On 2021-10-29 10:36:25 -0300, Lucas Kanashiro wrote:
> On Thu, 28 Oct 2021 23:34:28 +0200 Sebastian Ramacher
> wrote:
> > Yes, please go ahead
>
> I just uploaded ruby-defaults/1:2.7.6 to unstable adding ruby3.0 as an
> alternative interpreter, it should be available soo
On 2021-10-30 00:50:49 +0200, Drew Parsons wrote:
> On 2021-10-22 14:35, Sebastian Ramacher wrote:
> > On 2021-10-12 13:09:02, Drew Parsons wrote:
> ...
> > > I'd like to proceed with a transition of the numerical library stack.
> ...
> > > (along with other fenic
Control: tags -1 confirmed
On 2021-10-20 09:45:10 -0300, Antonio Terceiro wrote:
> Control: tag -1 - moreinfo
>
> On Sat, Oct 16, 2021 at 03:46:11PM +0200, Sebastian Ramacher wrote:
> > Control: tags -1 moreinfo
> >
> > On 2021-10-15 06:44:36 -0300, Anton
ot;;
> is_good = .depends ~ "(libnetcdf\-mpi\-19|libnetcdf\-pnetcdf\-19)";
> is_bad = .depends ~ "(libnetcdf\-mpi\-18|libnetcdf\-pnetcdf\-18)";
>
--
Sebastian Ramacher
signature.asc
Description: PGP signature
tml
>
> --
> Simon Quigley
> tsimo...@debian.org
> tsimonq2 on LiberaChat and OFTC
> 5C7A BEA2 0F86 3045 9CC8
> C8B5 E27F 2CF8 458C 2FA4
>
--
Sebastian Ramacher
signature.asc
Description: PGP signature
ing in NEW) uses that refactored class, so the transition
> should run smoothly, and my local rebuild on amd64 was successful at
> least.
>
> The auto-generated ben file is good.
Please go ahead
Cheers
>
> Cheers
> Timo
>
>
>
--
Sebastian Ramacher
signature.asc
Description: PGP signature
rg/transitions/html/auto-mumps.html
> https://release.debian.org/transitions/html/auto-petsc.html
> https://release.debian.org/transitions/html/auto-slepc.html
>
>
> Ben file:
>
> title = "numerical library stack";
> is_affected = .depends ~ "libpetsc-.*3.14" | .depends ~ "libpetsc-.*3.15";
> is_good = .depends ~ "libpetsc-.*3.15";
> is_bad = .depends ~ "libpetsc-.*3.14";
>
--
Sebastian Ramacher
-2) OK
> therion (5.5.7ds1-2) FTBFS
>(#983345)
>
> qgis(3.16.10+dfsg-1) OK
>
>
> Kind Regards,
>
> Bas
>
--
Sebastian Ramacher
signature.asc
Description: PGP signature
On 2021-10-18 21:37:35 +0200, Sebastian Ramacher wrote:
> On 2021-10-18 13:24:20, Drew Parsons wrote:
> > On 2021-10-16 00:01, Drew Parsons wrote:
> > > On 2021-10-15 21:02, Sebastian Ramacher wrote:
> > > > >
> > > > > I'd like to proceed
On 2021-10-18 13:24:20, Drew Parsons wrote:
> On 2021-10-16 00:01, Drew Parsons wrote:
> > On 2021-10-15 21:02, Sebastian Ramacher wrote:
> > > >
> > > > I'd like to proceed with a transition of the numerical library stack.
> > > > This involves
On 2021-10-05 06:02:11 +0200, Bastian Blank wrote:
> On Mon, Oct 04, 2021 at 10:38:39PM +0200, Helmut Grohne wrote:
> > I was looking into why debianutils doesn't migrate and saw the block
> > hint from Sebastian Ramacher:
> > | # 20210818
> > | # #992399: removes
;
> Most of those bugs are for leaf libraries. We already started fixing the
> ones that block a lof of other (e.g. the ones with C extensions that
> FTBFS with ruby3.0) so they are ready to be binNMUed.
ruby3.0 isn't in testing yet - it currently fails to build on ppc64el.
So let's at least wait until it migrated.
Cheers
--
Sebastian Ramacher
signature.asc
Description: PGP signature
be compatible with both 40 and 41. Many of the rest were
> already autoremoved from testing due to incompatibility with Shell 40.
Please go ahead
Cheers
>
> smcv
>
--
Sebastian Ramacher
signature.asc
Description: PGP signature
ansition
> X-Debbugs-Cc: jspri...@debian.org
>
> Hi release team,
>
> I would like to transition ros-ros-comm. The auto generated ben file
> is ok and I've rebuild all reverse dependencies successfully.
Please go ahead
Cheers
>
> Cheers Jochen
>
--
Sebastian Ra
gt; Usertags: transition
>
> Hi release team,
>
> I would like to transition ros-geometric-shapes. The autogenerated Ben
> file is ok and I've tested the downstream dependency successfully.
Please go ahead
Cheers
>
> Cheers Jochen
>
--
Sebastian Ramacher
signature.asc
Description: PGP signature
tml
> https://release.debian.org/transitions/html/auto-petsc.html
> https://release.debian.org/transitions/html/auto-slepc.html
Please go ahead
Cheers
>
>
> Ben file:
>
> title = "numerical library stack";
> is_affected = .depends ~ "libpetsc-.*3.1
/10/08 22:51:04 Build results:
> 2021/10/08 22:51:04 PASSED: dart
Please go ahead
Cheers
> """
>
> Ben file:
>
> title = "fcl";
> is_affected = .depends ~ "libfcl0.6" | .depends ~ "libfcl0.7";
> is_good = .depends ~ "libfcl0.7";
> is_bad = .depends ~ "libfcl0.6";
>
> Thanks!
>
--
Sebastian Ramacher
signature.asc
Description: PGP signature
On 2021-10-03 21:42:59, Sebastian Ramacher wrote:
> Hi Norbert, Phil
>
> On 2021-09-27 10:22:31 +0900, Norbert Preining wrote:
> > Hi Phil,
> >
> > I pushed a commit with initial changes for libqalculate20-data dummy
> > package. Please take a look.
>
>
On 2021-10-11 21:41:32, Sebastian Ramacher wrote:
> Control: tags -1 confirmed
> Control: forwarded -1
> https://release.debian.org/transitions/html/auto-pcl.html
>
> On 2021-10-10 22:45:58 +0200, Jochen Sprickerhof wrote:
> > Package: release.debian.org
> >
es from libsidplayfp6.
Cheers
>
> Regards,
> Laszlo/GCS
>
--
Sebastian Ramacher
signature.asc
Description: PGP signature
;
> Hi release team,
>
> I would like to transition pcl. The autogenerated ben file looks fine
> and ros-perception-pcl builds against the new version. For python-pcl I
> will upload a fixed version myself.
Please go ahead
Cheers
>
> Cheers Jochen
>
--
Sebastian Ra
Control: tags -1 = confirmed
On 2021-10-05 00:27:53 +0200, Jose Luis Rivero wrote:
> On Sun, Sep 19, 2021 at 6:10 PM Sebastian Ramacher
> wrote:
>
> > The automatically generated tracker at
> > https://release.debian.org/transitions/html/auto-console-bridge.html
>
tion
>
> Hi release team,
>
> I would like to transition orocos-kdl. The auto generated ben file looks
> fine and I've rebuild all reverse dependencies successfully.
Please go ahead
Cheers
>
> Cheers Jochen
>
--
Sebastian Ramacher
signature.asc
Description: PGP signature
s.debain.org
> Severity: normal
>
> I request permission to do the vala transition.
>
> We can do a binNMU for valabind. I confirmed that valabind builds
> successfully against the new vala version.
>
> https://release.debian.org/transitions/html/auto-vala.html
Please go ahead.
Cheers
--
Sebastian Ramacher
to act on #993624.
>
> Kind Regards,
>
> Bas
>
> --
> GPG Key ID: 4096R/6750F10AE88D4AF1
> Fingerprint: 8182 DE41 7056 408D 6146 50D1 6750 F10A E88D 4AF1
--
Sebastian Ramacher
Hi Norbert, Phil
On 2021-09-27 10:22:31 +0900, Norbert Preining wrote:
> Hi Phil,
>
> I pushed a commit with initial changes for libqalculate20-data dummy
> package. Please take a look.
Any news regarding libqalculate20-data?
Cheers
--
Sebastian Ramacher
signature.asc
Desc
/release.debian.org/transitions/html/auto-gupnp.html
Please go ahead
Cheers
>
> Thank you,
> Jeremy Bicha
>
--
Sebastian Ramacher
signature.asc
Description: PGP signature
"libquvi-0.9-0.9.4";
> is_good = .depends ~ "libquvi-0.9-0.9.4";
> is_bad = .depends ~ "libquvi-0.9-0.9.3";
>
>
> Thanks,
> Boyuan Yang
--
Sebastian Ramacher
signature.asc
Description: PGP signature
On 2021-09-29 10:01:18 +0200, Sebastian Ramacher wrote:
> Control: tags -1 confirmed
> Control: forwarded -1
> https://release.debian.org/transitions/html/auto-glew.html
>
> On 2021-09-25 12:24:06 +0100, Alastair McKinstry wrote:
> > Package: release.debian.org
> >
-1) OK
> pyferret (7.6.3-3) OK
> qgis (3.16.10+dfsg-1) OK
>
> cdo(2.0.0~rc5-1) OK
> metview(5.13.0-1)OK
Please go ahead
Cheers
>
>
> Kind Regards,
>
> Bas
>
--
Sebastian Ramacher
signature.asc
Description: PGP signature
inx
> rss-glx: OK
> scorched3d: OK
> slic3r-prusa OK
> slop: FTBFS (#994824) unrelated
> sludge: OK
> sofa-framework: FTBFS (#875184): QT4 removed
> spring: OK
> supertux: OK
> supertuxkart: OK
> trigger-rally: OK
> tulip: OK
> vice (contrib): FTBFS #994835 (jpeg support missing)
> vtk7: OK
> vtk9: OK
> warzone2100: OK
> widelands: OK
>
> cegui-mk2: OK
> meshlab; OK
> openscad: FTBFS (#994937) CGAL-related ?
> pcl:OK
Please go ahead
Cheers
>
>
--
Sebastian Ramacher
signature.asc
Description: PGP signature
On 2021-09-28 07:09:11 +0200, Andreas Tille wrote:
> On Tue, Sep 28, 2021 at 12:07:49AM +0200, Sebastian Ramacher wrote:
> > > > I think we should now focus on autopkgtests of the r-bioc-* packages
> > > > since some test were depending from packages in a high
On 2021-09-28 08:12:11, Andrius Merkys wrote:
> Hi Sebastian,
>
> On 2021-09-28 00:40, Sebastian Ramacher wrote:
> > Please go ahead
>
> Thanks! By the way, did you intend to close the transition bug? AFAIR,
> such bugs were kept open until the completi
On 2021-09-15 09:11:02 +0200, Sebastian Ramacher wrote:
> On 2021-09-15 07:13:25, Andreas Tille wrote:
> > Hi,
> >
> > On Sun, Aug 15, 2021 at 10:01:21AM +0200, Dylan Aïssi wrote:
> > >
> > > The transition tracker is on at
> > > https://release.
p with a dependency on the new glib.
Please feel free to go ahead after glib2.0 migrated.
Cheers
>
> Thanks,
> Jeremy Bicha
>
--
Sebastian Ramacher
signature.asc
Description: PGP signature
ickwand-6.q[^-]+-7|libmagick++-6.q[^-]+-9)";
> is_bad = .depends ~
> "(?:libmagickcore-6.q[^-]+-6|libmagickwand-6.q[^-]+-6|libmagick++-6.q[^-]+-8)";
--
Sebastian Ramacher
signature.asc
Description: PGP signature
Hi Phil
On 2021-09-16 23:09:17 +0200, Sebastian Ramacher wrote:
> On 2021-09-10 09:49:05 +0200, Sebastian Ramacher wrote:
> > Control: tags -1 confirmed
> > Control: forwarded -1
> > https://release.debian.org/transitions/html/auto-libqalculate.html
> >
> > On
On 2021-09-25 14:55:23 +0100, Simon McVittie wrote:
> On Sat, 25 Sep 2021 at 15:01:46 +0200, Sebastian Ramacher wrote:
> > Regardless of future transitions of libffi, if glib and the
> > introspection ecosystems are closely tied to the the libffi ABI, the
> > affected pac
libffi, if glib and the
introspection ecosystems are closely tied to the the libffi ABI, the
affected packages need to express that with the proper dependencies. We
have the same situation with boost and icu and boost and python3.X.
If you implement a similar solution to that in boost, this would also
allows us to track this via ben in a future libffi transition.
Cheers
--
Sebastian Ramacher
signature.asc
Description: PGP signature
On 2021-09-23 11:44:14 +0200, Sebastiaan Couwenberg wrote:
> On 9/23/21 11:40 AM, Sebastian Ramacher wrote:
> > On 2021-09-23 11:34:21, Sebastiaan Couwenberg wrote:
> >> On 9/18/21 9:57 AM, Sebastian Ramacher wrote:
> >>> On 2021-09-18 07:01:38 +0200, Sebastiaan Couwe
no-change uploads.
Please go ahead.
Cheers
--
Sebastian Ramacher
signature.asc
Description: PGP signature
On 2021-09-23 11:40:15, Sebastian Ramacher wrote:
> On 2021-09-23 11:34:21, Sebastiaan Couwenberg wrote:
> > On 9/18/21 9:57 AM, Sebastian Ramacher wrote:
> > > On 2021-09-18 07:01:38 +0200, Sebastiaan Couwenberg wrote:
> > >> On 9/12/21 7:54 PM, Sebastiaan Couwenb
On 2021-09-23 11:34:21, Sebastiaan Couwenberg wrote:
> On 9/18/21 9:57 AM, Sebastian Ramacher wrote:
> > On 2021-09-18 07:01:38 +0200, Sebastiaan Couwenberg wrote:
> >> On 9/12/21 7:54 PM, Sebastiaan Couwenberg wrote:
> >>
> >> Quite a few packages on mipsel ma
he new
> foonathan-memory version.
>
> The auto-generated Ben file is fine:
> https://release.debian.org/transitions/html/auto-foonathan-memory.html
Please go ahead
Cheers
>
> Cheers
> Timo
>
>
--
Sebastian Ramacher
t is not required.
>
> GNOME team: any last-minute objections?
>
> Release team: please let us know when we can go ahead.
This does not seem to require a lot of attentation from our side. Please
go ahead whenever you are ready.
Cheers
>
> Thanks,
> smcv
>
--
Sebastian Ramacher
signature.asc
Description: PGP signature
3.7b" | .depends ~ "proftpd-abi-1.3.7c";
> is_good = .depends ~ "proftpd-abi-1.3.7c";
> is_bad = .depends ~ "proftpd-abi-1.3.7a" | .depends ~ "proftpd-abi-1.3.7b";
>
> Please trigger a rebuild. Thanks!
Scheduled
Cheers
>
> Hilmar
> --
> sigfault
>
>
--
Sebastian Ramacher
signature.asc
Description: PGP signature
ts more reverse dependencies. Do those also build fine with the new
version of console-bridge?
Cheers
>
> Ben file:
>
> title = "urdfdom";
> is_affected = .depends ~ "libconsole-bridge0.4" | .depends ~
> "libconsole-bridge1.0";
> is_good = .depends ~ "libconsole-bridge1.0";
> is_bad = .depends ~ "libconsole-bridge0.4";
>
> Thanks!
>
--
Sebastian Ramacher
signature.asc
Description: PGP signature
r 200 packages and a bunch of binNMUs that are blocked by
glibc. I'm slowly wading through that list.
Cheers
--
Sebastian Ramacher
signature.asc
Description: PGP signature
On 2021-09-15 20:09:26 +0200, Sebastian Ramacher wrote:
> On 2021-09-14 09:12:34 +0100, Simon McVittie wrote:
> > On Sun, 12 Sep 2021 at 20:17:36 +0100, Simon McVittie wrote:
> > > According to
> > > https://release.debian.org/transitions/html/auto-upperlimit-gnom
all changes and I approve them
[x] attach debdiff against the package in (old)stable
[x] the issue is verified as fixed in unstable
Cheers
--
Sebastian Ramacher
diff -Nru dazzdb-1.0+git20201103.8d98c37/debian/changelog
dazzdb-1.0+git20201103.8d98c37/debian/changelog
--- dazzdb-
On 2021-09-10 09:49:05 +0200, Sebastian Ramacher wrote:
> Control: tags -1 confirmed
> Control: forwarded -1
> https://release.debian.org/transitions/html/auto-libqalculate.html
>
> On 2021-09-06 23:49:01, Phil Morrell wrote:
> > Package: release.debian.org
> >
igration of some of the ongoing transtions, I will look at some
additional binNMUs
Cheers
>
> smcv
>
--
Sebastian Ramacher
signature.asc
Description: PGP signature
e depending from packages in a higher transition
> level.
>
> Kind regards
>
> Andreas.
>
> [1] https://lists.debian.org/debian-r/2021/09/msg00067.html
>
> --
> http://fam-tille.de
>
--
Sebastian Ramacher
yim currently is the only reverse dependency of in
> >> unstable.
> >
> > coyim is not in bookworm. Did you want request removal from unstable?
>
> Correct. Just wanting to clean up my packages as at least coyim would
> surely just be accumulating bug reports from now :)
R
uest removal from unstable?
Cheers
>
> Cheers
> Sascha
>
> [0] https://bugs.debian.org/cgi-bin/bugreport.cgi?bug=930332
> [1] https://bugs.debian.org/cgi-bin/bugreport.cgi?bug=979755
>
--
Sebastian Ramacher
the tracker transition finishes - they
> don't seem to collide.
tracker is almost done (except for netatalk which is blocked by glibc).
Unless netatalk is a blocker, let's go ahead with mutter.
Cheers
>
> smcv
>
--
Sebastian Ramacher
signature.asc
Description: PGP signature
On 2021-09-11 17:02:48 +0200, Sebastiaan Couwenberg wrote:
> On 9/10/21 9:35 AM, Sebastian Ramacher wrote:
> > On 2021-09-09 13:02:14, Sebastiaan Couwenberg wrote:
> >> On 9/9/21 5:57 AM, Sebastiaan Couwenberg wrote:
> >>> On 9/8/21 6:56 AM, Sebastiaan Couwenberg w
On 2021-09-05 19:28:40 +0200, Sebastian Ramacher wrote:
> Control: tags -1 confirmed
> Control: forwarded -1
> https://release.debian.org/transitions/html/auto-folks.html
>
> On 2021-08-31 11:12:37 +0200, Laurent Bigonville wrote:
> > Package: release.debian.org
> >
gt; https://buildd.debian.org/status/package.php?p=libqalculate=experimental
>
> It has 4 reverse dependencies which have all been test built with the
> new version and we have significant team overlap with them for future
> uploads.
Please go ahead
Cheers
--
Sebastian Ramacher
On 2021-09-09 13:02:14, Sebastiaan Couwenberg wrote:
> On 9/9/21 5:57 AM, Sebastiaan Couwenberg wrote:
> > On 9/8/21 6:56 AM, Sebastiaan Couwenberg wrote:
> >> On 9/7/21 3:07 PM, Sebastiaan Couwenberg wrote:
> >>> On 9/5/21 6:48 PM, Sebastian Ramacher wrote:
>
vlc) build fine with
> the new version in experimental.
>
> Thanks,
> Dylan
>
--
Sebastian Ramacher
signature.asc
Description: PGP signature
Control: tags -1 confirmed
On 2021-09-05 18:54:16 +0200, László Böszörményi wrote:
> On Wed, Sep 1, 2021 at 10:41 AM Sebastian Ramacher
> wrote:
> > On 2021-08-21 10:49:04 +0200, László Böszörményi wrote:
> > > Again a small transition of botan to 2.18.1 version. Rever
y reportbug, but probably not needed since
> auto-soapysdr is fine:
>
> title = "soapysdr";
> is_affected = .depends ~ "libsoapysdr0.7" | .depends ~ "libsoapysdr0.8";
> is_good = .depends ~ "libsoapysdr0.8";
> is_bad = .depends ~ "libsoapysdr0.7";
>
>
> Thanks.
>
--
Sebastian Ramacher
signature.asc
Description: PGP signature
On 2021-08-30 23:17:50 +0200, Sebastian Ramacher wrote:
> Control: tags -1 confirmed
> Control: forwarded -1
> https://release.debian.org/transitions/html/auto-tracker.html
>
> On 2021-08-26 20:02:13 -0400, Jeremy Bicha wrote:
> > Package: release.debian.org
>
ons/html/auto-folks.html
>
> Kind regards,
> Laurent Bigonville
>
--
Sebastian Ramacher
signature.asc
Description: PGP signature
;
> --
> Aurelien Jarno GPG: 4096R/1DDD8C9B
> aurel...@aurel32.net http://www.aurel32.net
>
--
Sebastian Ramacher
signature.asc
Description: PGP signature
e to
> ACK / NACK this transition.
Please go ahead.
Cheers
>
> Regards,
> Laszlo/GCS
>
--
Sebastian Ramacher
signature.asc
Description: PGP signature
.0-12-amd64 (SMP w/8 CPU cores)
> Kernel taint flags: TAINT_OOT_MODULE, TAINT_UNSIGNED_MODULE
> Locale: LANG=en_IE.UTF-8, LC_CTYPE=en_IE.UTF-8 (charmap=UTF-8),
> LANGUAGE=en_IE:en (charmap=UTF-8)
> Shell: /bin/sh linked to /bin/dash
> Init: systemd (via /run/systemd/system)
>
>
--
Sebastian Ramacher
signature.asc
Description: PGP signature
(2.3.0-2)OK
> paraview(5.9.0-2)OK
> sumo(1.8.0+dfsg2-5) OK
>
> libgdal-grass (3.2.2-1 / 3.3.1-1~exp1) FTBFS / OK
> otb (7.2.0+dfsg-1) OK
> qgis(3.16.10+dfsg-1) OK
>
>
> Kind Regards,
>
> Bas
>
--
Sebastian Ramacher
signature.asc
Description: PGP signature
with the new Botan release.
biboumi is also involved in the ongoing libidn transition. So let's
postpone this transition until libidn is done.
Cheers
>
> Thanks in advance,
> Laszlo/GCS
>
--
Sebastian Ramacher
signature.asc
Description: PGP signature
64 architectures.
Cheers
>
> Example Ben file (the one currently from auto-wbxml2 should be enough):
>
> title = "wbxml2";
> is_affected = .depends ~ "libwbxml2-0" | .depends ~ "libwbxml2-1";
> is_good = .depends ~ "libwbxml2-1";
> is_bad =
On 2021-08-30 23:11:48 +0200, Sebastian Ramacher wrote:
> Control: tags -1 confirmed
> Control: forwarded -1
> https://release.debian.org/transitions/html/auto-knot.html
>
> On 2021-08-26 13:45:39 +, Jakub Ružička wrote:
> > Package: release.debian.org
> >
On 2021-08-10 23:40:20 +0200, Sebastian Ramacher wrote:
> Package: release.debian.org
> Severity: normal
> Tags: bullseye
> User: release.debian@packages.debian.org
> Usertags: pu
> X-Debbugs-Cc: sramac...@debian.org
>
> [ Reason ]
> The BDJ features of libblur
ad the last time? Such a tracker would have made this a
lot easier.
In any case, I am holding off on scheduling any other KDE (PIM) related
binNMUs until you come up with a complete list.
Cheers
--
Sebastian Ramacher
signature.asc
Description: PGP signature
> https://release.debian.org/transitions/html/auto-tracker.html
>
> https://salsa.debian.org/berto/grilo-plugins/-/merge_requests/2
>
> Thank you,
> Jeremy Bicha
>
--
Sebastian Ramacher
signature.asc
Description: PGP signature
bad = .depends ~ /\b(libknot11|libzscanner3)\b/;
>
> Thank you.
>
>
> Cheers,
> Jakub
>
--
Sebastian Ramacher
signature.asc
Description: PGP signature
t; title = "wbxml2";
> is_affected = .depends ~ "libwbxml2-0" | .depends ~ "libwbxml2-1";
> is_good = .depends ~ "libwbxml2-1";
> is_bad = .depends ~ "libwbxml2-0";
>
>
> Thanks,
> Boyuan Yang
--
Sebastian Ramacher
signature.asc
Description: PGP signature
> Thanks,
> Andrius
>
> [1]
> https://release.debian.org/transitions/html/auto-schroedinger-coordgenlibs.html
>
--
Sebastian Ramacher
signature.asc
Description: PGP signature
R Packages team will upgrade to the new upstream releases
> all of the reverse dependencies.
Please go ahead
Cheers
>
> Best,
> Dylan
>
--
Sebastian Ramacher
signature.asc
Description: PGP signature
M libraries that have recently been uploaded
> in version 21.08. To ensure co-installability, a rebuild is necessary.
I'm not sure I can follow. What issues are you trying to solve with this
binNMU?
Cheers
>
> nmu step_4:21.08.0-1 . ANY . unstable . -m "Rebuild against KDE Gears 21.
nds ~ /r-api-bioc/;
> is_good = .depends ~ "r-api-bioc-3.13";
> is_bad = .depends ~ "r-api-bioc-3.12";
> -----
>
> Best,
> Dylan
>
--
Sebastian Ramacher
signature.asc
Description: PGP signature
ransition.
> Thanks in advance.
Please go ahead
Cheers
>
>
> --
> Regards
> Sudip
>
--
Sebastian Ramacher
signature.asc
Description: PGP signature
one already looks ok):
>
> title = "granite";
> is_affected = .depends ~ "libgranite5" | .depends ~ "libgranite6";
> is_good = .depends ~ "libgranite6";
> is_bad = .depends ~ "libgranite5";
>
> The dependency chain is straightforward and
entire transition has been completed?
We will close the bug once the transition is done from the release
team's point of view, i.e. after libidn11 was removed from testing.
Cheers
>
> /Simon
>
--
Sebastian Ramacher
signature.asc
Description: PGP signature
d output on the webpage -- not sure this
> is correct -- why doesn't it output something in the right format?):
>
> title = "libidn";
> is_affected = .depends ~
> "/\b(libidn\-dev|libidn12|libidn11|libidn11\-java)\b/";
> is_good = .depends ~ "/\b(libidn\-dev|libidn12)\b/";
> is_bad = .depends ~ "/\b(libidn11|libidn11\-java)\b/";
>
> /Simon
--
Sebastian Ramacher
On 2021-06-08 02:06:08 +0800, Chow Loong Jin wrote:
> On Sat, Jun 05, 2021 at 05:39:04PM +0800, Chow Loong Jin wrote:
> > On Wed, Jun 02, 2021 at 12:27:06PM +0200, Sebastian Ramacher wrote:
> > > On 2021-06-02 02:45:56, Chow Loong Jin wrote:
> > > > Package: relea
"libxmlb";
> is_affected = .depends ~ "libxmlb1" | .depends ~ "libxmlb2";
> is_good = .depends ~ "libxmlb2";
> is_bad = .depends ~ "libxmlb1";
>
> -- System Information:
> Debian Release: bullseye/sid
> APT prefers testing
> APT policy: (500, 'testing')
> Architecture: amd64 (x86_64)
> Foreign Architectures: i386
>
> Kernel: Linux 5.10.0-1-amd64 (SMP w/8 CPU threads)
>
> --
> I welcome VSRE emails. See http://vsre.info/
>
--
Sebastian Ramacher
signature.asc
Description: PGP signature
;;
> is_affected = .depends ~ "libavif9" | .depends ~ "libavif12";
> is_good = .depends ~ "libavif12";
> is_bad = .depends ~ "libavif9";
>
> This would be a really tiny transition, and I expect that we can finish it
> very soon.
Please go ahead.
Cheers
>
> Thanks,
> Boyuan Yang
--
Sebastian Ramacher
signature.asc
Description: PGP signature
On 2021-01-27 23:39:06 +0100, Sebastian Ramacher wrote:
> Control: forwarded -1
> https://release.debian.org/transitions/html/libgdk-pixbuf-2.0-0.html
>
> On 2021-01-26 22:18:33 +, Simon McVittie wrote:
> > Package: release.debian.org
> > Severity: normal
in unstable once bullseye is released.
[ Changes ]
Besides changing gbp's branch, the new version unapplies a
Debian-specific patch and removes libasm-java from Build-Depends.
Depends is automatically handled by javahelper.
Cheers
--
Sebastian Ramacher
diff --git a/debian/changelog b/debian/changelog
f you any more information. TIA!
> \o/
Unstable and bullseye contain the same version of libjdom2-java. Are you
sure that the upload reached unstable?
Cheers
>
>
> - u
--
Sebastian Ramacher
signature.asc
Description: PGP signature
ACACGACGAAAGGAGCATCAGCA
> \ No newline at end of file
> diff -Nru perm-0.4.0/debian/tests/run-unit-test
> perm-0.4.0/debian/tests/run-unit-test
> --- perm-0.4.0/debian/tests/run-unit-test 1970-01-01 05:30:00.0
> +0530
> +++ perm-0.4.0/debian/tests/run-unit-test 2021-08-03 00:31:10.0
> +0530
> @@ -0,0 +1,18 @@
> +#!/bin/bash
> +set -e
> +
> +pkg=perm
> +
> +export LC_ALL=C.UTF-8
> +if [ "${AUTOPKGTEST_TMP}" = "" ] ; then
> + AUTOPKGTEST_TMP=$(mktemp -d /tmp/${pkg}-test.XX)
> + trap "rm -rf ${AUTOPKGTEST_TMP}" 0 INT QUIT ABRT PIPE TERM
> +fi
> +
> +cp -a /usr/share/doc/${pkg}/examples/* "${AUTOPKGTEST_TMP}"
> +
> +cd "${AUTOPKGTEST_TMP}"
> +
> +perm Ref.fasta Reads.fasta -v 100 -A -o out.sam
> +[ -s "out.sam" ] || exit 1
> +echo "PASS test"
--
Sebastian Ramacher
signature.asc
Description: PGP signature
t; (there are intentionally no diffs attached, yet)
>
> unblock nvidia-graphics-drivers/470.57.02-2
> unblock nvidia-settings/470.57.02-2
> unblock nvidia-modprobe/470.57.02-1
> unblock nvidia-persistenced/470.57.02-1
> unblock nvidia-xconfig/470.57.02-1
>
> Andr
n wouldn't work in this context.
> ++@skip("certificate expired")
> + class TestAnagrafica(TestCase):
> + @contextmanager
> + def capath(self):
> diff -Nru python-a38-0.1.3/debian/patches/series
> python-a38-0.1.3/debian/patches/series
> --- python-a38-0.1.3/debian/patches/series1970-01-01 01:00:00.0
> +0100
> +++ python-a38-0.1.3/debian/patches/series2021-07-30 12:01:58.0
> +0200
> @@ -0,0 +1 @@
> +0001-Skip-tests-that-fail-because-of-an-expired-certifica.patch
--
Sebastian Ramacher
signature.asc
Description: PGP signature
On 2021-07-29 16:50:05, Chris Hofstaedtler wrote:
> Hi,
>
> * Sebastian Ramacher [210729 10:23]:
> > On 2021-07-29 10:15:30, Chris Hofstaedtler wrote:
> [..]
> > Besides the missing unblocks, util-linux would be blocked by:
> >
> > autopkgtest for ocfs2-too
ebdiff, expluding the ABI reference and generated
> > > > rules file. Changelog entry is still set to UNRELEASED.
> > >
> > > Additionally would like to include another change, the bugfix for
> > > https://lists.debian.org/debian-kernel/2021/07/msg00134.html .
> >
> > And attached the new filtered debdiff.
>
> The upload has happened, including the above bugfix as well and
> another followup for the sctp changes[1].
>
> [1]:
> https://lore.kernel.org/linux-sctp/599e6c1fdcc50f16597380118c9b3b6790241d50.1627439903.git.marcelo.leit...@gmail.com/
>
> All builds arrived in meanwhile and Ansgar poked the signing service
> to get in linux-signed-{amd64,arm64,i386} as well.
>
> Discussed with Cyril on IRC, I propose to wait now 24h for little more
> exposure in unstable, before letting it migrate to testing, and so
> clear the way for d-i RC3.
ACK, please ping us after the 24h so that we can add the
unblock{,-udeb}s.
Cheers
--
Sebastian Ramacher
needs
to be looked at first.
Cheers
Sebastian
>
> Thanks,
> Chris
>
--
Sebastian Ramacher
Hi
On 2021-07-17 19:49:05 +0200, Sebastian Ramacher wrote:
> Control: tags -1 confirmed moreinfo
>
> On 2021-07-14 21:48:50, Oxan van Leeuwen wrote:
> > Package: release.debian.org
> > Severity: normal
> > User: release.debian@packages.debian.org
> > Usertags
> - if (strcmp(argv[i], "-f"))
> + if (strcmp(argv[i], "-f") == 0)
> cfg->force = true;
> - if (strcmp(argv[i], "--force"))
> + if (strcmp(argv[i], "--force") == 0)
> cfg->force = true;
> - if (strcmp(argv[i], "-w"))
> + if (strcmp(argv[i], "-w") == 0)
> cfg->wtmp_only = true;
> - if (strcmp(argv[i], "--wtmp-only"))
> + if (strcmp(argv[i], "--wtmp-only") == 0)
> cfg->wtmp_only = true;
> + if (strcmp(argv[i], "-r") == 0)
> + cfg->action = ACTION_REBOOT;
> }
> }
>
>
--
Sebastian Ramacher
signature.asc
Description: PGP signature
Control: tags -1 moreinfo confirmed
On 2021-07-25 14:33:37 +0200, Reiner Herrmann wrote:
> Control: tags -1 - moreinfo
>
> Hi Sebastian,
>
> On Wed, Jul 21, 2021 at 11:42:36AM +0200, Sebastian Ramacher wrote:
> > Could you please provide a debdiff between the version in tes
801 - 900 of 1466 matches
Mail list logo
