ absence data from matrix to single column Also reshape() will work: adat-data.frame(Year=rep(2004,3),Route=rep(123,3), Point=c(123-1,123-2,123-10),Sp1=c(0,0,1), Sp2=c(1,1,1),Sp3=c(0,1,0)) reshape(adat, varying=4:6, v.name=Sp-value, times=c(Sp1, Sp2, Sp3), idvar=Point, timevar=Sp-name, direction=long) -- David L Carlson Associate Professor of Anthropology Texas AM University College Station, TX 77843-4352 -Original Message- From: r-help-boun...@r-project.org [mailto:r-help-bounces@r- project.org] On Behalf Of Jim Lemon Sent: Saturday, October 06, 2012 7:36 PM To: agoijman Cc: r-help@r-project.org Subject: Re: [R] Presence/ absence data from matrix to single column On 10/07/2012 01:03 AM, agoijman wrote: I've been trying to reshape this database but haven't succeed at it. I tried using loops but can't get it right. I just want to reshape my database from this matrix, to the one below, with only one column of data. YearRoute Point Sp1 Sp2 Sp3 2004123 123-1 0 1 0 2004123 123-2 0 1 1 2004123 123-10 1 1 0 What I want: YearRoute Point 2004123 123-1 Sp1 0 2004123 123-2 Sp1 0 2004123 123-10 Sp1 1 2004123 123-1 Sp2 1 2004123 123-2 Sp2 1 2004123 123-10 Sp2 1 2004123 123-1 Sp3 0 2004123 123-2 Sp3 1 2004123 123-10 Sp3 0 Hi agoijman, You can do this using the rep_n_stack function. adat-data.frame(Year=rep(2004,3),Route=rep(123,3), Point=c(123-1,123-2,123-10),Sp1=c(0,0,1), Sp2=c(1,1,1),Sp3=c(0,1,0)) library(prettyR) rep_n_stack(adat,c(Sp1,Sp2,Sp3), stack.names=c(Sp-names,Sp-values)) Jim __ R-help@r-project.org mailing list https://stat.ethz.ch/mailman/listinfo/r-help PLEASE do read the posting guide http://www.R-project.org/posting- guide.html and provide commented, minimal, self-contained, reproducible code. __ R-help@r-project.org mailing list https://stat.ethz.ch/mailman/listinfo/r-help PLEASE do read the posting guide http://www.R-project.org/posting- guide.html and provide commented, minimal, self-contained, reproducible code. __ R-help@r-project.org mailing list https://stat.ethz.ch/mailman/listinfo/r-help PLEASE do read the posting guide http://www.R-project.org/posting-guide.html and provide commented, minimal, self-contained, reproducible code.
[R] Robust regression for ordered data
I have two regressions to perform - one with a metric DV (-3 to 3), the other with an ordered DV (0,1,2,3). Neither normal distribution not homoscedasticity is given. I have a two questions: (1) Some sources say robust regression take care of both lack of normal distribution and heteroscedasticity, while others say only of normal distribution. What is true? (2) Are there ways of using robust regressions with ordered data, or is that only possible for metric DVs? Thanks Torvon [[alternative HTML version deleted]] __ R-help@r-project.org mailing list https://stat.ethz.ch/mailman/listinfo/r-help PLEASE do read the posting guide http://www.R-project.org/posting-guide.html and provide commented, minimal, self-contained, reproducible code.
Re: [R] a merge() problem
* Peter Ehlers ruy...@hpnytnel.pn [2012-10-07 10:03:42 -0700]: On 2012-10-07 08:34, Sam Steingold wrote: I know it does not look very good - using the same column names to mean different things in different data frames, but here you go: --8---cut here---start-8--- x - data.frame(a=c(1,2,3),b=c(4,5,6)) y - data.frame(b=c(1,2),a=c(a,b)) merge(x,y,by.x=a,by.y=b,all.x=TRUE,suffixes=c(,y)) a ba 1 1 4a 2 2 5b 3 3 6 NA Warning message: In merge.data.frame(x, y, by.x = a, by.y = b, all.x = TRUE) : column name 'a' is duplicated in the result --8---cut here---end---8--- why is the suffixes argument ignored? I mean, I expected that the second a to be a.y. The 'suffixes' argument refers to _non-by_ names only (as per ?merge). yes, but a in y is _not_ a by-name. -- Sam Steingold (http://sds.podval.org/) on Ubuntu 12.04 (precise) X 11.0.11103000 http://www.childpsy.net/ http://americancensorship.org http://think-israel.org http://www.memritv.org http://mideasttruth.com Save time: send elected officials to jail directly, bypassing the office. __ R-help@r-project.org mailing list https://stat.ethz.ch/mailman/listinfo/r-help PLEASE do read the posting guide http://www.R-project.org/posting-guide.html and provide commented, minimal, self-contained, reproducible code.
Re: [R] Robust regression for ordered data
This does not appear to be a question about R. You should post in a list or forum dedicated to discussing statistics theory, such as stats.stackoverflow.com. --- Jeff NewmillerThe . . Go Live... DCN:jdnew...@dcn.davis.ca.usBasics: ##.#. ##.#. Live Go... Live: OO#.. Dead: OO#.. Playing Research Engineer (Solar/BatteriesO.O#. #.O#. with /Software/Embedded Controllers) .OO#. .OO#. rocks...1k --- Sent from my phone. Please excuse my brevity. Eiko Fried tor...@gmail.com wrote: I have two regressions to perform - one with a metric DV (-3 to 3), the other with an ordered DV (0,1,2,3). Neither normal distribution not homoscedasticity is given. I have a two questions: (1) Some sources say robust regression take care of both lack of normal distribution and heteroscedasticity, while others say only of normal distribution. What is true? (2) Are there ways of using robust regressions with ordered data, or is that only possible for metric DVs? Thanks Torvon [[alternative HTML version deleted]] __ R-help@r-project.org mailing list https://stat.ethz.ch/mailman/listinfo/r-help PLEASE do read the posting guide http://www.R-project.org/posting-guide.html and provide commented, minimal, self-contained, reproducible code. __ R-help@r-project.org mailing list https://stat.ethz.ch/mailman/listinfo/r-help PLEASE do read the posting guide http://www.R-project.org/posting-guide.html and provide commented, minimal, self-contained, reproducible code.
Re: [R] Robust regression for ordered data
Thank you Jeff! Please ignore the first of my two questions then, and apologies for not making it clear that my second question was about R. (2) Are there ways of using robust regressions with ordered data ... in R? Thank you On 7 October 2012 18:26, Jeff Newmiller jdnew...@dcn.davis.ca.us wrote: This does not appear to be a question about R. You should post in a list or forum dedicated to discussing statistics theory, such as stats.stackoverflow.com. --- Jeff NewmillerThe . . Go Live... DCN:jdnew...@dcn.davis.ca.usBasics: ##.#. ##.#. Live Go... Live: OO#.. Dead: OO#.. Playing Research Engineer (Solar/BatteriesO.O#. #.O#. with /Software/Embedded Controllers) .OO#. .OO#. rocks...1k --- Sent from my phone. Please excuse my brevity. Eiko Fried tor...@gmail.com wrote: I have two regressions to perform - one with a metric DV (-3 to 3), the other with an ordered DV (0,1,2,3). Neither normal distribution not homoscedasticity is given. I have a two questions: (1) Some sources say robust regression take care of both lack of normal distribution and heteroscedasticity, while others say only of normal distribution. What is true? (2) Are there ways of using robust regressions with ordered data, or is that only possible for metric DVs? Thanks Torvon [[alternative HTML version deleted]] __ R-help@r-project.org mailing list https://stat.ethz.ch/mailman/listinfo/r-help PLEASE do read the posting guide http://www.R-project.org/posting-guide.html and provide commented, minimal, self-contained, reproducible code. [[alternative HTML version deleted]] __ R-help@r-project.org mailing list https://stat.ethz.ch/mailman/listinfo/r-help PLEASE do read the posting guide http://www.R-project.org/posting-guide.html and provide commented, minimal, self-contained, reproducible code.
Re: [R] Presence/ absence data from matrix to single column
Ill try this one as well. And I guess the one below is not going to work, because all my species have different names. Thanks! #nms - names(adat) nms - c(Year, Route, Point, paste0(Sp, 1:250)) pattern - ^Sp[[:digit:]]+$ whichCols - grep(pattern, nms) whichNames - nms[whichCols] reshape(..., varying = whichCols, times = whichNames, ...) On Sun, Oct 7, 2012 at 3:02 PM, arun smartpink...@yahoo.com wrote: Hi, I guess you are not talking about the melt() method. dat1-read.table(text= YearRoutePointSp1Sp2Sp3 2004123123-1010 2004123123-2011 2004123123-10110 ,header=TRUE,sep=,stringsAsFactors=FALSE) #If all the Sp columns are located next to another as shown in your example dataset, then you can also try this: name1-unlist(strsplit(paste(colnames(dat1)[4:6],collapse= ), )) reshape(dat1,varying=4:6,v.name =Sp-value,times=name1,timevar=Sp-name,idvar=c(Year,Route,Point),direction=long) A.K. - Original Message - From: Rui Barradas ruipbarra...@sapo.pt To: agoijman agoij...@cnia.inta.gov.ar Cc: r-help@r-project.org Sent: Sunday, October 7, 2012 2:32 PM Subject: Re: [R] Presence/ absence data from matrix to single column Hello, I haven't been following this thread but apparently the answer to your worries is no. You can use a combination of names() and grep() to sort it out. something like #nms - names(adat) nms - c(Year, Route, Point, paste0(Sp, 1:250)) pattern - ^Sp[[:digit:]]+$ whichCols - grep(pattern, nms) whichNames - nms[whichCols] reshape(..., varying = whichCols, times = whichNames, ...) Hope this helps, Rui Barradas Em 07-10-2012 15:35, agoijman escreveu: The problem with that, is that I just wrote an example of my database, but I have around 250 species and more than 500 sites. In the approach you show me, it looks like I have to enter every species name and sites individually, right? -- View this message in context: http://r.789695.n4.nabble.com/Presence-absence-data-from-matrix-to-single-column-tp4645271p4645331.html Sent from the R help mailing list archive at Nabble.com. __ R-help@r-project.org mailing list https://stat.ethz.ch/mailman/listinfo/r-help PLEASE do read the posting guide http://www.R-project.org/posting-guide.html and provide commented, minimal, self-contained, reproducible code. __ R-help@r-project.org mailing list https://stat.ethz.ch/mailman/listinfo/r-help PLEASE do read the posting guide http://www.R-project.org/posting-guide.html and provide commented, minimal, self-contained, reproducible code. -- --- Lic. Andrea Paula Goijman Grupo Ecología y Gestión Ambiental de la Biodiversidad IRB - INTA Castelar, Argentina agoij...@cnia.inta.gov.ar http://inta.gob.ar/personas/goijman.andrea/ http://inta.gob.ar/personas/goijman.andrea/ PhD Candidate Georgia Cooperative Fish and Wildlife Research Unit D.B. Warnell School of Forestry and Natural Resources University of Georgia Athens, GA 30602 USA Tel. +706.206.4805 andre...@uga.edu [[alternative HTML version deleted]] __ R-help@r-project.org mailing list https://stat.ethz.ch/mailman/listinfo/r-help PLEASE do read the posting guide http://www.R-project.org/posting-guide.html and provide commented, minimal, self-contained, reproducible code.
Re: [R] Robust regression for ordered data
Have you checked the Robust task view on CRAN?? Would seem that that should have been the first place to look. -- Bert On Sun, Oct 7, 2012 at 3:30 PM, Eiko Fried tor...@gmail.com wrote: Thank you Jeff! Please ignore the first of my two questions then, and apologies for not making it clear that my second question was about R. (2) Are there ways of using robust regressions with ordered data ... in R? Thank you On 7 October 2012 18:26, Jeff Newmiller jdnew...@dcn.davis.ca.us wrote: This does not appear to be a question about R. You should post in a list or forum dedicated to discussing statistics theory, such as stats.stackoverflow.com. --- Jeff NewmillerThe . . Go Live... DCN:jdnew...@dcn.davis.ca.usBasics: ##.#. ##.#. Live Go... Live: OO#.. Dead: OO#.. Playing Research Engineer (Solar/BatteriesO.O#. #.O#. with /Software/Embedded Controllers) .OO#. .OO#. rocks...1k --- Sent from my phone. Please excuse my brevity. Eiko Fried tor...@gmail.com wrote: I have two regressions to perform - one with a metric DV (-3 to 3), the other with an ordered DV (0,1,2,3). Neither normal distribution not homoscedasticity is given. I have a two questions: (1) Some sources say robust regression take care of both lack of normal distribution and heteroscedasticity, while others say only of normal distribution. What is true? (2) Are there ways of using robust regressions with ordered data, or is that only possible for metric DVs? Thanks Torvon [[alternative HTML version deleted]] __ R-help@r-project.org mailing list https://stat.ethz.ch/mailman/listinfo/r-help PLEASE do read the posting guide http://www.R-project.org/posting-guide.html and provide commented, minimal, self-contained, reproducible code. [[alternative HTML version deleted]] __ R-help@r-project.org mailing list https://stat.ethz.ch/mailman/listinfo/r-help PLEASE do read the posting guide http://www.R-project.org/posting-guide.html and provide commented, minimal, self-contained, reproducible code. -- Bert Gunter Genentech Nonclinical Biostatistics Internal Contact Info: Phone: 467-7374 Website: http://pharmadevelopment.roche.com/index/pdb/pdb-functional-groups/pdb-biostatistics/pdb-ncb-home.htm __ R-help@r-project.org mailing list https://stat.ethz.ch/mailman/listinfo/r-help PLEASE do read the posting guide http://www.R-project.org/posting-guide.html and provide commented, minimal, self-contained, reproducible code.
Re: [R] Robust regression for ordered data
I don't know about the topic of your question. Have you used the RSiteSearch function to research it yourself? --- Jeff NewmillerThe . . Go Live... DCN:jdnew...@dcn.davis.ca.usBasics: ##.#. ##.#. Live Go... Live: OO#.. Dead: OO#.. Playing Research Engineer (Solar/BatteriesO.O#. #.O#. with /Software/Embedded Controllers) .OO#. .OO#. rocks...1k --- Sent from my phone. Please excuse my brevity. Eiko Fried tor...@gmail.com wrote: Thank you Jeff! Please ignore the first of my two questions then, and apologies for not making it clear that my second question was about R. (2) Are there ways of using robust regressions with ordered data ... in R? Thank you On 7 October 2012 18:26, Jeff Newmiller jdnew...@dcn.davis.ca.us wrote: This does not appear to be a question about R. You should post in a list or forum dedicated to discussing statistics theory, such as stats.stackoverflow.com. --- Jeff NewmillerThe . . Go Live... DCN:jdnew...@dcn.davis.ca.usBasics: ##.#. ##.#. Live Go... Live: OO#.. Dead: OO#.. Playing Research Engineer (Solar/BatteriesO.O#. #.O#. with /Software/Embedded Controllers) .OO#. .OO#. rocks...1k --- Sent from my phone. Please excuse my brevity. Eiko Fried tor...@gmail.com wrote: I have two regressions to perform - one with a metric DV (-3 to 3), the other with an ordered DV (0,1,2,3). Neither normal distribution not homoscedasticity is given. I have a two questions: (1) Some sources say robust regression take care of both lack of normal distribution and heteroscedasticity, while others say only of normal distribution. What is true? (2) Are there ways of using robust regressions with ordered data, or is that only possible for metric DVs? Thanks Torvon [[alternative HTML version deleted]] __ R-help@r-project.org mailing list https://stat.ethz.ch/mailman/listinfo/r-help PLEASE do read the posting guide http://www.R-project.org/posting-guide.html and provide commented, minimal, self-contained, reproducible code. __ R-help@r-project.org mailing list https://stat.ethz.ch/mailman/listinfo/r-help PLEASE do read the posting guide http://www.R-project.org/posting-guide.html and provide commented, minimal, self-contained, reproducible code.
[R] dist based kmeans clustering
Dear useRs, i have a matrix X and i generated a distance matrix of X, let us call it Y. I did hierarchical clustering of Y and got some results. I just wanted to know that can i use the same distance matrix Y in Kmeans clustering? If not, then how can i use my own distance matrix for kmeans clustering? thanks in advance.. eliza [[alternative HTML version deleted]] __ R-help@r-project.org mailing list https://stat.ethz.ch/mailman/listinfo/r-help PLEASE do read the posting guide http://www.R-project.org/posting-guide.html and provide commented, minimal, self-contained, reproducible code.
Re: [R] Presence/ absence data from matrix to single column
Hello, If all your species have different names, you can allways try one of 1. if the non-species follow a pattern, negate those columns and you'll have the species columns. 2. are the species the last columns? Use positional referencing. Rui Barradas Em 08-10-2012 00:16, Andrea Goijman escreveu: Ill try this one as well. And I guess the one below is not going to work, because all my species have different names. Thanks! #nms - names(adat) nms - c(Year, Route, Point, paste0(Sp, 1:250)) pattern - ^Sp[[:digit:]]+$ whichCols - grep(pattern, nms) whichNames - nms[whichCols] reshape(..., varying = whichCols, times = whichNames, ...) On Sun, Oct 7, 2012 at 3:02 PM, arun smartpink...@yahoo.com wrote: Hi, I guess you are not talking about the melt() method. dat1-read.table(text= YearRoutePointSp1Sp2Sp3 2004123123-1010 2004123123-2011 2004123123-10110 ,header=TRUE,sep=,stringsAsFactors=FALSE) #If all the Sp columns are located next to another as shown in your example dataset, then you can also try this: name1-unlist(strsplit(paste(colnames(dat1)[4:6],collapse= ), )) reshape(dat1,varying=4:6,v.name =Sp-value,times=name1,timevar=Sp-name,idvar=c(Year,Route,Point),direction=long) A.K. - Original Message - From: Rui Barradas ruipbarra...@sapo.pt To: agoijman agoij...@cnia.inta.gov.ar Cc: r-help@r-project.org Sent: Sunday, October 7, 2012 2:32 PM Subject: Re: [R] Presence/ absence data from matrix to single column Hello, I haven't been following this thread but apparently the answer to your worries is no. You can use a combination of names() and grep() to sort it out. something like #nms - names(adat) nms - c(Year, Route, Point, paste0(Sp, 1:250)) pattern - ^Sp[[:digit:]]+$ whichCols - grep(pattern, nms) whichNames - nms[whichCols] reshape(..., varying = whichCols, times = whichNames, ...) Hope this helps, Rui Barradas Em 07-10-2012 15:35, agoijman escreveu: The problem with that, is that I just wrote an example of my database, but I have around 250 species and more than 500 sites. In the approach you show me, it looks like I have to enter every species name and sites individually, right? -- View this message in context: http://r.789695.n4.nabble.com/Presence-absence-data-from-matrix-to-single-column-tp4645271p4645331.html Sent from the R help mailing list archive at Nabble.com. __ R-help@r-project.org mailing list https://stat.ethz.ch/mailman/listinfo/r-help PLEASE do read the posting guide http://www.R-project.org/posting-guide.html and provide commented, minimal, self-contained, reproducible code. __ R-help@r-project.org mailing list https://stat.ethz.ch/mailman/listinfo/r-help PLEASE do read the posting guide http://www.R-project.org/posting-guide.html and provide commented, minimal, self-contained, reproducible code. __ R-help@r-project.org mailing list https://stat.ethz.ch/mailman/listinfo/r-help PLEASE do read the posting guide http://www.R-project.org/posting-guide.html and provide commented, minimal, self-contained, reproducible code.
Re: [R] Presence/ absence data from matrix to single column
HI, Sorry, I complicated a code where it was not required at all. Just using colnames(dat1)[4:6] or names(dat1)[4:6] should work if the species columns are adjacent to each other. reshape(dat1,varying=4:6,v.name=Sp-value,times=colnames(dat1)[4:6],timevar=Sp-name,idvar=c(Year,Route,Point),direction=long) #or reshape(dat1,varying=4:6,v.name=Sp-value,times=names(dat1)[4:6],timevar=Sp-name,idvar=c(Year,Route,Point),direction=long) A.K. From: Andrea Goijman agoij...@cnia.inta.gov.ar To: arun smartpink...@yahoo.com Cc: Rui Barradas ruipbarra...@sapo.pt; R help r-help@r-project.org Sent: Sunday, October 7, 2012 7:16 PM Subject: Re: [R] Presence/ absence data from matrix to single column Ill try this one as well. And I guess the one below is not going to work, because all my species have different names. Thanks! #nms - names(adat) nms - c(Year, Route, Point, paste0(Sp, 1:250)) pattern - ^Sp[[:digit:]]+$ whichCols - grep(pattern, nms) whichNames - nms[whichCols] reshape(..., varying = whichCols, times = whichNames, ...) On Sun, Oct 7, 2012 at 3:02 PM, arun smartpink...@yahoo.com wrote: Hi, I guess you are not talking about the melt() method. dat1-read.table(text= Year Route Point Sp1 Sp2 Sp3 2004 123 123-1 0 1 0 2004 123 123-2 0 1 1 2004 123 123-10 1 1 0 ,header=TRUE,sep=,stringsAsFactors=FALSE) #If all the Sp columns are located next to another as shown in your example dataset, then you can also try this: name1-unlist(strsplit(paste(colnames(dat1)[4:6],collapse= ), )) reshape(dat1,varying=4:6,v.name=Sp-value,times=name1,timevar=Sp-name,idvar=c(Year,Route,Point),direction=long) A.K. - Original Message - From: Rui Barradas ruipbarra...@sapo.pt To: agoijman agoij...@cnia.inta.gov.ar Cc: r-help@r-project.org Sent: Sunday, October 7, 2012 2:32 PM Subject: Re: [R] Presence/ absence data from matrix to single column Hello, I haven't been following this thread but apparently the answer to your worries is no. You can use a combination of names() and grep() to sort it out. something like #nms - names(adat) nms - c(Year, Route, Point, paste0(Sp, 1:250)) pattern - ^Sp[[:digit:]]+$ whichCols - grep(pattern, nms) whichNames - nms[whichCols] reshape(..., varying = whichCols, times = whichNames, ...) Hope this helps, Rui Barradas Em 07-10-2012 15:35, agoijman escreveu: The problem with that, is that I just wrote an example of my database, but I have around 250 species and more than 500 sites. In the approach you show me, it looks like I have to enter every species name and sites individually, right? -- View this message in context: http://r.789695.n4.nabble.com/Presence-absence-data-from-matrix-to-single-column-tp4645271p4645331.html Sent from the R help mailing list archive at Nabble.com. __ R-help@r-project.org mailing list https://stat.ethz.ch/mailman/listinfo/r-help PLEASE do read the posting guide http://www.R-project.org/posting-guide.html and provide commented, minimal, self-contained, reproducible code. __ R-help@r-project.org mailing list https://stat.ethz.ch/mailman/listinfo/r-help PLEASE do read the posting guide http://www.R-project.org/posting-guide.html and provide commented, minimal, self-contained, reproducible code. -- ---Lic. Andrea Paula Goijman Grupo Ecología y Gestión Ambiental de la Biodiversidad IRB - INTA Castelar, Argentina agoij...@cnia.inta.gov.arhttp://inta.gob.ar/personas/goijman.andrea/ PhD Candidate Georgia Cooperative Fish and Wildlife Research Unit D.B. Warnell School of Forestry and Natural Resources University of Georgia Athens, GA 30602 USA Tel. +706.206.4805 andre...@uga.edu __ R-help@r-project.org mailing list https://stat.ethz.ch/mailman/listinfo/r-help PLEASE do read the posting guide http://www.R-project.org/posting-guide.html and provide commented, minimal, self-contained, reproducible code.
Re: [R] multinomial MCMCglmm
Vaniscotte vanamelie at gmail.com writes: Dear all, I would like to add mixed effects in a multinomial model and I am trying to use MCMCglmm for that. [snip] ill-conditioned G/R structure: use proper priors if you haven't or rescale data if you have I guess that the problem comes from the nature of my observations which are frequencies instead of 0/1 per unit Does someone know if a multinomial model fitted with MCMCglmm can handle those frequencies table and how to specify the good G/R variance structures? (1) you should probably post this to r-sig-mixed-mod...@r-project.org instead (and try to post only once ...) (2) multinomial models generally require *integer* responses (although not necessarily 0/1); if you don't have a natural denominator, you may have to think a bit harder about this (a Dirichlet distribution would be the natural way to model frequencies that sum to 1) (3) have you read the course notes vignette that comes with MCMCglmm? Ben Bolker __ R-help@r-project.org mailing list https://stat.ethz.ch/mailman/listinfo/r-help PLEASE do read the posting guide http://www.R-project.org/posting-guide.html and provide commented, minimal, self-contained, reproducible code.
Re: [R] a merge() problem
On 2012-10-07 14:44, Sam Steingold wrote: * Peter Ehlers ruy...@hpnytnel.pn [2012-10-07 10:03:42 -0700]: On 2012-10-07 08:34, Sam Steingold wrote: I know it does not look very good - using the same column names to mean different things in different data frames, but here you go: --8---cut here---start-8--- x - data.frame(a=c(1,2,3),b=c(4,5,6)) y - data.frame(b=c(1,2),a=c(a,b)) merge(x,y,by.x=a,by.y=b,all.x=TRUE,suffixes=c(,y)) a ba 1 1 4a 2 2 5b 3 3 6 NA Warning message: In merge.data.frame(x, y, by.x = a, by.y = b, all.x = TRUE) : column name 'a' is duplicated in the result --8---cut here---end---8--- why is the suffixes argument ignored? I mean, I expected that the second a to be a.y. The 'suffixes' argument refers to _non-by_ names only (as per ?merge). yes, but a in y is _not_ a by-name. Yes, it is. The set of by-names is the union of names specified by by.x and by.y, in your case: c(a, b). I suppose that a case could be made that ?merge does not spell that out sufficiently explicitly. Peter Ehlers __ R-help@r-project.org mailing list https://stat.ethz.ch/mailman/listinfo/r-help PLEASE do read the posting guide http://www.R-project.org/posting-guide.html and provide commented, minimal, self-contained, reproducible code.
[R] Removing header from a matrix
I have three column vectors (X1, X2, X3). X1 X2 X3 20 25 40 100 90 80 I want to put them as one matrix of dimention 2 by 3, but remove headers(X1,X2,X3) from the matrix. I wrote as follows U-cbind (X1,X2,X3) the headers are there. I need help please. Thanks Dereje [[alternative HTML version deleted]] __ R-help@r-project.org mailing list https://stat.ethz.ch/mailman/listinfo/r-help PLEASE do read the posting guide http://www.R-project.org/posting-guide.html and provide commented, minimal, self-contained, reproducible code.
Re: [R] Removing header from a matrix
You need to clarify what you have and what you want. Please use the dput() function to create a reproducible example that we can enter into R to make suggestions about. [1] There are a couple of possible things that could be going on here, and what you have given so far is ambiguous. [1] http://stackoverflow.com/questions/5963269/how-to-make-a-great-r-reproducible-example --- Jeff NewmillerThe . . Go Live... DCN:jdnew...@dcn.davis.ca.usBasics: ##.#. ##.#. Live Go... Live: OO#.. Dead: OO#.. Playing Research Engineer (Solar/BatteriesO.O#. #.O#. with /Software/Embedded Controllers) .OO#. .OO#. rocks...1k --- Sent from my phone. Please excuse my brevity. Dereje Bacha d_ba...@yahoo.com wrote: I have three column vectors (X1, X2, X3).� ��� X1� X2� X3 �� 20�� 25� 40 �� 100 90� 80 I want to put them as one matrix of dimention 2 by 3, �but remove headers(X1,X2,X3) from the matrix. I wrote as follows U-cbind (X1,X2,X3) the headers are there. I need help please. Thanks Dereje [[alternative HTML version deleted]] __ R-help@r-project.org mailing list https://stat.ethz.ch/mailman/listinfo/r-help PLEASE do read the posting guide http://www.R-project.org/posting-guide.html and provide commented, minimal, self-contained, reproducible code. __ R-help@r-project.org mailing list https://stat.ethz.ch/mailman/listinfo/r-help PLEASE do read the posting guide http://www.R-project.org/posting-guide.html and provide commented, minimal, self-contained, reproducible code.
Re: [R] Removing header from a matrix
These are just column names, but if you want to remove them, it is easy: X1 - c(20, 100) X2 - c(25, 90) X3 - c(40, 80) U - cbind(X1, X2, X3) U X1 X2 X3 [1,] 20 25 40 [2,] 100 90 80 colnames(U) - NULL U [,1] [,2] [,3] [1,] 20 25 40 [2,] 100 90 80 -- David L Carlson Associate Professor of Anthropology Texas AM University College Station, TX 77843-4352 -Original Message- From: r-help-boun...@r-project.org [mailto:r-help-bounces@r- project.org] On Behalf Of Dereje Bacha Sent: Sunday, October 07, 2012 10:13 PM To: r-help@r-project.org Subject: [R] Removing header from a matrix I have three column vectors (X1, X2, X3). X1 X2 X3 20 25 40 100 90 80 I want to put them as one matrix of dimention 2 by 3, but remove headers(X1,X2,X3) from the matrix. I wrote as follows U-cbind (X1,X2,X3) the headers are there. I need help please. Thanks Dereje [[alternative HTML version deleted]] __ R-help@r-project.org mailing list https://stat.ethz.ch/mailman/listinfo/r-help PLEASE do read the posting guide http://www.R-project.org/posting-guide.html and provide commented, minimal, self-contained, reproducible code.
[R] nlminb problem, convergence error code = 1
Hi, I was trying to do a multi-level modeling of the data using the nlme package. I encounter the following message: addRandomSlopeRange- lme(FAN.range ~ CHN.range + Age + Block.T, data=data.block, random = ~CHN.range|CHI, method = ML, na.action=na.omit) Error in lme.formula(FAN.range ~ CHN.range + Age + Block.T, data = data.block, : nlminb problem, convergence error code = 1 message = iteration limit reached without convergence (10) I get this error message only when FAN.range or FAN.avg is used as the dependent variable. head(data.block) Block.N Block.T CHI Age CHN.avg FAN.avg CHN.min FAN.min CHN.max 1 3AICF C003 765 8.676307 7.257332 7.619782 5.033533 9.428432 2 25AICF C003 765 8.227647 6.475297 4.853860 4.452857 10.430625 3 32AICF C003 765 8.381634 6.720497 6.700553 4.977628 9.049861 4 50AICF C003 765 8.113471 6.037453 6.294747 4.958514 9.593018 5 59AICF C003 765 8.301553 7.444806 7.587508 4.808462 10.975600 6 61AICF C003 765 7.895683 6.319403 4.455857 4.198858 11.331577 FAN.max CHN.rate FAN.rate CHN.dur FAN.dur CHN.range FAN.range 1 9.995912 2.09 2.394000 0.633 1.984000 1.808650 4.962380 2 8.296612 2.53 2.91 1.580 1.335000 5.576765 3.843754 3 9.275749 2.46 2.767500 0.820 1.862500 2.349308 4.298121 4 7.914313 2.604286 3.112500 1.053 1.206250 3.298271 2.955799 5 11.436886 2.26 2.73 1.330 2.20 3.388092 6.628425 6 10.865545 3.00 2.77 1.000 1.526667 6.875720 6.87 The following work fine: addRandomSlopeAvg- lme(CHN.avg ~ FAN.avg + Age + Block.T, data=data.block, random = ~FAN.avg|CHI, method = ML, na.action=na.omit) addRandomSlopeRange- lme(CHN.range ~ FAN.range + Age + Block.T, data=data.block, random = ~FAN.range|CHI, method = ML, na.action=na.omit) addRandomSlopeMin- lme(FAN.min ~ CHN.min + Age + Block.T, data=data.block, random = ~CHN.min|CHI, method = ML, na.action=na.omit) addRandomSlopeMax- lme(FAN.max ~ CHN.max + Age + Block.T, data=data.block, random = ~CHN.max|CHI, method = ML, na.action=na.omit) It is really strange that the script runs fine for minimum and maximum values but not for the average. Does anyone have an insight? [[alternative HTML version deleted]] __ R-help@r-project.org mailing list https://stat.ethz.ch/mailman/listinfo/r-help PLEASE do read the posting guide http://www.R-project.org/posting-guide.html and provide commented, minimal, self-contained, reproducible code.
Re: [R] a merge() problem
On 08/10/2012 02:57, Peter Ehlers wrote: On 2012-10-07 14:44, Sam Steingold wrote: * Peter Ehlers ruy...@hpnytnel.pn [2012-10-07 10:03:42 -0700]: On 2012-10-07 08:34, Sam Steingold wrote: I know it does not look very good - using the same column names to mean different things in different data frames, but here you go: --8---cut here---start-8--- x - data.frame(a=c(1,2,3),b=c(4,5,6)) y - data.frame(b=c(1,2),a=c(a,b)) merge(x,y,by.x=a,by.y=b,all.x=TRUE,suffixes=c(,y)) a ba 1 1 4a 2 2 5b 3 3 6 NA Warning message: In merge.data.frame(x, y, by.x = a, by.y = b, all.x = TRUE) : column name 'a' is duplicated in the result --8---cut here---end---8--- why is the suffixes argument ignored? I mean, I expected that the second a to be a.y. The 'suffixes' argument refers to _non-by_ names only (as per ?merge). yes, but a in y is _not_ a by-name. Yes, it is. The set of by-names is the union of names specified by by.x and by.y, in your case: c(a, b). I suppose that a case could be made that ?merge does not spell that out sufficiently explicitly. It does in 'Details' (and where else would there be such a detail?) E.g. in R 2.15.1: If the remaining columns in the data frames have any common names, these have ‘suffixes’ (‘.x’ and ‘.y’ by default) appended to try to make the names of the result unique. If this is not possible, an error is thrown. Note *remaining*, and read what comes before that. Peter Ehlers __ R-help@r-project.org mailing list https://stat.ethz.ch/mailman/listinfo/r-help PLEASE do read the posting guide http://www.R-project.org/posting-guide.html and provide commented, minimal, self-contained, reproducible code. -- Brian D. Ripley, rip...@stats.ox.ac.uk Professor of Applied Statistics, http://www.stats.ox.ac.uk/~ripley/ University of Oxford, Tel: +44 1865 272861 (self) 1 South Parks Road, +44 1865 272866 (PA) Oxford OX1 3TG, UKFax: +44 1865 272595 __ R-help@r-project.org mailing list https://stat.ethz.ch/mailman/listinfo/r-help PLEASE do read the posting guide http://www.R-project.org/posting-guide.html and provide commented, minimal, self-contained, reproducible code.
Re: [R] problem with convergence in mle2/optim function
Dear R Help, Thank you to those who responded to my questions about mle2/optim convergence. A few responders pointed out that the optim error seems to arise when either one of the probabilities P1, P2, or P3 become negative or infinite. One suggested examining the exponential terms within the P1 and P2 equations. I may have made some progress along these lines. The exponential terms in the equations for P1 and P2 go to infinity at certain (large) values of t. The exponential terms can be found in lines 1, 5, and 7 in the P1 and P2 expressions below. Here is some example code: ### # P1 and P2 equations P1 - expression((p1*((-1 + exp(sqrt((mu1 + mu2 + p1 + p2)^2 - 4*(mu2*p1 + mu1*(mu2 + p2)))*t))*((-mu2)*(mu2 - p1 + p2) + mu1*(mu2 + 2*p2)) - mu2*sqrt((mu1 + mu2 + p1 + p2)^2 - 4*(mu2*p1 + mu1*(mu2 + p2))) - exp(sqrt((mu1 + mu2 + p1 + p2)^2 - 4*(mu2*p1 + mu1*(mu2 + p2)))*t)* mu2*sqrt((mu1 + mu2 + p1 + p2)^2 - 4*(mu2*p1 + mu1*(mu2 + p2))) + 2*exp((1/2)*(mu1 + mu2 + p1 + p2 + sqrt((mu1 + mu2 + p1 + p2)^2 - 4*(mu2*p1 + mu1*(mu2 + p2*t)*mu2* sqrt((mu1 + mu2 + p1 + p2)^2 - 4*(mu2*p1 + mu1*(mu2 + p2)/ exp((1/2)*(mu1 + mu2 + p1 + p2 + sqrt((mu1 + mu2 + p1 + p2)^2 - 4*(mu2*p1 + mu1*(mu2 + p2*t)/(2*(mu2*p1 + mu1*(mu2 + p2))* sqrt((mu1 + mu2 + p1 + p2)^2 - 4*(mu2*p1 + mu1*(mu2 + p2) P2 - expression((p2*((-1 + exp(sqrt((mu1 + mu2 + p1 + p2)^2 - 4*(mu2*p1 + mu1*(mu2 + p2)))*t))*(-mu1^2 + 2*mu2*p1 + mu1*(mu2 - p1 + p2)) - mu1*sqrt((mu1 + mu2 + p1 + p2)^2 - 4*(mu2*p1 + mu1*(mu2 + p2))) - exp(sqrt((mu1 + mu2 + p1 + p2)^2 - 4*(mu2*p1 + mu1*(mu2 + p2)))*t)* mu1*sqrt((mu1 + mu2 + p1 + p2)^2 - 4*(mu2*p1 + mu1*(mu2 + p2))) + 2*exp((1/2)*(mu1 + mu2 + p1 + p2 + sqrt((mu1 + mu2 + p1 + p2)^2 - 4*(mu2*p1 + mu1*(mu2 + p2*t)*mu1* sqrt((mu1 + mu2 + p1 + p2)^2 - 4*(mu2*p1 + mu1*(mu2 + p2)/ exp((1/2)*(mu1 + mu2 + p1 + p2 + sqrt((mu1 + mu2 + p1 + p2)^2 - 4*(mu2*p1 + mu1*(mu2 + p2*t)/(2*(mu2*p1 + mu1*(mu2 + p2))* sqrt((mu1 + mu2 + p1 + p2)^2 - 4*(mu2*p1 + mu1*(mu2 + p2) # Vector of t values tv - c(1:200) # 'true' parameter values p1t = 2; p2t = 2; mu1t = 0.001; mu2t = 0.001 # Function to calculate probabilities from 'true' parameter values psim - function(x){ params - list(p1 = p1t, p2 = p2t, mu1 = mu1t, mu2 = mu2t, t = x) eval.P1 - eval(P1, params) eval.P2 - eval(P2, params) P3 - 1 - eval.P1 - eval.P2 c(x, matrix(c(eval.P1, eval.P2, P3), ncol = 3)) } pdat - sapply(tv, psim, simplify = TRUE) Pdat - as.data.frame(t(pdat)) names(Pdat) - c(time, P1, P2, P3) matplot(Pdat[,-1], type = l, xlab = time, ylab = Probability, col = c(black, brown, blue), lty = c(1:3), lwd = 2, ylim = c(0,1)) legend(topright, c(P1, P2, P3), col = c(black, brown, blue), lty = c(1:3), lwd = 2) Pdat[160:180,] # psim function begins to return NaN at t = 178 # exponential terms in P1 and P2 expressions are problematic params - list(p1 = p1t, p2 = p2t, mu1 = mu1t, mu2 = mu2t, t = 178) exp1 - expression(exp(sqrt((mu1 + mu2 + p1 + p2)^2 - 4*(mu2*p1 + mu1*(mu2 + p2)))*t)) eval(exp1, params) # returns Inf at t = 178 exp2 - expression(exp((1/2)*(mu1 + mu2 + p1 + p2 + sqrt((mu1 + mu2 + p1 + p2)^2 - 4*(mu2*p1 + mu1*(mu2 + p2*t)) eval(exp2, params) # also returns Inf at t = 178 ## The time step at which the exponential terms go to infinity depends on the values of the parameters p1, p2, mu1, mu2. It seems that the convergence problems may be due to these exponential terms going to infinity. Thus my convergence problem appears to be an overflow problem? Unfortunately, I'm not sure where to go from here. Due to the complexity of the P1 and P2 equations, there's no clear way to rearrange the equations to eliminate t from the exponential terms. Does anyone have any suggestions on how to address this problem? Perhaps there is a way to bound p1, p2, mu1, and mu2 to avoid the exponential terms going to infinity? Or bound P1 and P2? Any suggestions would be greatly appreciated. Adam Zeilinger On 10/5/2012 3:06 AM, Berend Hasselman wrote: On 05-10-2012, at 07:12, Adam Zeilinger wrote: Hello R Help, I am trying solve an MLE convergence problem: I would like to estimate four parameters, p1, p2, mu1, mu2, which relate to the probabilities, P1, P2, P3, of a multinomial (trinomial) distribution. I am using the mle2() function and feeding it a time series dataset composed of four columns: time point, number of successes in category 1, number of successes in category 2, and number of success in category 3. The column headers are: t, n1, n2, and n3. The mle2() function converges occasionally, and I need to improve the rate of convergence when used in a stochastic simulation, with multiple stochastically generated datasets. When mle2() does not converge, it returns an error:
Re: [R] Robust regression for ordered data
On 08/10/2012 00:37, Bert Gunter wrote: Have you checked the Robust task view on CRAN?? Would seem that that should have been the first place to look. It is still a conceptual question. I presume this means an ordered response, and then we need to know what is meant by 'regression'. If you tell us precisely what robust method you want to know about, you may get help about whether it is available in R. But I surmise that you need rather to be looking at ordinal regression (polr in MASS, for example), and you will not find that in the 'Robust' task view. In the task view, 'robust' is a technical term and I don't think 'Elko Fried' is using it in the sense the author of the task view is. -- Bert On Sun, Oct 7, 2012 at 3:30 PM, Eiko Fried tor...@gmail.com wrote: Thank you Jeff! Please ignore the first of my two questions then, and apologies for not making it clear that my second question was about R. (2) Are there ways of using robust regressions with ordered data ... in R? Thank you On 7 October 2012 18:26, Jeff Newmiller jdnew...@dcn.davis.ca.us wrote: This does not appear to be a question about R. You should post in a list or forum dedicated to discussing statistics theory, such as stats.stackoverflow.com. --- Jeff NewmillerThe . . Go Live... DCN:jdnew...@dcn.davis.ca.usBasics: ##.#. ##.#. Live Go... Live: OO#.. Dead: OO#.. Playing Research Engineer (Solar/BatteriesO.O#. #.O#. with /Software/Embedded Controllers) .OO#. .OO#. rocks...1k --- Sent from my phone. Please excuse my brevity. Eiko Fried tor...@gmail.com wrote: I have two regressions to perform - one with a metric DV (-3 to 3), the other with an ordered DV (0,1,2,3). Neither normal distribution not homoscedasticity is given. I have a two questions: (1) Some sources say robust regression take care of both lack of normal distribution and heteroscedasticity, while others say only of normal distribution. What is true? (2) Are there ways of using robust regressions with ordered data, or is that only possible for metric DVs? Thanks Torvon [[alternative HTML version deleted]] __ R-help@r-project.org mailing list https://stat.ethz.ch/mailman/listinfo/r-help PLEASE do read the posting guide http://www.R-project.org/posting-guide.html and provide commented, minimal, self-contained, reproducible code. [[alternative HTML version deleted]] __ R-help@r-project.org mailing list https://stat.ethz.ch/mailman/listinfo/r-help PLEASE do read the posting guide http://www.R-project.org/posting-guide.html and provide commented, minimal, self-contained, reproducible code. -- Brian D. Ripley, rip...@stats.ox.ac.uk Professor of Applied Statistics, http://www.stats.ox.ac.uk/~ripley/ University of Oxford, Tel: +44 1865 272861 (self) 1 South Parks Road, +44 1865 272866 (PA) Oxford OX1 3TG, UKFax: +44 1865 272595 __ R-help@r-project.org mailing list https://stat.ethz.ch/mailman/listinfo/r-help PLEASE do read the posting guide http://www.R-project.org/posting-guide.html and provide commented, minimal, self-contained, reproducible code.