Structure arguments and Duplicate

When passing structures as arguments and return variables, when should duplicate be used? When do I need to be concerned that CF passes pointer to original versus copy. For example: Function Foo argument fooArg set var workingFoo = arguments.fooArg return workingFoo OR Funct

Structure arguments and Duplicate

When passing structures as arguments and return variables, when should duplicate be used? When do I need to be concerned that CF passes pointer to original versus copy. For example: Function Foo argument fooArg set var workingFoo = arguments.fooArg return workingFoo OR Funct

Re: multithreading a single page/calling coldfusion methods from java

On 11/30/05, Russ <[EMAIL PROTECTED]> wrote: > Thank you, Dave. That concurrency library looks great. I'll try to play > with it later this week. Let me know if you have questions / issues. I'm halfway through release 1.3 which will have better documentation and a new TaskArray class. p.s. I'll

Re: Form Scope Problems

Thanks Sean, Here's something funny...if I dump the scope on the process page, I always get the structure with the correct data. However, if I don't dump the scope and just try to check for the variable form.Options25--it is not defined. I guess I'm going to have to run a few tests and see if

RE: multithreading a single page/calling coldfusion methods from java

Thank you, Dave. That concurrency library looks great. I'll try to play with it later this week. Russ -Original Message- From: Dave Carabetta [mailto:[EMAIL PROTECTED] Sent: Thursday, December 01, 2005 12:16 AM To: CF-Talk Subject: Re: multithreading a single page/calling coldfusion me

Re: multithreading a single page/calling coldfusion methods from java

On 11/30/05, Russ <[EMAIL PROTECTED]> wrote: > Is there any way to have a page start multiple child threads? If you're using CFMX 7 Enterprise, yes - the async CFML gateway. If you want to call methods asynchronously and get results back, look at my Concurrency library (which requires CFMX 7 Ente

Re: Free SSL (was Re: Authorize.net request)

Hey, I'd agree. The insurance is a great feature. I've used instantssl.comfor many certs. Their price is pretty nice and they do have some good insurance (see below). - Fully validated, High Assurance - 1024 bit industry standard SSL Certificate - Trusted by all popular browsers - 99.

Re: multithreading a single page/calling coldfusion methods from java

On 11/30/05, Russ <[EMAIL PROTECTED]> wrote: > Is there any way to have a page start multiple child threads? > > > > From what I remember, there isn't. At least not just using pure coldfusion. > In that case, is there a way to do it using java? Perhaps have a java class > that can somehow call col

multithreading a single page/calling coldfusion methods from java

Is there any way to have a page start multiple child threads? >From what I remember, there isn't. At least not just using pure coldfusion. In that case, is there a way to do it using java? Perhaps have a java class that can somehow call coldfusion methods? Like lets say I have a cfc that ha

strange CFFILE output behavior

CFFILE seems to be putting extra linefeeds or carriage returns into the output written to a file. For example, Using: Here is my contents: GATGAGGAGGAGGTGGTGCTTGTGTGCGACAAGGTCATTGAGGAGGCTGACTTGGACGGTGACGGCAAGC TGGGCTTTGCTGACTTCGAGGACATGATTGCCAAGGTGACTTCCTCAGCACTTTCCACATCCGGAT C

REReplace

Hi there, I wish to remove the img tags from an article for email purposes. I have... ]+>)", "", "all")> However, this doesn't seem to be working ?? mike ~| Find out how CFTicket can increase your company's customer suppor

RE: read every file in a directory

-Original Message- From: Richard Colman [mailto:[EMAIL PROTECTED] Sent: Wednesday, November 30, 2005 9:39 PM To: CF-Talk Subject: read every file in a directory I need to read every file in a directory (filenames unknown) and proces

RE: read every file in a directory

Yes, cfdirectroy will give you the file names. Loop over those and use cffile to read them. ..:.:.:.:.:.:.:.:.:.:.:.:.:.:. Bobby Hartsfield http://acoderslife.com -Original Message- From: Richard Colman [mailto:[EMAIL PROTECTED] Sent: Wednesday, November 30, 2005 9:39 PM To: CF-Talk Sub

Re: read every file in a directory

Yes. Loop over the CFDIRECTORY query, using CFFILE on each entry. On 12/1/05, Richard Colman <[EMAIL PROTECTED]> wrote: > I need to read every file in a directory (filenames unknown) and process > each file sequentially, extracting some text from each page and building a > datafile with the extrac

read every file in a directory

I need to read every file in a directory (filenames unknown) and process each file sequentially, extracting some text from each page and building a datafile with the extracted page. I think I know how to do it, but am not sure about the reading a directory part and getting the filenames Ca

Read every file in a directory

I need to read every file in a directory (filenames unknown) and process each file sequentially, extracting some text from each page and building a datafile with the extracted page. I think I know how to do it, but am not sure about the reading a directory part and getting the filenames

Shopping Cart Coupon facility

hi there, i have the following function which checks the validity of a coupon code at checkout time. when uploading a new coupon, the site admin can specify a minimum amount spent as well as having it available for any purchase... -- SELECT promotio

Re: Form Scope Problems

On 11/30/05, Brad Haas <[EMAIL PROTECTED]> wrote: > Here's some partial code from both pages. Even though this code is very > "watered down", I can get it to produce the same type of problems as the full > application. All I have to do to get the form scope to disappear is to > submit this for

Re: Code reuse ideas?

If you think about it, this is exactly what frameworks do. For instance, with Mach-II you map a directory to the Mach-II framework folder, and all of your Mach-II apps use that directory for the core files. The disadvantage is that your shared files are just that- shared. You need to make sure

Re: Free SSL (was Re: Authorize.net request)

Wow, agreed. I had to visit multiple people with photo IDs and other ID just to get a free Email cert from Thawte. If any muggins can get a cert with any name, that CA should not be in the trusted certs list. Certs do more than just provide for encryption; they also verify identity. On 12/1/05, R

Re: FREE Homesite/CF Studio CFC VTML Generator

I just uploaded a new version that now supports the following primary keys: max_id, autonumber, uuid, guid, text user defined, and I suppose I should add a numeric user defined. The download can be found at: http://www.aftershockweb.net/forums/messages.cfm/ThreadId/50 Also, could someone send

Re: Form Scope Problems

Here's some partial code from both pages. Even though this code is very "watered down", I can get it to produce the same type of problems as the full application. All I have to do to get the form scope to disappear is to submit this form without selecting either radio button. Even if you sele

RE: Free SSL (was Re: Authorize.net request)

I don't know... Isn't the whole point of verisign is that they verify your identity on some level? Otherwise, I could just order a certificate from these guys for Amazon.com, somehow get your computer to recognize amazon.com as my ip (either through the hosts file, dns poisoning or other means) an

RE: Free SSL (was Re: Authorize.net request)

I thought that the reason you paid for certificates wasn't really anything to do with the cert, but more to do with the indemnity insurance that the issuer is offering if the cert gets cracked and your SSL connections reveal info to someone sniffing the packets... Could it happen? Theoretically, Ye

Re: Free SSL (was Re: Authorize.net request)

Oh, and the fact that they will most likely be included in the browsers as "trusted" before you or your company is. :-) On 11/30/05, John C. Bland II <[EMAIL PROTECTED]> wrote: > > Knowledge. :-) > > On 11/30/05, Russ <[EMAIL PROTECTED]> wrote: > > > > I'm confused... What's the difference between

Re: Free SSL (was Re: Authorize.net request)

Knowledge. :-) On 11/30/05, Russ <[EMAIL PROTECTED]> wrote: > > I'm confused... What's the difference between getting the certificate from > that site and generating one yourself? I've gotten a warning in IE as > well, > so if a browser is going to give users a warning, why not just generate > yo

RE: Free SSL (was Re: Authorize.net request)

I'm confused... What's the difference between getting the certificate from that site and generating one yourself? I've gotten a warning in IE as well, so if a browser is going to give users a warning, why not just generate your own? -Original Message- From: Bryan Stevenson [mailto:[EMAIL

RE: Form Scope Problems

> I'm having a really hard time with losing the form scope > variables on CFMX 7. I have a pretty simple form that posts > to a CF page. The form contains a couple of radio buttons > and a select box. The select box name is dynamically > generated, but it shows correctly when I view the page

RE: Form Scope Problems

Well, I have run into your problem before. If you don't select a radio button, the form fields don't show up on the next page. I always use cfparam in those cases. Or put a default selected option in the radio button array (on the form page), like a 'none' option. That way you will always have

Re: Form Scope Problems

Yes...they have to be able to submit the form with no data. The application is a "configurator", which allows the user to configure a machine. The user is not required to configure all of the components of a machine--which are handled by the form. Thanks, Brad > I don't know about fixing yo

RE: CF7 and 64-bit CPUs

Apparently it works, but I've since given up: NAT Subject: CF7 and 64-bit CPUs From: Dave Ross <[EMAIL PROTECTED]> Date: Wed, 30 Nov 2005 09:16:10 -0400 Try CF on Tomcat on a 1.5 64-bit

RE: Form Scope Problems

I don't know about fixing your problem, but you don't want people to submit an empty form anyway, do you? You can use the validation in the CF form fields (cfinput, cfselect, etc.), or build your own JS validation...anything to make sure the data you need is there (and valid) before the form is su

Re: Free SSL (was Re: Authorize.net request)

> All, the bad cert warning is because CACert is not included as a trusted > certification authority by default in IE or Firefox certificate settings. > So yes, that warning will probably pop up for most people landing on a site > which uses their certs. Note that one of their primary goals is "in

Re: Free SSl certs was: Re: Authorize.net request

Ok. Here's the deal. 1) Very confusing to get a cert setup using their admin. (will add steps below) 2) Once you figure it out it is a piece of cake to setup (can be done with 5 minutes, including validation sent by email) 3) https://katapultmedia.com/ shows the message. https://www.katapultmedia.

Re: Advance HTML form design

Yeap. here is another example of tabbed forms(called layering on this link) and just happens to be from qForms again but only because it was the first example I could find. http://www.pengoworks.com/qforms/docs/examples/multilayers.htm Guess it all boils down to what is a "advanced form" could ha

Free SSL (was Re: Authorize.net request)

All, the bad cert warning is because CACert is not included as a trusted certification authority by default in IE or Firefox certificate settings. So yes, that warning will probably pop up for most people landing on a site which uses their certs. Note that one of their primary goals is "inclusi

RE: Free SSl certs was: Re: Authorize.net request

> You're probably better off reading their news or forums than > listening to my > ramblings...but hopefully that's enough info to find reality ;-) Well, I don't know that I'll be using them anytime soon (or any other certificate, for that matter). I was just curious. [INFO] -- Access Manager

Re: Free SSl certs was: Re: Authorize.net request

I'm trying them now. I'll post about my experience. On 11/30/05, Bryan Stevenson <[EMAIL PROTECTED]> wrote: > > > Bryan, when I click join at CACert, I get a possible bogus certificate > > warning from Firefox. Is this something all CAcert users are going to > > have to subject their users too, o

Free SSl certs was: Re: Authorize.net request

> Bryan, when I click join at CACert, I get a possible bogus certificate > warning from Firefox. Is this something all CAcert users are going to > have to subject their users too, or is it just the way that CAcert setup > their site? I noticed that Firefox complained about *.cacert.org, maybe > i

Re: Code reuse ideas?

Thanks Aaron. Did you notice any downside to this? Anything that you could share is helpful. On 11/30/05, Aaron Rouse <[EMAIL PROTECTED]> wrote: > I know of a couple of in house frameworks that do just this. One for > example uses a lot of different custom tags for its CMS and that CMS is used >

RE: Advance HTML form design

The presentation Mosh posted has some validation on #2 (the one he pointed out) that is VERY similar to the qFOrms demo you pointed out. With a little styling it could be damn near identical. ..:.:.:.:.:.:.:.:.:.:.:.:.:.:. Bobby Hartsfield http://acoderslife.com -Original Message- From

Re: Advance HTML form design

Yeah, that is why I just commented on the presentation. I do not even think that version of qForms is released yet. I think OnTap framework does something similar, but not 100% on that. On 11/30/05, Bobby Hartsfield <[EMAIL PROTECTED]> wrote: > > Yes, qForms is very nice with a ton of options.

RE: Advance HTML form design

Yes, qForms is very nice with a ton of options. I'm just an egg head and I like to write my own for the practice and pure fun of it. : ) ..:.:.:.:.:.:.:.:.:.:.:.:.:.:. Bobby Hartsfield http://acoderslife.com -Original Message- From: Aaron Rouse [mailto:[EMAIL PROTECTED] Sent: Wednesday,

Form Scope Problems

I'm having a really hard time with losing the form scope variables on CFMX 7. I have a pretty simple form that posts to a CF page. The form contains a couple of radio buttons and a select box. The select box name is dynamically generated, but it shows correctly when I view the page source fro

RE: CF7 and 64-bit CPUs

> Dave, would you mind noting the "plenty of things" you're referring > to? I believe you've noted that CFLDAP stops working, but what else? > Also, are these things OS-specific that you're aware of? Just curious. You know, I really wish I had a complete list. Paul Hastings has mentioned a bunch o

RE: Advance HTML form design

A while back, I gave a presentation on DHTML and included some examples of "advanced" (I guess) form design. The presentation and accompanying source file are available from http://www.evoch.com/Community/presentations_dhtml.cfm Specifically, look at the "Form Design #2" example for how it accomp

Re: Authorize.net request

i know, i just HATE that we have to do this. and i wanted to vent. and yes, im psycho nazi about security, so dont worry, no converting needed here, im in the choir. :) tw On 11/30/05, Dave Carabetta <[EMAIL PROTECTED]> wrote: > On 11/30/05, Tony <[EMAIL PROTECTED]> wrote: > > just a wild questi

Re: CF7 and 64-bit CPUs

On 11/30/05, Dave Watts <[EMAIL PROTECTED]> wrote: > > You mean "supports" as "officially supported", correct? I > > think this thread is more about "Is it possible to run CFMX > > on a 64-bit jvm". > > No, I mean "supports" as "actually works correctly". There are plenty of > things in CFMX which

Long URLs in flash forms

Has anyone run across this, or know of a (better) workaround? Apparently a URL in an tag inside is truncated to 128 characters. However, using a with a GetURL() function works with URLs longer than 128 characters. CFMX 7 obviously... since it's a flash form. -- Jon

RE: Authorize.net request

Bryan, when I click join at CACert, I get a possible bogus certificate warning from Firefox. Is this something all CAcert users are going to have to subject their users too, or is it just the way that CAcert setup their site? I noticed that Firefox complained about *.cacert.org, maybe if you actu

Re: SOAP headers in MX 6.1

Conidering that I upgrade to MX 7, how can I pass this header in a soap envelope?: YourUniqueID Thanks On 11/30/05, Robert Munn <[EMAIL PROTECTED]> wrote: > > There is a 6.1 patch that adds SOAP header support, but I never got it to > work properly and eventually just upgraded to 7 (which I

RE: CF7 and 64-bit CPUs

> You mean "supports" as "officially supported", correct? I > think this thread is more about "Is it possible to run CFMX > on a 64-bit jvm". No, I mean "supports" as "actually works correctly". There are plenty of things in CFMX which stop working with any JVMs newer than 1.4.2_05. As for the

Re: Authorize.net request

yeah, I did the same and found a lot of "try for free" (verisign), etc. (i hate those too) On 11/30/05, Bryan Stevenson <[EMAIL PROTECTED]> wrote: > > np...and a Google of "free SSL certificate" turns up a bunch of hits...but > they > all look like directory sites or re-direct sites (damn I hate

Re: Code reuse ideas?

I know of a couple of in house frameworks that do just this. One for example uses a lot of different custom tags for its CMS and that CMS is used for 20+ sites. Instead of copying that pack of tags to each site they all point to a common spot that stores just one copy of them. That way when a up

Re: Advance HTML form design

I really like how the validation is presented on this form. I like the notifying the user of everything that is wrong via one attempt to submit and also the method of highlighting the wrong and showing an explanation. http://www.pengoworks.com/qforms/v2/demo/demo_dhtml_errorBox.htm On 11/30/0

Re: Code reuse ideas?

Any one have any thoughts on this? Am I not make any sense? On 11/30/05, Phill B <[EMAIL PROTECTED]> wrote: > Hey every one, > > I have around 9 web sites that all use copies of an original set of > code. I have converted most of the code to use CFCs which has been a > big help. I'm still having a

Re: Authorize.net request

np...and a Google of "free SSL certificate" turns up a bunch of hits...but they all look like directory sites or re-direct sites (damn I hate those) Bryan Stevenson B.Comm. VP & Director of E-Commerce Development Electric Edge Systems Group Inc. phone: 250.480.0642 fax: 250.480.1264 cell: 250.920

Re: Authorize.net request

Coo. That's not the one I saw but I'll check them out. Thx... On 11/30/05, Bryan Stevenson <[EMAIL PROTECTED]> wrote: > > > Bryan, I saw something about free certs somewhere but didn't save the > link. > > Mind passing the resource along? > > http://www.cacert.org/ > > Bryan Stevenson B.Comm. > V

Re: Authorize.net request

> Bryan, I saw something about free certs somewhere but didn't save the link. > Mind passing the resource along? http://www.cacert.org/ Bryan Stevenson B.Comm. VP & Director of E-Commerce Development Electric Edge Systems Group Inc. phone: 250.480.0642 fax: 250.480.1264 cell: 250.920.8830 e-mail:

Re: Authorize.net request

Bryan, I saw something about free certs somewhere but didn't save the link. Mind passing the resource along? On 11/30/05, Bryan Stevenson <[EMAIL PROTECTED]> wrote: > > > just a wild question but how many of us on here has ever had a situation > where > > someone was sniffing the packets on the wi

Re: SOAP headers in MX 6.1

There is a 6.1 patch that adds SOAP header support, but I never got it to work properly and eventually just upgraded to 7 (which I had via subscription anyway, so cost was not an issue). >Hi. I am using MX 6.1, trying to invoke a wsdl for a wevservice. The >webservice requires me to pass this as

SOAP headers in MX 6.1

Hi. I am using MX 6.1, trying to invoke a wsdl for a wevservice. The webservice requires me to pass this as a header: YourUniqueID I know that MX 6.1 does not have the addSOAPRequestHeader function that MX 7 does. Is there a way to send this header to the webservoce as a part of the soap enve

Re: Authorize.net request

> just a wild question but how many of us on here has ever had a situation where > someone was sniffing the packets on the wire, had the know how to decipher > what was there, and then use the data? > > really? > > tw To me or any of my clients..never...but I use SSL Now that you can get FREE SSL

Re: Authorize.net request

Ray, it was a huge issue on another list somewhere about it not being secure. I think it was the user group manager list. Someone was irate about not seeing the lock and they pretty much spit on MM for not having it until someone (MM employee) spoke up about how its done. Coo on the original point

Re: Authorize.net request

Ha! :-) Good one... On 11/30/05, Ray Champagne <[EMAIL PROTECTED]> wrote: > > dude! that's like saying "how many of you have been hit by a bus?" and > when no one answers, we all decide to stop looking both ways before > crossing the street. > > i mean, *I've* never heard of it happening, but it

Re: Authorize.net request

We haven't. We did a large e-commerce site for a leading cell phone provider (it was internal to their employees) and they didn't care about https for a whole year. Version 2 had https which took all of 10 minutes to update the site but for version 1 over 100k (or there about) was bought and no on

Re: Authorize.net request

On 11/30/05, Tony <[EMAIL PROTECTED]> wrote: > just a wild question but how many of us on here has ever had a situation where > someone was sniffing the packets on the wire, had the know how to decipher > what was there, and then use the data? > > really? > Respectfully, it's that sort of thought

Re: Authorize.net request

Well, no I haven't bought anything from them, but I do get what your original point is now. I'm actually a little surprised to hear that... John C. Bland II wrote: > Have you bought from MM's online store? The button to checkout says Secure > Checkout but there is no lock. Why? Because the swf u

Re: Authorize.net request

Have you bought from MM's online store? The button to checkout says Secure Checkout but there is no lock. Why? Because the swf uses an https call to process the order. The swf isn't viewed in an https setting. I agree with you guys whole heartedly. We were just dealing with a completely different

Re: Authorize.net request

dude! that's like saying "how many of you have been hit by a bus?" and when no one answers, we all decide to stop looking both ways before crossing the street. i mean, *I've* never heard of it happening, but it *is* possible. Tony wrote: > just a wild question but how many of us on here has ev

Re: Authorize.net request

The practicality isn't what I was referring to. It seemed as if the thought was "we're not behind https so we can't use AIM," which I was pointing out is incorrect. I agree...posting to a form not behind https isn't good but I wasn't dealing with that aspect. On 11/30/05, Mark A Kruger <[EMAIL PRO

Re: Authorize.net request

just a wild question but how many of us on here has ever had a situation where someone was sniffing the packets on the wire, had the know how to decipher what was there, and then use the data? really? tw On 11/30/05, Mark A Kruger <[EMAIL PROTECTED]> wrote: > Actually that is not correct... at l

Assistance Interpreting JRUN metrics

Could someone more familiar with the technical points of JRUN metrics assist me in interpreting these metric logs? http://tracker.iofficecorp.com/uploads/11302005AM.pdf http://tracker.iofficecorp.com/uploads/11302005NOON.pdf http://tracker.iofficecorp.com/uploads/113020051-2pm.pdf We are having

Re: Authorize.net request

Not to mention the fact that if I am putting gin my credit card and personal info into a form, I NEED to see the lock down there in the corner. If I don't, you won't see me typing my credit card info into that form. So, it can lose you customers too. Mark A Kruger wrote: > Actually that is n

RE: Authorize.net request

Actually that is not correct... at least not practical. While it's true that the POST to authorize.net is secure, you have to collect the data somehow first. That means the user would submit an insecure form to US and we would turn around and post the data to auth.net. -mark -Original Messa

RE: Authorize.net request

Who uses ninjas these days!? That's so 1980's. You might as well break out the "Plumbers Helper" while you're at it. -e -Original Message- From: Tony [mailto:[EMAIL PROTECTED] Sent: Wednesday, November 30, 2005 2:57 PM To: CF-Talk Subject: Re: Authorize.net request i mean, i didnt n

Re: Authorize.net request

its VERY simple code. its just a cfhttp with some parameters... right? i mean, i didnt need to use any ninja for it. tw On 11/30/05, John C. Bland II <[EMAIL PROTECTED]> wrote: > Ah, coo. > > On 11/30/05, Ray Champagne <[EMAIL PROTECTED]> wrote: > > > > you're fine. that's just a warning, it

RE: Advance HTML form design

I've got another one that is very similar and will be up soon. The great thing about that validation is that it is serverside although it looks like client side. Actually I guess it’s a mix of both. Client side scripts send it to the serverside validation scripts. (the server side takes over all

Re: Advance HTML form design

That is some pretty slick validation, do you have anymore examples of forms like this? Here is an example of some usability I found for a multiple select box, it works like a charm. http://justinsomnia.org/2005/01/roll-your-own-multiple-select-listbox/ Bob Everland ~

java.sql.SQLException

We get this error randomly and usually hitting refresh it goes away. This is datasource for client variable storage. Any thoughts on what the issue could be and why it would just happen on occasion? Error Occurred While Processing Request Operation failed on the data source named "CF_CLIENT_SE

Re: Authorize.net request

Ah, coo. On 11/30/05, Ray Champagne <[EMAIL PROTECTED]> wrote: > > you're fine. that's just a warning, it goes through anyways. > > John C. Bland II wrote: > > Was my email with the code received? I got an email back about the body > > being too long. > > > > > > > > ~~~

Re: Authorize.net request

you're fine. that's just a warning, it goes through anyways. John C. Bland II wrote: > Was my email with the code received? I got an email back about the body > being too long. > > > ~| Find out how CFTicket can increase your

Re: Authorize.net request

Was my email with the code received? I got an email back about the body being too long. ~| Logware (www.logware.us): a new and convenient web-based time tracking application. Start tracking and documenting hours spent on a proje

Re: Authorize.net request

You don't have to be in a secure site to post with AIM. If you notice the url to the dll is secure (https://secure.authorize.net/gateway/transact.dll ). If SIM is what you want then I'll bow out gracefully. :-) I haven't used SIM. Thx... On 11/30/05, Jason Herbolsheimer <[EMAIL PROTECTED]> wrote

Re: Authorize.net request

You might want to think about asking Authorize.NET to add the cf code you found into the ir online docs. Not sure if they'll do it or not, but if it was a choice in the sample scripts, I bet we could get more ppl to either switch to Cf or use it over PHP and ASP or :::shudder::: PERL. It's all

RE: Authorize.net request

The problem we (Mike and I) were having was that we are unable to use AIM because we are not in a secure environment, so we needed to post to auth.net to finish the process (SIM). The problem we were having was building the fingerprint items(transaction key, loginid, sequence, amount) to pass to au

Re: Javascript Scrolling news ticker

DHTMLCentral.com Bryan Stevenson B.Comm. VP & Director of E-Commerce Development Electric Edge Systems Group Inc. phone: 250.480.0642 fax: 250.480.1264 cell: 250.920.8830 e-mail: [EMAIL PROTECTED] web: www.electricedgesystems.com ~~~

Javascript Scrolling news ticker

Anyone know of a good Javascript horizontal scrolling script that I could use for a news ticker? Thank you, Daron Smith PSEA ~| Logware (www.logware.us): a new and convenient web-based time tracking application. Start tracking

RE: qBrowser Released

Ha! Pay attention bobby! I thought you were asking if I got the fakeap working. I'm going back to my dark corner. ..:.:.:.:.:.:.:.:.:.:.:.:.:.:. Bobby Hartsfield http://acoderslife.com -Original Message- From: Ryan Guill [mailto:[EMAIL PROTECTED] Sent: Wednesday, November 30, 2005 12:26

Re: Authorize.net request

I would suggest using AIM (read docs...Auth.net suggests it too). You can create an MD5 in their control panel and use that in your code to make the call. Below is code I used the other day from an old project kinda "redone" a bit for this new project. I'm open to any suggestions someone may have a

RE: CFIDE directory in CFMX 7.0.1 on Solaris with multi-server instal l

I've seen a few people do that... they don’t usually keep all the contents in the cfide dir though. You'll usually find stuff like the js libraries for cfforms and such. ..:.:.:.:.:.:.:.:.:.:.:.:.:.:. Bobby Hartsfield http://acoderslife.com -Original Message- From: Earl, George [mailto:[

Re: qBrowser Released

its my laptop. all of our production servers are all pwd'ed up and stuff. why bother on a dev laptop? really. tw On 11/30/05, Russ <[EMAIL PROTECTED]> wrote: > In that case, do you have a default linksys SID with no security set up? > Where are you located? I feel a wardrive coming on :-P > > --

Re: qBrowser Released

oh yes, not aproblem at all... just had to keep erasing that field... other than that, its working fine ryan, good job! tw On 11/30/05, Ryan Guill <[EMAIL PROTECTED]> wrote: > So were you able to get it working though? > > On 11/30/05, Ryan Guill <[EMAIL PROTECTED]> wrote: > > If you blank it ou

CFIDE directory in CFMX 7.0.1 on Solaris with multi-server instal l

We are finally entering the world of CFMX, jumping right from CF5 on Win2k to CFMX 7.0.1 on Solaris (Enterprise, multi-server install). We have lots to learn. I have been given the following path on the Solaris server in which to install my web application: server_address/data/cf7data/apps/appli

RE: qBrowser Released

**actually I guess we were using Kismet... not netstumbler ..:.:.:.:.:.:.:.:.:.:.:.:.:.:. Bobby Hartsfield http://acoderslife.com -Original Message- From: Bobby Hartsfield [mailto:[EMAIL PROTECTED] Sent: Wednesday, November 30, 2005 12:52 PM To: CF-Talk Subject: RE: qBrowser Released

RE: qBrowser Released

Yeah, heard about someone running it at DefCon and had to try it out. Once "we" found a card it would work with, yeah... it was pretty easy. I've never seen so many APs in netstumbler :) It was a friends card. I think it was an Oronico? I can find out for sure (I need to find out and get one for

Re: Authorize.net request

I'd be interested in this, too. Please post here or send the example code to my address if you can. Thanks, Stephen On 11/30/05, Ray Champagne <[EMAIL PROTECTED]> wrote: > > > back authorized or declined. I can share the code with you once I get > to work in about an hour. I'll email you off li

Re: qBrowser Released

So were you able to get it working though? On 11/30/05, Ryan Guill <[EMAIL PROTECTED]> wrote: > If you blank it out, and run a query and it comes back, its because > you have a password saved in your browser. I ran into that the other > day. > > If you are using firefox, you can go in and clear o

RE: pseudo-memory leak

> -Original Message- > From: Kerry [mailto:[EMAIL PROTECTED] > Sent: Wednesday, November 30, 2005 11:35 AM > To: CF-Talk > Subject: RE: pseudo-memory leak > > are you saying if it takes 2 weeks to hack a website, its less hacked than > if it takes 2 hours? > :P Well... sorta. ;^) In thi

RE: qBrowser Released

This s fun... http://www.blackalchemy.to/project/fakeap/ ;) ..:.:.:.:.:.:.:.:.:.:.:.:.:.:. Bobby Hartsfield http://acoderslife.com -Original Message- From: Bryan Stevenson [mailto:[EMAIL PROTECTED] Sent: Wednesday, November 30, 2005 11:44 AM To: CF-Talk Subject: Re: qBrowser Released

  1   2   >