Re: Can't launch BBEdit

[bruce linde]

wait… there’s some kind of manual/instructions with this thing?!?8-)

i constantly forget that the manual is pretty comprehensive and to check the 
damn thing.

i loves my bbedit.














> On Apr 11, 2021, at 8:28 AM, Patrick Woolsey  wrote:
> 
> For general reference, if you've asked BBEdit to bite off more than it can 
> reasonably chew :-), please see the section "Launching BBEdit" (pg 44 in the 
> current edition) within Chapter 3 of the user manual[*]: 
> 
>Launching BBEdit
> 
>To launch BBEdit, double-click the BBEdit application icon or a BBEdit 
>document. Holding down the following keys at launch has the indicated
>effects, overriding any startup options set in the Application preference
>panel. When one of these key combinations is applied, BBEdit will beep 
>after it finishes launching.
> 
>ModifierFunction
>
>Option  Suppress startup items only.
> 
>Shift   Disable all external services and startup items,
>and skip reopening all documents except those
>which contain unsaved changes.
> 
>Command-Disable all external services and startup items,
>Control-Shift   and optionally discard auto-recover [info] (which
>will result in the loss of any unsaved changes).
> 
> [*: available at any time via Help -> User Manual ]
> 
> 
> Regards,
> 
> Patrick Woolsey
> ==
> Bare Bones Software, Inc. <https://www.barebones.com/>
> 
> 
> 
> 
>> On Apr 11, 2021, at 05:36, @lbutlr  wrote:
>> 
>> On 11 Apr 2021, at 03:25, @lbutlr  wrote:
>>> On 11 Apr 2021, at 00:03, @lbutlr  wrote:
>>>> On 10 Apr 2021, at 22:26, Tom Robinson  wrote:
>>>>> It won’t be doing the same search when you relaunch, it’s probably just 
>>>>> reopening the huge document.  How long have you given it?
>>>> 
>>>> Oh, 15 minutes? Maybe a bit more.
>>> 
>>> It's now been more than 3h20m, Bbedit is still pinwheeled and the search 
>>> playground window is still nothing pout an outline.
>> 
>> OK, I got it back. I THINK holding the shift key down while BBEdit launched 
>> stopped it from doing whatever it was doing before because all the windows 
>> came up right away including the 20,000,000 line file and the search 
>> playground window, but it wasn't processing.
>> 
> [...older messages elided...]
> 
> -- 
> This is the BBEdit Talk public discussion group. If you have a feature 
> request or need technical support, please email "supp...@barebones.com" 
> rather than posting here. Follow @bbedit on Twitter: 
> <https://twitter.com/bbedit>
> --- 
> You received this message because you are subscribed to the Google Groups 
> "BBEdit Talk" group.
> To unsubscribe from this group and stop receiving emails from it, send an 
> email to bbedit+unsubscr...@googlegroups.com.
> To view this discussion on the web visit 
> https://groups.google.com/d/msgid/bbedit/89702F77-16D8-4FC5-87CF-A6A693207329%40barebones.com.





bruce linde
5 happiness webmaster (four more than the competition!)
http://www.5happy.com/
http://clockhappy.com/
510.530.1331 office
510.206.9730 mobile

(shift key available upon request)








-- 
This is the BBEdit Talk public discussion group. If you have a feature request 
or need technical support, please email "supp...@barebones.com" rather than 
posting here. Follow @bbedit on Twitter: <https://twitter.com/bbedit>
--- 
You received this message because you are subscribed to the Google Groups 
"BBEdit Talk" group.
To unsubscribe from this group and stop receiving emails from it, send an email 
to bbedit+unsubscr...@googlegroups.com.
To view this discussion on the web visit 
https://groups.google.com/d/msgid/bbedit/884F3661-C648-4215-997A-D57314656A8C%405happy.com.

Re: How to save out all my unsaved untitled files

[bruce linde]

> On Mar 29, 2021, at 8:29 AM, Steve Weiss  wrote:
> I see that option but then I still have to name each file and press save on 
> each one.  I really just want to save them all with their "untitled text 
> " as the filename in one operation and not have to confirm the filename 
> on each document.  Otherwise this could take several hours.  
> It's a clipboard, I'll copy a column out of excel, paste it in, run a regex, 
> and paste it back, several times a day.  Or, I'll take a forum post, and 
> instead of typing it in on the website (and risk losing it due to an errant 
> click or back button) I'll write it in BBEdit and paste it in when I'm done, 
> etc, etc (I am doing this, right now).  Or it could be a confirmation code 
> someone gave me over the phone, or a password (I know, I know, I am not as 
> security obsessed as thou).  Especially because I know BBEdit won't lose any 
> of these snippets, I just go about my life and don't take the time to sit 
> here and decide, yes, this should be saved and this shouldn't.  Maybe my life 
> is just too busy, maybe I'm just lazy, maybe a little bit of both.  But now 
> I'd really just like to be able to start BBEdit without waiting 20 minutes 
> and I also don't want to lose all of these snippets, some of them might be 
> important one day.  I'm a digital hoarder.



you’re not just a digital hoarder, you’re a DHP… a digital hoarder 
procrastinator.   8-)

i can’t even fathom how you would know which file contains what you need when 
you need it, but you should have been naming them as you went. it’s payback 
time.

you’ll probably need an AppleScript to automatically hit ’save’ for you as it 
cycles through all of the windows… but would still end up with 
‘untitled_text_257.txt’, etc.

of course, bbedit might actually be saving the ‘unsaved’ docs somewhere… 
perhaps someone from the mothership can comment on that.

and… it really wouldn’t take you that long to click ’save’ 1000x during the 
process…. organize some paperwork, line up your taxes, whatever, while 
monitoring the screen (or call your mother)











> 
>  <https://rs3.wgacany.com/rs/a0iDFok4>   
> Steve Weiss | CTO
> 347-308-5377 | st...@wgacany.com <mailto:st...@wgacany.com>
> 812 Jersey Ave, 8th Fl, Jersey City, NJ 07310
> On Monday, March 29, 2021 at 11:24:14 AM UTC-4 Bruce Linde wrote:
> first off, why wouldn’t you save them?
> 
> second, hold the option key while viewing the file menu… you’ll see ’save 
> all’
> 
> 
> 
> 
> 
> 
> On Mar 29, 2021, at 8:20 AM, Steve Weiss  > wrote:
> 
> I use BBEdit as my general purpose clipboard and I've amassed over a thousand 
> unsaved documents, which I still will refer back to even years after they 
> were created.  Every time BBEdit restarts those unsaved files are still 
> there.  They never go away.  I don't close them all because I want to retain 
> the information within them, but, lately it's become a problem because at 
> startup BBEdit will load this 1K files, some of which contain hundreds of MB 
> of data.  This then slows down my computer, slows down BBEdit, and generally 
> just makes life harder.
> 
> What I would like to do, is take all of these unsaved, untitled documents and 
> save them all out to a folder so that I can just grep through them without 
> having to use the Find feature in BBEdit - and then close all of the 
> documents so I don't have to keep reopening all of them. 
> 
> How can I do this without having to press save on every single file 
> individually?  I've seen applescripts but they all seem to assume the files 
> have already been saved once.
> 
> Thanks for any advice!
>  <https://rs3.wgacany.com/rs/a0KbbovC>
> Steve Weiss | CTO
> 347-308-5377  | st...@wgacany.com 
> 
> 812 Jersey Ave, 8th Fl, Jersey City, NJ 07310
> 
> -- 
> This is the BBEdit Talk public discussion group. If you have a feature 
> request or need technical support, please email "sup...@barebones.com 
> " rather than posting 
> here. Follow @bbedit on Twitter: <https://twitter.com/bbedit 
> <https://twitter.com/bbedit>>
> --- 
> You received this message because you are subscribed to the Google Groups 
> "BBEdit Talk" group.
> To unsubscribe from this group and stop receiving emails from it, send an 
> email to bbedit+un...@googlegroups.com 
> .
> To view this discussion on the web visit 
> https://groups.google.com/d/msgid/bbedit/645a86a2-a024-4c12-8876-60388030fc16n%40googlegroups.com
>  
> <https://groups.google.com/d/msgid/bbedit/645a86a2-a024-4c12-8876-60388030fc16n%40googlegroups.com?utm_medium=email_source=footer>.
> 
> 
> 
> 
> 
> bruce linde
> 5 happiness webmaster (four more than the competition!)
> ht

Re: How to save out all my unsaved untitled files

[bruce linde]

first off, why wouldn’t you save them?

second, hold the option key while viewing the file menu… you’ll see ’save all’  
  






> On Mar 29, 2021, at 8:20 AM, Steve Weiss  wrote:
> 
> I use BBEdit as my general purpose clipboard and I've amassed over a thousand 
> unsaved documents, which I still will refer back to even years after they 
> were created.  Every time BBEdit restarts those unsaved files are still 
> there.  They never go away.  I don't close them all because I want to retain 
> the information within them, but, lately it's become a problem because at 
> startup BBEdit will load this 1K files, some of which contain hundreds of MB 
> of data.  This then slows down my computer, slows down BBEdit, and generally 
> just makes life harder.
> 
> What I would like to do, is take all of these unsaved, untitled documents and 
> save them all out to a folder so that I can just grep through them without 
> having to use the Find feature in BBEdit - and then close all of the 
> documents so I don't have to keep reopening all of them. 
> 
> How can I do this without having to press save on every single file 
> individually?  I've seen applescripts but they all seem to assume the files 
> have already been saved once.
> 
> Thanks for any advice!
>  <https://rs3.wgacany.com/rs/a0KbbovC>   
> Steve Weiss | CTO
> 347-308-5377 | st...@wgacany.com <mailto:st...@wgacany.com>
> 812 Jersey Ave, 8th Fl, Jersey City, NJ 07310
> 
> -- 
> This is the BBEdit Talk public discussion group. If you have a feature 
> request or need technical support, please email "supp...@barebones.com 
> <mailto:supp...@barebones.com>" rather than posting here. Follow @bbedit on 
> Twitter: <https://twitter.com/bbedit <https://twitter.com/bbedit>>
> --- 
> You received this message because you are subscribed to the Google Groups 
> "BBEdit Talk" group.
> To unsubscribe from this group and stop receiving emails from it, send an 
> email to bbedit+unsubscr...@googlegroups.com 
> <mailto:bbedit+unsubscr...@googlegroups.com>.
> To view this discussion on the web visit 
> https://groups.google.com/d/msgid/bbedit/645a86a2-a024-4c12-8876-60388030fc16n%40googlegroups.com
>  
> <https://groups.google.com/d/msgid/bbedit/645a86a2-a024-4c12-8876-60388030fc16n%40googlegroups.com?utm_medium=email_source=footer>.





bruce linde
5 happiness webmaster (four more than the competition!)
http://www.5happy.com/
http://clockhappy.com/
510.530.1331 office
510.206.9730 mobile

(shift key available upon request)








-- 
This is the BBEdit Talk public discussion group. If you have a feature request 
or need technical support, please email "supp...@barebones.com" rather than 
posting here. Follow @bbedit on Twitter: <https://twitter.com/bbedit>
--- 
You received this message because you are subscribed to the Google Groups 
"BBEdit Talk" group.
To unsubscribe from this group and stop receiving emails from it, send an email 
to bbedit+unsubscr...@googlegroups.com.
To view this discussion on the web visit 
https://groups.google.com/d/msgid/bbedit/2AEA40FB-6237-4E75-85BF-73151037C118%405happy.com.

Re: Where Are Prefs for Open Windows in "Windows" Palette Saved?

[bruce linde]

i understand that he has no furniture, as he has no time to sit.









> On Mar 17, 2021, at 6:24 PM, Kerri Hicks  wrote:
> 
> On Wed, Mar 17, 2021, 9:08 PM Bill Kochman  <mailto:wordweaver...@gmail.com>> wrote:
> 
> Does Rich just wait for something to fix? Or does he hope that nothing ever 
> breaks? :)
> 
> I'm sure he's just sitting on the sofa waiting for you to write in, with 
> nothing else to do. ;-)
> 
> But yes, you should always write to support.
> 
> --Kerri
> 
> -- 
> This is the BBEdit Talk public discussion group. If you have a feature 
> request or need technical support, please email "supp...@barebones.com" 
> rather than posting here. Follow @bbedit on Twitter: 
> <https://twitter.com/bbedit <https://twitter.com/bbedit>>
> --- 
> You received this message because you are subscribed to the Google Groups 
> "BBEdit Talk" group.
> To unsubscribe from this group and stop receiving emails from it, send an 
> email to bbedit+unsubscr...@googlegroups.com 
> <mailto:bbedit+unsubscr...@googlegroups.com>.
> To view this discussion on the web visit 
> https://groups.google.com/d/msgid/bbedit/CAEmA4uZZjYT4ktTuk%3DkDjm%2B9B4qpUwJePQzCwNE20akxLz5tNA%40mail.gmail.com
>  
> <https://groups.google.com/d/msgid/bbedit/CAEmA4uZZjYT4ktTuk%3DkDjm%2B9B4qpUwJePQzCwNE20akxLz5tNA%40mail.gmail.com?utm_medium=email_source=footer>.





bruce linde
5 happiness webmaster (four more than the competition!)
http://www.5happy.com/
http://clockhappy.com/
510.530.1331 office
510.206.9730 mobile

(shift key available upon request)








-- 
This is the BBEdit Talk public discussion group. If you have a feature request 
or need technical support, please email "supp...@barebones.com" rather than 
posting here. Follow @bbedit on Twitter: <https://twitter.com/bbedit>
--- 
You received this message because you are subscribed to the Google Groups 
"BBEdit Talk" group.
To unsubscribe from this group and stop receiving emails from it, send an email 
to bbedit+unsubscr...@googlegroups.com.
To view this discussion on the web visit 
https://groups.google.com/d/msgid/bbedit/F26B9DA6-9441-44A4-BCCD-60AA76A17DB5%405happy.com.

Re: Where Are Prefs for Open Windows in "Windows" Palette Saved?

[bruce linde]

nes.com>" rather than posting here. Follow @bbedit on 
>> Twitter: <https://twitter.com/bbedit <https://twitter.com/bbedit>>
>> --- 
>> You received this message because you are subscribed to the Google Groups 
>> "BBEdit Talk" group.
>> To unsubscribe from this group and stop receiving emails from it, send an 
>> email to bbedit+unsubscr...@googlegroups.com 
>> <mailto:bbedit+unsubscr...@googlegroups.com>.
>> To view this discussion on the web visit 
>> https://groups.google.com/d/msgid/bbedit/6DD745CD-EA2C-4A45-9A61-6A9A2F7995DC%40gmail.com
>>  
>> <https://groups.google.com/d/msgid/bbedit/6DD745CD-EA2C-4A45-9A61-6A9A2F7995DC%40gmail.com?utm_medium=email_source=footer>.
> 
> 
> -- 
> This is the BBEdit Talk public discussion group. If you have a feature 
> request or need technical support, please email "supp...@barebones.com" 
> rather than posting here. Follow @bbedit on Twitter: 
> <https://twitter.com/bbedit <https://twitter.com/bbedit>>
> --- 
> You received this message because you are subscribed to the Google Groups 
> "BBEdit Talk" group.
> To unsubscribe from this group and stop receiving emails from it, send an 
> email to bbedit+unsubscr...@googlegroups.com 
> <mailto:bbedit+unsubscr...@googlegroups.com>.
> To view this discussion on the web visit 
> https://groups.google.com/d/msgid/bbedit/CFB0132A-51F2-4C6E-AE44-DF416A83BB93%40faiman.org
>  
> <https://groups.google.com/d/msgid/bbedit/CFB0132A-51F2-4C6E-AE44-DF416A83BB93%40faiman.org?utm_medium=email_source=footer>.





bruce linde
5 happiness webmaster (four more than the competition!)
http://www.5happy.com/
http://clockhappy.com/
510.530.1331 office
510.206.9730 mobile

(shift key available upon request)








-- 
This is the BBEdit Talk public discussion group. If you have a feature request 
or need technical support, please email "supp...@barebones.com" rather than 
posting here. Follow @bbedit on Twitter: <https://twitter.com/bbedit>
--- 
You received this message because you are subscribed to the Google Groups 
"BBEdit Talk" group.
To unsubscribe from this group and stop receiving emails from it, send an email 
to bbedit+unsubscr...@googlegroups.com.
To view this discussion on the web visit 
https://groups.google.com/d/msgid/bbedit/94EAEDD0-C25A-4613-AB42-088DF62E9B15%405happy.com.

Re: preview in 'safari technology preview'?

[bruce linde]

yes, well, that took about 3 seconds.

i’m here to keep you guys entertained… how am i doing?   8-)













> On Apr 27, 2020, at 2:01 PM, Patrick Woolsey  wrote:
> 
> On 4/27/20 at 4:25 PM, bli...@5happy.com (Bruce Linde) wrote:
> 
>> bbedit doesn't seem to see safari and safari technology preview as two 
>> different apps/browsers... as the finder does. STP does not appear in the 
>> list of possible preview browsers, and in fact bbedit will launch plain old 
>> safari even if STP is already running.
> 
> You'll need to add STP to the list of recognized helpers in the Preview 
> Helpers prefs pane. :-)
> 
> 
> Regards
> 
> Patrick Woolsey
> ==
> Bare Bones Software, Inc. <https://www.barebones.com/>
> 
> -- 
> This is the BBEdit Talk public discussion group. If you have a feature 
> request or need technical support, please email "supp...@barebones.com" 
> rather than posting here. Follow @bbedit on Twitter: 
> <https://twitter.com/bbedit>
> --- You received this message because you are subscribed to the Google Groups 
> "BBEdit Talk" group.
> To unsubscribe from this group and stop receiving emails from it, send an 
> email to bbedit+unsubscr...@googlegroups.com.
> To view this discussion on the web visit 
> https://groups.google.com/d/msgid/bbedit/r480Ps-10146i-DEC8C445C51F4711BBAB18D0FA6F487C%40Cylinder.local.





bruce linde
5 happiness webmaster (four more than the competition!)
http://www.5happy.com/
http://clockhappy.com/
510.530.1331 office
510.206.9730 mobile

(shift key available upon request)








-- 
This is the BBEdit Talk public discussion group. If you have a feature request 
or need technical support, please email "supp...@barebones.com" rather than 
posting here. Follow @bbedit on Twitter: <https://twitter.com/bbedit>
--- 
You received this message because you are subscribed to the Google Groups 
"BBEdit Talk" group.
To unsubscribe from this group and stop receiving emails from it, send an email 
to bbedit+unsubscr...@googlegroups.com.
To view this discussion on the web visit 
https://groups.google.com/d/msgid/bbedit/D29095F3-C5AA-4466-9B9B-4385817CBA84%405happy.com.

Re: preview in 'safari technology preview'?

[bruce linde]

that doesn’t require RTFM-ing, does it?   8-)

thx (as always),
b








> On Apr 27, 2020, at 2:01 PM, Patrick Woolsey  wrote:
> 
> On 4/27/20 at 4:25 PM, bli...@5happy.com (Bruce Linde) wrote:
> 
>> bbedit doesn't seem to see safari and safari technology preview as two 
>> different apps/browsers... as the finder does. STP does not appear in the 
>> list of possible preview browsers, and in fact bbedit will launch plain old 
>> safari even if STP is already running.
> 
> You'll need to add STP to the list of recognized helpers in the Preview 
> Helpers prefs pane. :-)
> 
> 
> Regards
> 
> Patrick Woolsey
> ==
> Bare Bones Software, Inc. <https://www.barebones.com/>
> 
> -- 
> This is the BBEdit Talk public discussion group. If you have a feature 
> request or need technical support, please email "supp...@barebones.com" 
> rather than posting here. Follow @bbedit on Twitter: 
> <https://twitter.com/bbedit>
> --- You received this message because you are subscribed to the Google Groups 
> "BBEdit Talk" group.
> To unsubscribe from this group and stop receiving emails from it, send an 
> email to bbedit+unsubscr...@googlegroups.com.
> To view this discussion on the web visit 
> https://groups.google.com/d/msgid/bbedit/r480Ps-10146i-DEC8C445C51F4711BBAB18D0FA6F487C%40Cylinder.local.





bruce linde
5 happiness webmaster (four more than the competition!)
http://www.5happy.com/
http://clockhappy.com/
510.530.1331 office
510.206.9730 mobile

(shift key available upon request)








-- 
This is the BBEdit Talk public discussion group. If you have a feature request 
or need technical support, please email "supp...@barebones.com" rather than 
posting here. Follow @bbedit on Twitter: <https://twitter.com/bbedit>
--- 
You received this message because you are subscribed to the Google Groups 
"BBEdit Talk" group.
To unsubscribe from this group and stop receiving emails from it, send an email 
to bbedit+unsubscr...@googlegroups.com.
To view this discussion on the web visit 
https://groups.google.com/d/msgid/bbedit/61099381-1C85-445B-8CCE-592484692A52%405happy.com.

Re: RegEx pattern find something but replace on following

[bruce linde]

this just came up somewhere else for me…. apple mail uses the 
ApplePlainTextBody class to show the ‘>’ as vertical lines… even in supposed 
plain text editing mode.

i found a couple of webmail clients that seem to respect that, as well, but 
using mac browsers… so maybe it’s an overall mac thing.

either way, i THINK he’s talking about the initial ‘>’s at the beginning of 
quoted lines in plain text.












> On Apr 12, 2020, at 8:58 AM, Bruce Van Allen  wrote:
> 
> Hmm. Not seeing the '>.' anywhere.
> 
> 
> On 4/12/20 at 8:01 AM, achim.quai...@gmail.com (archaeal) wrote:
> 
>> Hello,
>> I would like to detect the lines starting with >.+ and replace all U with T 
>> in the following line, but not in the line starting with >
>> Example:
>> 
>>> NeiUe1661551 bp  rna
>> AGAGAUUGAACAUAAGAGUUUGAUCCUGGCUCAGAUUGAACGCUGGCGGCAUGCUUU
>>> Unc316521491 bp  rna
>> AGGGUUUGAUCAUGGCUCAGGACGAACGCUGGCGGUGCGCCUUAUGCAUGCAAGUCG
>>> Unc316531469 bp  rna
>> AGGGUUUGAUCAUGGCUCAGAACGAACGCUGGCGGCAUGCUUCAGACAUGCAAGUCG
>> 
>> should look like:
>>> NeiUe1661551 bp  rna
>> AGAGATTGAACATAAGAGTTTGATCCTGGCTCAGATTGAACGCTGGCGGCATGCTTT
>>> Unc316521491 bp  rna
>> AGGGTTTGATCATGGCTCAGGACGAACGCTGGCGGTGCGCCTTATGCATGCAAGTCG
>>> Unc316531469 bp  rna
>> AGGGTTTGATCATGGCTCAGAACGAACGCTGGCGGCATGCTTCAGACATGCAAGTCG
>> 
>> The search pattern should find the >.. line but make changes only in the 
>> next line
>> Another possibility would be to search just in the "second" line for U and 
>> replace with T
>> 
>> It would be great if someone has an idea.
>> 
>> Thanks a lot
>> archaeal
>> 
>> 
> -- 
> 
>  - Bruce
> 
> _bruce__van_allen__santa_cruz__ca_
> 
> -- 
> This is the BBEdit Talk public discussion group. If you have a feature 
> request or need technical support, please email "supp...@barebones.com" 
> rather than posting here. Follow @bbedit on Twitter: 
> <https://twitter.com/bbedit>
> --- 
> You received this message because you are subscribed to the Google Groups 
> "BBEdit Talk" group.
> To unsubscribe from this group and stop receiving emails from it, send an 
> email to bbedit+unsubscr...@googlegroups.com.
> To view this discussion on the web visit 
> https://groups.google.com/d/msgid/bbedit/r480Ps-10146i-07F3200541164018A573F13298574B5A%40Forest.local.





bruce linde
5 happiness webmaster (four more than the competition!)
http://www.5happy.com/
http://clockhappy.com/
510.530.1331 office
510.206.9730 mobile

(shift key available upon request)








-- 
This is the BBEdit Talk public discussion group. If you have a feature request 
or need technical support, please email "supp...@barebones.com" rather than 
posting here. Follow @bbedit on Twitter: <https://twitter.com/bbedit>
--- 
You received this message because you are subscribed to the Google Groups 
"BBEdit Talk" group.
To unsubscribe from this group and stop receiving emails from it, send an email 
to bbedit+unsubscr...@googlegroups.com.
To view this discussion on the web visit 
https://groups.google.com/d/msgid/bbedit/ACC3D130-6D97-44FB-A9ED-F7F1ABE9B852%405happy.com.

Re: Dual Monitor Annoyances

[bruce linde]

probably best to reach out to supp...@barebones.com 
<mailto:supp...@barebones.com>… along with screenshots…







> On Nov 11, 2019, at 10:52 AM, W Lampkin  <mailto:wlampki...@lampkin.net>> wrote:
> 
> I'm having similar issues. I primarily use BBEdit on my MacBook Pro's 
> built-in screen, but every time I unplug or plug in my Thunderbolt dock with 
> the external display, the floating palettes shift all around. It was 
> happening with BBEdit 12.x and continues with 13.x. Anyone have any 
> suggestions?
> 
> - Bill
> 
> -- 
> This is the BBEdit Talk public discussion group. If you have a 
> feature request or need technical support, please email
> "supp...@barebones.com <mailto:supp...@barebones.com>" rather than posting to 
> the group.
> Follow @bbedit on Twitter: <https://twitter.com/bbedit 
> <https://twitter.com/bbedit>>
> --- 
> You received this message because you are subscribed to the Google Groups 
> "BBEdit Talk" group.
> To unsubscribe from this group and stop receiving emails from it, send an 
> email to bbedit+unsubscr...@googlegroups.com 
> <mailto:bbedit+unsubscr...@googlegroups.com>.
> To view this discussion on the web visit 
> https://groups.google.com/d/msgid/bbedit/6dc1b2d1-8382-4067-939f-a96d70da2d6b%40googlegroups.com
>  
> <https://groups.google.com/d/msgid/bbedit/6dc1b2d1-8382-4067-939f-a96d70da2d6b%40googlegroups.com?utm_medium=email_source=footer>.





bruce linde
5 happiness webmaster (four more than the competition!)
http://www.5happy.com/ <http://www.5happy.com/>
http://clockhappy.com/
510.530.1331 office
510.206.9730 mobile

(shift key available upon request)








-- 
This is the BBEdit Talk public discussion group. If you have a 
feature request or need technical support, please email
"supp...@barebones.com" rather than posting to the group.
Follow @bbedit on Twitter: <https://twitter.com/bbedit>
--- 
You received this message because you are subscribed to the Google Groups 
"BBEdit Talk" group.
To unsubscribe from this group and stop receiving emails from it, send an email 
to bbedit+unsubscr...@googlegroups.com.
To view this discussion on the web visit 
https://groups.google.com/d/msgid/bbedit/A3B70E3D-A390-4AA9-BEB5-0FBCA181047D%405happy.com.

Re: Problem with "Preview in BBEdit"

[bruce linde]

just confirming... you configured the site settings in your project, yes? i ask 
because i need to do that for each client site before those kinds of links work 
correctly.



bruce linde
5 happiness webmaster
510.530.1331 office
510.206.9730 mobile
http://www.5happy.com
bli...@5happy.com



> On Oct 17, 2019, at 8:51 PM, Fabrizio Ferrari  wrote:
> 
> Oh yes, sure, if I add "https:" it works fine because it is going to grab the 
> image over the network to the server, but I was wondering if there is a way 
> to use the local images without altering the html code by creating a simlink 
> somewhere on my system?
> 
> Thanks.
> 
>> On Thursday, October 17, 2019 at 2:06:39 PM UTC-7, Greg Raven wrote:
>> Have you tried putting "http:" or "https:" in front of your external links? 
>> It's possible that BBEdit does not interpret external links in the format 
>> you are using.
>> 
>>> On Thursday, October 17, 2019 at 7:27:15 AM UTC-7, Fabrizio Ferrari wrote:
>>> I am sorry I wanst' clear.
>>> 
>>> I am talking about image references, with markup like this:
>>> 
>>> >> src="//cdn4.virtualsheetmusic.com/images/newdesign/gallery/imageSlideBIG/Halloween_Sheet_Music_4_BIG.png"
>>>  alt="Halloween Sheet Music Collections" class="expimgbanners hideRESP558">
>>> 
>>> 
>>> How can I have that image showing in the BBEdit Preview window? I have that 
>>> image file locally inside a folder on my computer, so I guess there is a 
>>> way to create a simlink somewhere to have the source:
>>> 
>>> //cdn4.virtualsheetmusic.com/images/newdesign/gallery/imageSlideBIG/Halloween_Sheet_Music_4_BIG.png
>>> 
>>> loading the local image correctly.
>>> 
>>> I have no problems to load images like this for example:
>>> 
>>> 
>>> >> src="/images/newdesign/gallery/imageSlideBIG/Halloween_Sheet_Music_4_BIG.png"
>>>  alt="Halloween Sheet Music Collections" class="expimgbanners hideRESP558">
>>> 
>>> I just created a simlink to the /images/ directory on my computer root 
>>> directory and made the trick. But any //cdn4.virtualsheetmusic.com 
>>> reference brings to nowhere. Of course, I could just replace that with:
>>> 
>>> https://cdn4.virtualsheetmusic.com/images/newdesign/gallery/imageSlideBIG/Halloween_Sheet_Music_4_BIG.png
>>> 
>>> And let load the page from the web, but I am just wondering if there is a 
>>> way to create a simlink somewhere on my local computer to have local images 
>>> loaded instead.
>>> 
>>> I hope this is clear. Thank you!
>>> 
>>> Fab,
>>> 
>>> 
>>>> On Thursday, October 17, 2019 at 5:00:44 AM UTC-7, Greg Raven wrote:
>>>> I'm having difficulty understand what you are asking. Are you saying you 
>>>> want BBEdit to preview something other than the HTML code on your pages, 
>>>> or that you need a better way of managing your digital assets?
>>>> 
>>>>> On Wednesday, October 16, 2019 at 4:54:32 PM UTC-7, Fabrizio Ferrari 
>>>>> wrote:
>>>>> Hello everyone.
>>>>> 
>>>>> I am trying to get out most of the useful "Preview in BBEdit" feature, 
>>>>> but I am stuck in solving a problem.
>>>>> 
>>>>> The way I'd like to use that Preview feature is to display static HTML 
>>>>> pages taken from my websites. All references to images like the following:
>>>>> 
>>>>> /images/icons/icon.jpg
>>>>> 
>>>>> Have no problems to be displayed once I put a simlink in the root disk of 
>>>>> my Mac (I am on Mac OS), but if I have references looking at images on 
>>>>> our content delivery network like this one:
>>>>> 
>>>>> //cdn.mywebsite.com/images/icons/icon.jpg
>>>>> 
>>>>> 
>>>>> I can't find a way to reference those locally. Any ideas? If you know how 
>>>>> to do it, or you have a workaround, I'd really like to hear it!
>>>>> 
>>>>> Thanks in advance to anyone for any help.
>>>>> 
>>>>> All the best,
>>>>> 
>>>>> Fab.
>>>>> 
>>>>> 
> 
> -- 
> This is the BBEdit Talk public discussion group. If you have a 
> feature request or need technical support, please email
> "supp...@barebones.com" rather than posting to the group.
> Follow @bbedit on Twitter: <https://twitter.com/bbedit>
> --- 
> You received this message because you are subscribed to the Google Groups 
> "BBEdit Talk" group.
> To unsubscribe from this group and stop receiving emails from it, send an 
> email to bbedit+unsubscr...@googlegroups.com.
> To view this discussion on the web visit 
> https://groups.google.com/d/msgid/bbedit/45563308-f1e7-444b-bdec-b2d9c877418f%40googlegroups.com.

-- 
This is the BBEdit Talk public discussion group. If you have a 
feature request or need technical support, please email
"supp...@barebones.com" rather than posting to the group.
Follow @bbedit on Twitter: <https://twitter.com/bbedit>
--- 
You received this message because you are subscribed to the Google Groups 
"BBEdit Talk" group.
To unsubscribe from this group and stop receiving emails from it, send an email 
to bbedit+unsubscr...@googlegroups.com.
To view this discussion on the web visit 
https://groups.google.com/d/msgid/bbedit/38E4AA5C-57C9-49B1-B731-8994BA2AE0F9%405happy.com.

Re: BBEdit 13: Please, improvements instead of gimmicks

[bruce linde]

i was responding to your specific example… which is easily handled by find and 
replace. for me, it’s as simple as… without looking at my hands:

command-e - pack find field
command-option-e - pack replace field
command-f 
select ‘selected text only’
replace all

not sure what your flow is, but this is so second nature to me that it takes < 
15 seconds. and… i trust bbedit to find ALL instances of something (selected 
text only, or not) more than i trust myself… yet another argument for my 
method. using combinations of keyboard and mouse gives the best results AND 
flow (imho).

on the other hand, i could use a ‘select non-contiguous text’ feature when in 
applied bullshitology mode and writing copy for my clients’ websites. it would 
be nice to be able to select non-continguous sentences (for example) and then 
paste them into a new/re-assembled paragraph.

bruce











> On Oct 11, 2019, at 8:34 AM, Sam Hathaway  <mailto:list.bbe...@munkynet.org>> wrote:
> 
> I don’t really know how to articulate this.
> 
> Maybe: opening the dialog box breaks flow.
> 
> Or: it feels more natural to do this with multiple selections.
> 
> In a sense, it’s more of a “direct manipulation” than using the find/replace 
> tool.
> 
> Also: selecting a large range of text (a complete function, including the 
> prototype, etc.) is often awkward, requiring use of the mouse or a lot of 
> fiddling with arrow keys. The multiple selection workflow is completely 
> keyboard-based.
> 
> I’m not disputing that there may be ways to achieve the same goal in BBEdit 
> currently. My claim is that multiple selection has advantages over the 
> current methods.
> 
> Hope this helps.
> -sam
> 
> On 11 Oct 2019, at 10:58, bruce linde wrote:
> 
> wait… 
> 
> 1. select your ‘want to change things in this block of text’ section.
> 
> 2. set your ‘find ’ text and your ‘replace with __’ text
> 
> 3. check the ‘search and replace in selected text only’ checkbox.
> 
> unless i’m missing something?
> 
> bruce
> 
> 
> 
> 
> 
> 
> 
> 
>> On Oct 11, 2019, at 7:48 AM, Sam Hathaway > <mailto:list.bbe...@munkynet.org>> wrote:
>> 
>> On October 11, 2019 3:26:56 AM Gustave Stresen-Reuter tedmaster...@gmail.com 
>> <mailto:tedmaster...@gmail.com> wrote:
>> 
>> What else would you use discontiguous selections for (serious question)?
>> 
>> Lack of multiple selection is one of several things that make me jealous of 
>> VSCode/Atom/SublimeText users. In one of those editors, I would change the 
>> types of some variables in a struct like this:
>> 
>> select a word (say, uint16_t)
>> hit a key combo to also select the next instance of the selected word
>> and the next one
>> and the next one
>> ok, I've selected all the instances of uint16_t in this struct that I want 
>> to change
>> type: uint32_t
>> This is different from editing all instance of some text. If I’m changing a 
>> few variables in one struct from being 16-bit to 32-bit, that doesn’t mean I 
>> want to change every single uint16_t in the file.
>> 
>> I can get close with current BBEdit like this:
>> 
>> select a word (say, uint16_t)
>> hit Cmd-E (to set find text)
>> type: uint32_t
>> hit Opt-Shift-Left to select the word I just typed
>> hit Cmd-Opt-E (to set replace text)
>> hit Cmd-G
>> hit Cmd-T
>> hit Cmd-T
>> hit Cmd-T
>> This is… okay… I guess… but the keyboard acrobatics are a little stressful 
>> on my fingers, and I don’t like that I have to enter the replacement text 
>> first, before selecting all the instances that I want to change. It’s 
>> conceptually cleaner for me to “grab” all the text I want to change, and 
>> then change it all at once.
>> 
>> If all the words I want to change are on adjacent lines and lined up 
>> vertically, I can use a rectangular selection and this works pretty well (as 
>> long as I remember to use Cmd-Z rather than Backspace if I make a mistake). 
>> I wish I could do this even when things are not lined up nicely.
>> 
>> Does that make sense?
>> -sam
>> 
>> On 11 Oct 2019, at 3:26, Gustave Stresen-Reuter wrote:
>> 
>> Not sure if this is what you want but you can edit all instances of found 
>> text. Not at my computer so can't consult the docs but it is possible.
>> 
>> What else would you use discontiguous selections for (serious question)?
>> 
>> Ted
>> 
>> On Fri, Oct 11, 2019, 3:45 AM Tom Robinson > <mailto:barefootg...@gmail.com>> wrote:
>> See the ungimmicky footer of every message to t

Re: BBEdit 13: Please, improvements instead of gimmicks

[bruce linde]

quot;BBEdit Talk" group.
> To unsubscribe from this group and stop receiving emails from it, send an 
> email to bbedit+unsubscr...@googlegroups.com 
> <mailto:bbedit+unsubscr...@googlegroups.com>.
> To view this discussion on the web visit 
> https://groups.google.com/d/msgid/bbedit/CAKAQjicfJDhvaak3n9hEXL95o-WcTajgD2ovFBETM-rfekVP_Q%40mail.gmail.com
>  
> <https://groups.google.com/d/msgid/bbedit/CAKAQjicfJDhvaak3n9hEXL95o-WcTajgD2ovFBETM-rfekVP_Q%40mail.gmail.com?utm_medium=email_source=footer>.
> 
> -- 
> This is the BBEdit Talk public discussion group. If you have a 
> feature request or need technical support, please email
> "supp...@barebones.com <mailto:supp...@barebones.com>" rather than posting to 
> the group.
> Follow @bbedit on Twitter: <https://twitter.com/bbedit 
> <https://twitter.com/bbedit>>
> --- 
> You received this message because you are subscribed to the Google Groups 
> "BBEdit Talk" group.
> To unsubscribe from this group and stop receiving emails from it, send an 
> email to bbedit+unsubscr...@googlegroups.com 
> <mailto:bbedit+unsubscr...@googlegroups.com>.
> To view this discussion on the web visit 
> https://groups.google.com/d/msgid/bbedit/6075C4ED-9B46-4D05-9A40-1DA84D69B388%40munkynet.org
>  
> <https://groups.google.com/d/msgid/bbedit/6075C4ED-9B46-4D05-9A40-1DA84D69B388%40munkynet.org?utm_medium=email_source=footer>.





bruce linde
5 happiness webmaster (four more than the competition!)
http://www.5happy.com/ <http://www.5happy.com/>
http://clockhappy.com/
510.530.1331 office
510.206.9730 mobile

(shift key available upon request)








-- 
This is the BBEdit Talk public discussion group. If you have a 
feature request or need technical support, please email
"supp...@barebones.com" rather than posting to the group.
Follow @bbedit on Twitter: <https://twitter.com/bbedit>
--- 
You received this message because you are subscribed to the Google Groups 
"BBEdit Talk" group.
To unsubscribe from this group and stop receiving emails from it, send an email 
to bbedit+unsubscr...@googlegroups.com.
To view this discussion on the web visit 
https://groups.google.com/d/msgid/bbedit/8C5F2CA4-1F53-4740-9CAD-D65DE34A8367%405happy.com.

what new features require/use mojave?

[Bruce Linde]

curious to know what features of Mojave are required by BBEdit 13?


i have not yet mojaved and thought i would (for once) ask first.   8-)




-- 
This is the BBEdit Talk public discussion group. If you have a 
feature request or need technical support, please email
"supp...@barebones.com" rather than posting to the group.
Follow @bbedit on Twitter: 
--- 
You received this message because you are subscribed to the Google Groups 
"BBEdit Talk" group.
To unsubscribe from this group and stop receiving emails from it, send an email 
to bbedit+unsubscr...@googlegroups.com.
To view this discussion on the web visit 
https://groups.google.com/d/msgid/bbedit/b7dadb4e-529a-452d-a0fe-8f4f68258dd2%40googlegroups.com.

Re: web site templates

[bruce linde]

yup... that’s the pixelarity guy... both sites offer excellent templates 



bruce linde
5 happiness webmaster
510.530.1331 office
510.206.9730 mobile
http://www.5happy.com
bli...@5happy.com



> On Sep 22, 2019, at 2:13 PM, Luis Speciale  wrote:
> 
>> Le 22/09/2019 à 12:37, Jan Erik Moström a écrit :
>> A question about a good source for web site templates. 
>> 
>> I want to make some small static web sites for various stuff and thought 
>> that I could use BBEdit for creating/updating the sites (yes, I know about 
>> tools like RapidWeaver, Hugo, Pelican, etc but they are too complicated for 
>> what I have in mind). 
>> 
>> Unfortunately my graphic design skills isn't world famous ... not even 
>> within my family. So I did a search for "free web sites templates" and ended 
>> up with a long list of web sites that offers "free" templates (mostly WP 
>> templates) ... so I ended up looking at Hugo and WordPress templates. 
>> 
>> But before I sit down and try to convert them to be usable with BBEdit I 
>> want to ask if anyone knows of a good source for HTML5 templates that are 
>> not ... let's say, of doubtful quality ... and doesn't depend on frameworks 
>> like bootstrap etc (I want small, self contained static web sites)? 
>> 
>> = jem 
>> 
> Hope it helps
> 
> https://html5up.net/
> 
> -- 
> This is the BBEdit Talk public discussion group. If you have a 
> feature request or need technical support, please email
> "supp...@barebones.com" rather than posting to the group.
> Follow @bbedit on Twitter: <https://twitter.com/bbedit>
> --- 
> You received this message because you are subscribed to the Google Groups 
> "BBEdit Talk" group.
> To unsubscribe from this group and stop receiving emails from it, send an 
> email to bbedit+unsubscr...@googlegroups.com.
> To view this discussion on the web visit 
> https://groups.google.com/d/msgid/bbedit/fd6c9b84-9ef8-6bf9-c755-2207351235af%40gmail.com.

-- 
This is the BBEdit Talk public discussion group. If you have a 
feature request or need technical support, please email
"supp...@barebones.com" rather than posting to the group.
Follow @bbedit on Twitter: <https://twitter.com/bbedit>
--- 
You received this message because you are subscribed to the Google Groups 
"BBEdit Talk" group.
To unsubscribe from this group and stop receiving emails from it, send an email 
to bbedit+unsubscr...@googlegroups.com.
To view this discussion on the web visit 
https://groups.google.com/d/msgid/bbedit/00E79540-9EF2-4D86-B6DC-DA7976DE5678%405happy.com.

Re: web site templates

[bruce linde]

pixelarity.com

not free, but close to it.



> On Sep 22, 2019, at 3:37 AM, Jan Erik Moström  wrote:
> 
> A question about a good source for web site templates.
> 
> I want to make some small static web sites for various stuff and thought that 
> I could use BBEdit for creating/updating the sites (yes, I know about tools 
> like RapidWeaver, Hugo, Pelican, etc but they are too complicated for what I 
> have in mind).
> 
> Unfortunately my graphic design skills isn't world famous ... not even within 
> my family. So I did a search for "free web sites templates" and ended up with 
> a long list of web sites that offers "free" templates (mostly WP templates) 
> ... so I ended up looking at Hugo and WordPress templates.
> 
> But before I sit down and try to convert them to be usable with BBEdit I want 
> to ask if anyone knows of a good source for HTML5 templates that are not ... 
> let's say, of doubtful quality ... and doesn't depend on frameworks like 
> bootstrap etc (I want small, self contained static web sites)?
> 
> = jem
> 
> -- 
> This is the BBEdit Talk public discussion group. If you have a feature 
> request or need technical support, please email
> "supp...@barebones.com" rather than posting to the group.
> Follow @bbedit on Twitter: 
> --- You received this message because you are subscribed to the Google Groups 
> "BBEdit Talk" group.
> To unsubscribe from this group and stop receiving emails from it, send an 
> email to bbedit+unsubscr...@googlegroups.com.
> To view this discussion on the web visit 
> https://groups.google.com/d/msgid/bbedit/252761B3-F305-4C45-AD70-5E7FAE495FD8%40mostrom.pp.se.

-- 
This is the BBEdit Talk public discussion group. If you have a 
feature request or need technical support, please email
"supp...@barebones.com" rather than posting to the group.
Follow @bbedit on Twitter: 
--- 
You received this message because you are subscribed to the Google Groups 
"BBEdit Talk" group.
To unsubscribe from this group and stop receiving emails from it, send an email 
to bbedit+unsubscr...@googlegroups.com.
To view this discussion on the web visit 
https://groups.google.com/d/msgid/bbedit/B486AA42-B4C7-4A96-BC3E-5269211AC505%405happy.com.

Re: Favicon

[bruce linde]

effing spell check... that was supposed to be ‘prefs’



bruce linde
5 happiness webmaster
510.530.1331 office
510.206.9730 mobile
http://www.5happy.com
bli...@5happy.com



> On Aug 5, 2019, at 5:50 PM, bruce linde  wrote:
> 
> you can specify in the press... check the manual for tips on searching and 
> replacing across directories and files...
> 
> 
> 
> bruce linde
> 5 happiness webmaster
> 510.530.1331 office
> 510.206.9730 mobile
> http://www.5happy.com
> bli...@5happy.com
> 
> 
> 
>> On Aug 5, 2019, at 3:31 PM, Ben Rogers  wrote:
>> 
>> Bruce,
>> 
>> Thank you for the response. You make perfect sense. Now, the issue I have to 
>> figure out is how to run a search that reads the html pages in my website 
>> folders. When I run a multi-file search, it seems that everything in my 
>> website folders is checked but the html pages themselves. Do I have to open 
>> each document? Can I run a search that goes through the entire website 
>> folder and its subfolders? If so, how? In the Multi-File Search box, there 
>> are lots of options and boxes to check. I'm not sure what to do to set up 
>> the search. I know I am extremely ignorant on this. 
>> 
>> In addition, if I get the search and replace to work on all the html files, 
>> how do I save them to the server? Is there an automatic way to save multiple 
>> files? Or do I have to save one file at a time? Or do I use an FTP and just 
>> save/overwrite all the files from the computer to the web server?
>> 
>> I know, too many questions. Thanks for your help thus far. It is appreciated.
>> 
>> Ben
>> 
>>> On Monday, August 5, 2019 at 2:33:15 PM UTC-7, Ben Rogers wrote:
>>> I am trying to put a favicon on my website. I have to put code in each 
>>> header for each website page. How do I search out each page and insert the 
>>> code. I know there is a way using the search menu but I cannot figure out 
>>> how to set the search so that BBEdit finds each web page to run the search 
>>> and add the code to the appropriate spot. If someone could help me out with 
>>> exact steps as to how to accomplish this, I would greatly appreciate it.
>>> 
>>> Thanks,
>>> 
>>> Ben
>> 
>> -- 
>> This is the BBEdit Talk public discussion group. If you have a 
>> feature request or need technical support, please email
>> "supp...@barebones.com" rather than posting to the group.
>> Follow @bbedit on Twitter: <https://www.twitter.com/bbedit>
>> --- 
>> You received this message because you are subscribed to the Google Groups 
>> "BBEdit Talk" group.
>> To unsubscribe from this group and stop receiving emails from it, send an 
>> email to bbedit+unsubscr...@googlegroups.com.
>> To view this discussion on the web visit 
>> https://groups.google.com/d/msgid/bbedit/b67b414f-e350-40d0-b1c5-55addf3951da%40googlegroups.com.
> -- 
> This is the BBEdit Talk public discussion group. If you have a 
> feature request or need technical support, please email
> "supp...@barebones.com" rather than posting to the group.
> Follow @bbedit on Twitter: <https://www.twitter.com/bbedit>
> --- 
> You received this message because you are subscribed to the Google Groups 
> "BBEdit Talk" group.
> To unsubscribe from this group and stop receiving emails from it, send an 
> email to bbedit+unsubscr...@googlegroups.com.
> To view this discussion on the web visit 
> https://groups.google.com/d/msgid/bbedit/C6FEED51-C115-4D8E-824E-91FF03BC82BE%405happy.com.

-- 
This is the BBEdit Talk public discussion group. If you have a 
feature request or need technical support, please email
"supp...@barebones.com" rather than posting to the group.
Follow @bbedit on Twitter: <https://www.twitter.com/bbedit>
--- 
You received this message because you are subscribed to the Google Groups 
"BBEdit Talk" group.
To unsubscribe from this group and stop receiving emails from it, send an email 
to bbedit+unsubscr...@googlegroups.com.
To view this discussion on the web visit 
https://groups.google.com/d/msgid/bbedit/5ABA66D6-F608-4F18-8A4C-F799F12993D0%405happy.com.

Re: Favicon

[bruce linde]

you can specify in the press... check the manual for tips on searching and 
replacing across directories and files...



bruce linde
5 happiness webmaster
510.530.1331 office
510.206.9730 mobile
http://www.5happy.com
bli...@5happy.com



> On Aug 5, 2019, at 3:31 PM, Ben Rogers  wrote:
> 
> Bruce,
> 
> Thank you for the response. You make perfect sense. Now, the issue I have to 
> figure out is how to run a search that reads the html pages in my website 
> folders. When I run a multi-file search, it seems that everything in my 
> website folders is checked but the html pages themselves. Do I have to open 
> each document? Can I run a search that goes through the entire website folder 
> and its subfolders? If so, how? In the Multi-File Search box, there are lots 
> of options and boxes to check. I'm not sure what to do to set up the search. 
> I know I am extremely ignorant on this. 
> 
> In addition, if I get the search and replace to work on all the html files, 
> how do I save them to the server? Is there an automatic way to save multiple 
> files? Or do I have to save one file at a time? Or do I use an FTP and just 
> save/overwrite all the files from the computer to the web server?
> 
> I know, too many questions. Thanks for your help thus far. It is appreciated.
> 
> Ben
> 
>> On Monday, August 5, 2019 at 2:33:15 PM UTC-7, Ben Rogers wrote:
>> I am trying to put a favicon on my website. I have to put code in each 
>> header for each website page. How do I search out each page and insert the 
>> code. I know there is a way using the search menu but I cannot figure out 
>> how to set the search so that BBEdit finds each web page to run the search 
>> and add the code to the appropriate spot. If someone could help me out with 
>> exact steps as to how to accomplish this, I would greatly appreciate it.
>> 
>> Thanks,
>> 
>> Ben
> 
> -- 
> This is the BBEdit Talk public discussion group. If you have a 
> feature request or need technical support, please email
> "supp...@barebones.com" rather than posting to the group.
> Follow @bbedit on Twitter: <https://www.twitter.com/bbedit>
> --- 
> You received this message because you are subscribed to the Google Groups 
> "BBEdit Talk" group.
> To unsubscribe from this group and stop receiving emails from it, send an 
> email to bbedit+unsubscr...@googlegroups.com.
> To view this discussion on the web visit 
> https://groups.google.com/d/msgid/bbedit/b67b414f-e350-40d0-b1c5-55addf3951da%40googlegroups.com.

-- 
This is the BBEdit Talk public discussion group. If you have a 
feature request or need technical support, please email
"supp...@barebones.com" rather than posting to the group.
Follow @bbedit on Twitter: <https://www.twitter.com/bbedit>
--- 
You received this message because you are subscribed to the Google Groups 
"BBEdit Talk" group.
To unsubscribe from this group and stop receiving emails from it, send an email 
to bbedit+unsubscr...@googlegroups.com.
To view this discussion on the web visit 
https://groups.google.com/d/msgid/bbedit/C6FEED51-C115-4D8E-824E-91FF03BC82BE%405happy.com.

Re: Favicon

[bruce linde]

ben -

some of that is bbedit and some is not.

once you’ve googled your ‘how to add a favicon’ solution and want to put it on 
every page you would find the appropriate code in your pages and do a 
multi-file search to replace code with the new stuff.

i re-map command+shift+f to bring up the multi-search file window. i no longer 
remember if this is stock, but for me command+e puts the selected text in the 
‘find’ box and command+option+e puts it in the ‘replace’ box. when i 
command+shift+f to bring up the multi-search dialog box it’s already 
pre-selected to search the current project.

for example, you might search for:

  
  
and replace it with:

  

  


… across all files in that project.

the trick is to 1) figure out what code you need/want to add and then 2) find 
some unique string immediately preceding (or following) where you want to put 
it and do the global search and replace.

make sense?










> On Aug 5, 2019, at 2:31 PM, Ben Rogers  <mailto:hist...@pacbell.net>> wrote:
> 
> I am trying to put a favicon on my website. I have to put code in each header 
> for each website page. How do I search out each page and insert the code. I 
> know there is a way using the search menu but I cannot figure out how to set 
> the search so that BBEdit finds each web page to run the search and add the 
> code to the appropriate spot. If someone could help me out with exact steps 
> as to how to accomplish this, I would greatly appreciate it.
> 
> Thanks,
> 
> Ben
> 
> -- 
> This is the BBEdit Talk public discussion group. If you have a 
> feature request or need technical support, please email
> "supp...@barebones.com <mailto:supp...@barebones.com>" rather than posting to 
> the group.
> Follow @bbedit on Twitter: <https://www.twitter.com/bbedit 
> <https://www.twitter.com/bbedit>>
> --- 
> You received this message because you are subscribed to the Google Groups 
> "BBEdit Talk" group.
> To unsubscribe from this group and stop receiving emails from it, send an 
> email to bbedit+unsubscr...@googlegroups.com 
> <mailto:bbedit+unsubscr...@googlegroups.com>.
> To view this discussion on the web visit 
> https://groups.google.com/d/msgid/bbedit/e1ebcacb-fcb4-43b0-a2bc-bff15bc0abbb%40googlegroups.com
>  
> <https://groups.google.com/d/msgid/bbedit/e1ebcacb-fcb4-43b0-a2bc-bff15bc0abbb%40googlegroups.com?utm_medium=email_source=footer>.





bruce linde
5 happiness webmaster (four more than the competition!)
http://www.5happy.com/ <http://www.5happy.com/>
http://clockhappy.com/
510.530.1331 office
510.206.9730 mobile

(shift key available upon request)








-- 
This is the BBEdit Talk public discussion group. If you have a 
feature request or need technical support, please email
"supp...@barebones.com" rather than posting to the group.
Follow @bbedit on Twitter: <https://www.twitter.com/bbedit>
--- 
You received this message because you are subscribed to the Google Groups 
"BBEdit Talk" group.
To unsubscribe from this group and stop receiving emails from it, send an email 
to bbedit+unsubscr...@googlegroups.com.
To view this discussion on the web visit 
https://groups.google.com/d/msgid/bbedit/9EA6E4F8-86E3-42C7-9EAA-84D1C7EE728C%405happy.com.

Re: GREP question: how to find and remove tags in XML document

[Bruce Linde]

you specifically said: "So i need to remove the  tags 
entirely but preserve the content and tags WITHIN these elements, is this 
at all possible with grep in bbedit ?"

my solution does just that.

if a yutz like me and a monster like christopher are both unclear on what 
you're looking to accomplish, it's clearly on you to provide specific 
before and after examples of EXACTLY what you're starting with and would 
like to end up with... the more, the merrier.








On Sunday, May 12, 2019 at 2:53:56 PM UTC-7, cosmo wrote:
>
> just to clarify, i am loohing for a way to find and delete specific tags 
> ONLY while preserving all other tags, including those contained WITHIN the 
> tags i want to remove. So for the above example the output i'm looking for 
> is:
>
>
> Original Markup:
>
>  "id-c416e7d8-cd3d-4c85-bb5a-d5496d0aa54a">Some  "id-a1847df5-8e01-21d8-f1d1-88b03728498b">text content here.
> 
>
>
> Processed markup:
>
>
> Some text 
> content here.
>
>

-- 
This is the BBEdit Talk public discussion group. If you have a 
feature request or need technical support, please email
"supp...@barebones.com" rather than posting to the group.
Follow @bbedit on Twitter: 
--- 
You received this message because you are subscribed to the Google Groups 
"BBEdit Talk" group.
To unsubscribe from this group and stop receiving emails from it, send an email 
to bbedit+unsubscr...@googlegroups.com.
To post to this group, send email to bbedit@googlegroups.com.
Visit this group at https://groups.google.com/group/bbedit.
To view this discussion on the web visit 
https://groups.google.com/d/msgid/bbedit/7410eacb-b076-46b9-b844-8f4d696fc651%40googlegroups.com.

Re: grep search - insert character before search result

[bruce linde]

now you’re just showing off... guess i’m going to have to stare at the docs a 
bit to make sure i grok that  8-)



bruce linde
5 happiness webmaster
510.530.1331 office
510.206.9730 mobile
http://www.5happy.com
bli...@5happy.com



> On Apr 29, 2019, at 5:28 PM, Dave  wrote:
> 
> Or find: (?=\d{4})
> replace: \t
> This finds the position before four consecutive digits and inserts a tab.
> -- 
> This is the BBEdit Talk public discussion group. If you have a 
> feature request or need technical support, please email
> "supp...@barebones.com" rather than posting to the group.
> Follow @bbedit on Twitter: <https://www.twitter.com/bbedit>
> --- 
> You received this message because you are subscribed to the Google Groups 
> "BBEdit Talk" group.
> To unsubscribe from this group and stop receiving emails from it, send an 
> email to bbedit+unsubscr...@googlegroups.com.
> To post to this group, send email to bbedit@googlegroups.com.
> Visit this group at https://groups.google.com/group/bbedit.

-- 
This is the BBEdit Talk public discussion group. If you have a 
feature request or need technical support, please email
"supp...@barebones.com" rather than posting to the group.
Follow @bbedit on Twitter: <https://www.twitter.com/bbedit>
--- 
You received this message because you are subscribed to the Google Groups 
"BBEdit Talk" group.
To unsubscribe from this group and stop receiving emails from it, send an email 
to bbedit+unsubscr...@googlegroups.com.
To post to this group, send email to bbedit@googlegroups.com.
Visit this group at https://groups.google.com/group/bbedit.

Re: grep search - insert character before search result

[bruce linde]

doh! thx for the reminder... i typically use the \1 because i’m searching for 
(and replacing) several things simultaneously.




bruce linde
5 happiness webmaster
510.530.1331 office
510.206.9730 mobile
http://www.5happy.com
bli...@5happy.com



> On Apr 28, 2019, at 5:33 PM, Tom Robinson  wrote:
> 
> In addition to bruce’s answer:
> 
> You can replace with \t&
> 
> The ampersand represents the entire found string, so you’re replacing the 4 
> digits with a tab followed by the original 4 digits.
> 
> Cheers
> 
> 
>> On 2019-04-29, at 09:53, gebseng  wrote:
>> 
>> In bbedit 12, I am using grep in the Find window to search for this pattern: 
>> \d\d\d\d (number with four digits), which works fine.
>> 
>> However, now I do not want to replace the search results with something 
>> lese, but rather I would like to insert a tab (\t) BEFORE each occurence of 
>> \d\d\d\d. is there a way to do that?
> 
> -- 
> This is the BBEdit Talk public discussion group. If you have a 
> feature request or need technical support, please email
> "supp...@barebones.com" rather than posting to the group.
> Follow @bbedit on Twitter: <https://www.twitter.com/bbedit>
> --- 
> You received this message because you are subscribed to the Google Groups 
> "BBEdit Talk" group.
> To unsubscribe from this group and stop receiving emails from it, send an 
> email to bbedit+unsubscr...@googlegroups.com.
> To post to this group, send email to bbedit@googlegroups.com.
> Visit this group at https://groups.google.com/group/bbedit.

-- 
This is the BBEdit Talk public discussion group. If you have a 
feature request or need technical support, please email
"supp...@barebones.com" rather than posting to the group.
Follow @bbedit on Twitter: <https://www.twitter.com/bbedit>
--- 
You received this message because you are subscribed to the Google Groups 
"BBEdit Talk" group.
To unsubscribe from this group and stop receiving emails from it, send an email 
to bbedit+unsubscr...@googlegroups.com.
To post to this group, send email to bbedit@googlegroups.com.
Visit this group at https://groups.google.com/group/bbedit.

Re: grep search - insert character before search result

[bruce linde]

find: (\d\d\d\d)
replace: \t\1





> On Apr 28, 2019, at 2:53 PM, gebseng  <mailto:gebs...@gmail.com>> wrote:
> 
> Hi everyone,
> 
> In bbedit 12, I am using grep in the Find window to search for this pattern: 
> \d\d\d\d (number with four digits), which works fine.
> 
> However, now I do not want to replace the search results with something lese, 
> but rather I would like to insert a tab (\t) BEFORE each occurence of 
> \d\d\d\d. is there a way to do that?
> 
> best,
> 
> geb
> 
> -- 
> This is the BBEdit Talk public discussion group. If you have a 
> feature request or need technical support, please email
> "supp...@barebones.com <mailto:supp...@barebones.com>" rather than posting to 
> the group.
> Follow @bbedit on Twitter: <https://www.twitter.com/bbedit 
> <https://www.twitter.com/bbedit>>
> --- 
> You received this message because you are subscribed to the Google Groups 
> "BBEdit Talk" group.
> To unsubscribe from this group and stop receiving emails from it, send an 
> email to bbedit+unsubscr...@googlegroups.com 
> <mailto:bbedit+unsubscr...@googlegroups.com>.
> To post to this group, send email to bbedit@googlegroups.com 
> <mailto:bbedit@googlegroups.com>.
> Visit this group at https://groups.google.com/group/bbedit 
> <https://groups.google.com/group/bbedit>.





bruce linde
5 happiness webmaster (four more than the competition!)
http://www.5happy.com/ <http://www.5happy.com/>
http://www.5happy.com/blahg
510.530.1331 office (and best place to leave messages)
510.206.9730 mobile

(shift key available upon request)






-- 
This is the BBEdit Talk public discussion group. If you have a 
feature request or need technical support, please email
"supp...@barebones.com" rather than posting to the group.
Follow @bbedit on Twitter: <https://www.twitter.com/bbedit>
--- 
You received this message because you are subscribed to the Google Groups 
"BBEdit Talk" group.
To unsubscribe from this group and stop receiving emails from it, send an email 
to bbedit+unsubscr...@googlegroups.com.
To post to this group, send email to bbedit@googlegroups.com.
Visit this group at https://groups.google.com/group/bbedit.

Re: Unexplained boxes on all pages

[bruce linde]

hmm… more of an HTML/CSS question than bbedit, but there appears to be a 1px 
border defined in your CSS (style sheet).

you can right click on any of those boxes to ‘inspect element’ and view the 
CSS… but all you need to do is change:

div, p, em {
margin: 5px;
padding: 1px;
background-color: white;
border: 1px solid black;

to:

div, p, em {
margin: 5px;
padding: 1px;
background-color: white;
border: 0px solid black;

in the CSS file called RFCAStyle4.css and you should be good to go. 

if not, look for other element styles that might be adding a border.










> On Mar 14, 2019, at 7:30 AM, Patricia Scott  <mailto:ferali...@gmail.com>> wrote:
> 
> Hello again, Forum people,
> 
> I am still having problems with the website. Originally, it was looking just 
> like it should. I did not change anything, but suddenly every syntactic 
> element has a box around it: such as content.. I have used BBEdit for 
> more than 10 years, so I am not a novice. I attach a link to a file where you 
> can see what is happening, and which gives access to the whole sorry site.
> 
> We did have a hacker attack a few months ago. They were obviously amateur 
> hackers and they put stupid things on many pages and on the css sheet. So I 
> wonder if these boxes are the result of a more experienced hacker. 
> 
> I hope someone in the Forum can help. It will be much  appreciated.
> 
> http://www.rarefruitclub.org.au/ArticlesEssays.htm 
> <http://www.rarefruitclub.org.au/ArticlesEssays.htm>
> 
> Cheers,
> Pat
> 
> -- 
> This is the BBEdit Talk public discussion group. If you have a 
> feature request or need technical support, please email
> "supp...@barebones.com <mailto:supp...@barebones.com>" rather than posting to 
> the group.
> Follow @bbedit on Twitter: <https://www.twitter.com/bbedit 
> <https://www.twitter.com/bbedit>>
> --- 
> You received this message because you are subscribed to the Google Groups 
> "BBEdit Talk" group.
> To unsubscribe from this group and stop receiving emails from it, send an 
> email to bbedit+unsubscr...@googlegroups.com 
> <mailto:bbedit+unsubscr...@googlegroups.com>.
> To post to this group, send email to bbedit@googlegroups.com 
> <mailto:bbedit@googlegroups.com>.
> Visit this group at https://groups.google.com/group/bbedit 
> <https://groups.google.com/group/bbedit>.





bruce linde
5 happiness webmaster (four more than the competition!)
http://www.5happy.com/ <http://www.5happy.com/>
http://www.5happy.com/blahg
510.530.1331 office (and best place to leave messages)
510.206.9730 mobile

(shift key available upon request)






-- 
This is the BBEdit Talk public discussion group. If you have a 
feature request or need technical support, please email
"supp...@barebones.com" rather than posting to the group.
Follow @bbedit on Twitter: <https://www.twitter.com/bbedit>
--- 
You received this message because you are subscribed to the Google Groups 
"BBEdit Talk" group.
To unsubscribe from this group and stop receiving emails from it, send an email 
to bbedit+unsubscr...@googlegroups.com.
To post to this group, send email to bbedit@googlegroups.com.
Visit this group at https://groups.google.com/group/bbedit.

Re: Navigating folders and files in a project sidebar from the keyboard?

[bruce linde]

i have no memory of ever doing this, but must have… it’s a brilliant feature i 
use all the time.
as usual: thx, barebones!   8-)






> On Feb 7, 2019, at 8:13 AM, Patrick Woolsey  <mailto:pwool...@barebones.com>> wrote:
> 
> On 2/6/19 at 7:23 PM, barb...@signalfx.com <mailto:barb...@signalfx.com> 
> (Barbara Snyder) wrote:
> 
>> What I want to do is use the keyboard to select a different file from the 
>> project file list.
>> 
> [...]
> 
> There is an expert prefs option which you can set to obtain this behavior.
> 
> Cribbing from the "Expert Preferences" page of the online help (Help -> 
> BBEdit Help):
> 
> 
> 
> Projects
> 
>  * In project windows, the file list does not accept keyboard focus
>by default, unless the editing view is hidden. You can modify this
>so that the file list gets the focus whenever you click on it:
> 
>[ by issuing the following Terminal command ]
> 
>defaults write com.barebones.bbedit ProjectsListCanAcquireKeyboardFocus 
> -bool YES
> 
> 
> 
> Having made the above change, you may further wish to enable the next option 
> to prevent keyboard navigation "over" files from automatically opening them:
> 
> 
> 
> Projects
> 
>  * In project windows, the file list does not accept [ ... ]
> 
>  * Project windows will ordinarily open an item in the file list
>for editing when you click on it and the editing view is visible.
>To require a double-click:
> 
>[ just enter the following Terminal command ]
> 
>defaults write com.barebones.bbedit ProjectsOpenItemsOnSingleClick -bool NO
> 
> 
> 
> (PS: Since the latter option does work :-) please check to ensure you've 
> entered the  command exactly as it appears above.)
> 
> 
> Regards,
> 
>  -- Patrick Woolsey
> ==
> Bare Bones Software, Inc.   <http://www.barebones.com/ 
> <http://www.barebones.com/>>
> 
> 
> -- 
> This is the BBEdit Talk public discussion group. If you have a feature 
> request or need technical support, please email
> "supp...@barebones.com <mailto:supp...@barebones.com>" rather than posting to 
> the group.
> Follow @bbedit on Twitter: <https://www.twitter.com/bbedit 
> <https://www.twitter.com/bbedit>>
> --- You received this message because you are subscribed to the Google Groups 
> "BBEdit Talk" group.
> To unsubscribe from this group and stop receiving emails from it, send an 
> email to bbedit+unsubscr...@googlegroups.com 
> <mailto:bbedit+unsubscr...@googlegroups.com>.
> To post to this group, send email to bbedit@googlegroups.com 
> <mailto:bbedit@googlegroups.com>.
> Visit this group at https://groups.google.com/group/bbedit 
> <https://groups.google.com/group/bbedit>.





bruce linde
5 happiness webmaster (four more than the competition!)
http://www.5happy.com/ <http://www.5happy.com/>
http://www.5happy.com/blahg
510.530.1331 office (and best place to leave messages)
510.206.9730 mobile

(shift key available upon request)






-- 
This is the BBEdit Talk public discussion group. If you have a 
feature request or need technical support, please email
"supp...@barebones.com" rather than posting to the group.
Follow @bbedit on Twitter: <https://www.twitter.com/bbedit>
--- 
You received this message because you are subscribed to the Google Groups 
"BBEdit Talk" group.
To unsubscribe from this group and stop receiving emails from it, send an email 
to bbedit+unsubscr...@googlegroups.com.
To post to this group, send email to bbedit@googlegroups.com.
Visit this group at https://groups.google.com/group/bbedit.

Re: Tricky regex question

[bruce linde]

yes, but… what about Eb7#9 or C#7#9 or A9sus?

you’re assuming missionary position chords and not (for example) steely dan or 
jazz.

i am still not sure what the goal is… put the chords in bold, but not the 
lyrics? create a ‘chords only’ version for the non-singers in the band?

you said you want to style them differently…

why not search for any line that is NOT just words and single spaces, and wrap 
it in (for example) bold tags, or a span/css tag?






 

 







> On Feb 2, 2019, at 9:53 AM, Marek Stepanek  
> wrote:
> 
> 
> So try this:
> 
> ^\s*([A-Z\dm♭#dim]+\s+)+
> 
> it’s working on this example:
> 
> 
> E   B7   E  A  Am  E  
> This is a line of a song
>E
> This is a line of a song
>   B7  E  E7
> This is a line of a song
>  A
> This is a line of a song
>   E
> This is a line of a song
>  B7
> This is a line of a song
>   EA Am  E  
> This is a line of a song
>A#  EA Am  E  
> This is a line of a song
>A♭ Adim  EA Am  E  
> This is a line of a song
> 
> 
> 
> 
> 
>> On 2. Feb 2019, at 18:45, jgill  wrote:
>> 
>> I need to identify chord lines and non-chord lines so that I can style them 
>> differently on a web page. Remember, I'm not just looking for [A-G] but A7, 
>> Am, A#, A♭dim etc
>> 
>> On Saturday, February 2, 2019 at 5:36:42 PM UTC, Marek wrote:
>> Hello jgill!
>> 
>> 
>> You forgot to tell us, what you exactly want to achieve. Do you want to 
>> extract the lines with the chords? 
>> 
>> Try with regex: search with grep case sensitive: 
>> 
>> \s*([A-Z\dm]+\s+)+
>> 
>> 
>> Best greetings from Munich
>> 
>> 
>> marek
>> 
>> 
>> 
>>> On 2. Feb 2019, at 17:59, jgill  wrote:
>>> 
>>> I've been banging my head all afternoon trying to derive a regex the will 
>>> identify lines (of a song) that contains chords.
>>> 
>>> eg
>>> 
>>> E   B7   E  A  Am  E  
>>> This is a line of a song
>>>E
>>> This is a line of a song
>>>   B7  E  E7
>>> This is a line of a song
>>>  A
>>> This is a line of a song
>>>   E
>>> This is a line of a song
>>>  B7
>>> This is a line of a song
>>>   EA Am  E  
>>> This is a line of a song
>>> 
>>> There could be spaces before or after the chord names and the only way I 
>>> can think to distinguish chords from regular words is that chords are 
>>> likely to have more than one space after them - or a newline
>>> 
>>> I've got as far as [A-G][6|7|9|m|#|♯|b|♭|aug|dim]
>>> 
>>> but the spaces and newlines have me flumoxed.
>>> 
>>> Can anyone help?
>>> 
>>> -- 
>>> This is the BBEdit Talk public discussion group. If you have a 
>>> feature request or need technical support, please email
>>> "sup...@barebones.com" rather than posting to the group.
>>> Follow @bbedit on Twitter: <https://www.twitter.com/bbedit>
>>> --- 
>>> You received this message because you are subscribed to the Google Groups 
>>> "BBEdit Talk" group.
>>> To unsubscribe from this group and stop receiving emails from it, send an 
>>> email to bbedit+un...@googlegroups.com.
>>> To post to this group, send email to bbe...@googlegroups.com.
>>> Visit this group at https://groups.google.com/group/bbedit.
>> 
>> 
>> -- 
>> This is the BBEdit Talk public discussion group. If you have a 
>> feature request or need technical support, please email
>> "supp...@barebones.com" rather than posting to the group.
>> Follow @bbedit on Twitter: <https://www.twitter.com/bbedit>
>> --- 
>> You received this message because you are subscribed to the Google Groups 
>> "BBEdit Talk" group.
>> To unsubscribe from this group and stop receiving emails from it, send an 
>> email to bbedit+unsubscr...@googlegroups.com.
>> To post to this group, send email to bbedit@googlegroups.com.
>> Visit this group at https://groups.google.com/group/bbedit.
> 
> 
> -- 
> This is the BBEdit Talk public discussion group. If you have a 
> feature request or need technical support, please email
> "supp...@barebones.com" rather than posting to the group.
> Follow @bbedit on Twitter: <https://www.twitter.com/bbedit>
> --- 
> You

Re: Tricky regex question

[bruce linde]

actually, you don’t. you need to identify one or the other…. if you match one, 
it ain’t the other and you can format accordingly.







> On Feb 2, 2019, at 9:45 AM, jgill  <mailto:joegillespie2...@gmail.com>> wrote:
> 
> I need to identify chord lines and non-chord lines so that I can style them 
> differently on a web page. Remember, I'm not just looking for [A-G] but A7, 
> Am, A#, A♭dim etc
> 
> On Saturday, February 2, 2019 at 5:36:42 PM UTC, Marek wrote:
> Hello jgill!
> 
> 
> You forgot to tell us, what you exactly want to achieve. Do you want to 
> extract the lines with the chords? 
> 
> Try with regex: search with grep case sensitive: 
> 
> \s*([A-Z\dm]+\s+)+
> 
> 
> Best greetings from Munich
> 
> 
> marek
> 
> 
> 
>> On 2. Feb 2019, at 17:59, jgill > wrote:
>> 
>> I've been banging my head all afternoon trying to derive a regex the will 
>> identify lines (of a song) that contains chords.
>> 
>> eg
>> 
>> E   B7   E  A  Am  E  
>> This is a line of a song
>>E
>> This is a line of a song
>>   B7  E  E7
>> This is a line of a song
>>  A
>> This is a line of a song
>>   E
>> This is a line of a song
>>  B7
>> This is a line of a song
>>   EA Am  E  
>> This is a line of a song
>> 
>> There could be spaces before or after the chord names and the only way I can 
>> think to distinguish chords from regular words is that chords are likely to 
>> have more than one space after them - or a newline
>> 
>> I've got as far as [A-G][6|7|9|m|#|♯|b|♭|aug|dim]
>> 
>> but the spaces and newlines have me flumoxed.
>> 
>> Can anyone help?
>> 
>> -- 
>> This is the BBEdit Talk public discussion group. If you have a 
>> feature request or need technical support, please email
>> "sup...@barebones.com " rather than posting to the group.
>> Follow @bbedit on Twitter: <https://www.twitter.com/bbedit 
>> <https://www.twitter.com/bbedit>>
>> --- 
>> You received this message because you are subscribed to the Google Groups 
>> "BBEdit Talk" group.
>> To unsubscribe from this group and stop receiving emails from it, send an 
>> email to bbedit+un...@googlegroups.com .
>> To post to this group, send email to bbe...@googlegroups.com .
>> Visit this group at https://groups.google.com/group/bbedit 
>> <https://groups.google.com/group/bbedit>.
> 
> 
> -- 
> This is the BBEdit Talk public discussion group. If you have a 
> feature request or need technical support, please email
> "supp...@barebones.com <mailto:supp...@barebones.com>" rather than posting to 
> the group.
> Follow @bbedit on Twitter: <https://www.twitter.com/bbedit 
> <https://www.twitter.com/bbedit>>
> --- 
> You received this message because you are subscribed to the Google Groups 
> "BBEdit Talk" group.
> To unsubscribe from this group and stop receiving emails from it, send an 
> email to bbedit+unsubscr...@googlegroups.com 
> <mailto:bbedit+unsubscr...@googlegroups.com>.
> To post to this group, send email to bbedit@googlegroups.com 
> <mailto:bbedit@googlegroups.com>.
> Visit this group at https://groups.google.com/group/bbedit 
> <https://groups.google.com/group/bbedit>.





bruce linde
5 happiness webmaster (four more than the competition!)
http://www.5happy.com/ <http://www.5happy.com/>
http://www.5happy.com/blahg
510.530.1331 office (and best place to leave messages)
510.206.9730 mobile

(shift key available upon request)






-- 
This is the BBEdit Talk public discussion group. If you have a 
feature request or need technical support, please email
"supp...@barebones.com" rather than posting to the group.
Follow @bbedit on Twitter: <https://www.twitter.com/bbedit>
--- 
You received this message because you are subscribed to the Google Groups 
"BBEdit Talk" group.
To unsubscribe from this group and stop receiving emails from it, send an email 
to bbedit+unsubscr...@googlegroups.com.
To post to this group, send email to bbedit@googlegroups.com.
Visit this group at https://groups.google.com/group/bbedit.

Re: One-liner to replace multiple spaces between words (only words) with one space isn't working

[Bruce Linde]

ok... pardon my ignorance but why/when does one want leading spaces from a 
file?





On Monday, January 14, 2019 at 9:26:47 AM UTC-8, Lewis Butler wrote:
>
> On 14 Jan 2019, at 10:15, Bruce Linde > 
> wrote: 
> > why do we care about word boundaries? 
>
> Possibly because you do not want to strip leading spaces from the file? 
>
>
>
> -- 
> I gotta straighten my face This mellow-thighed chick just put my spine 
> out of place 
>
>

-- 
This is the BBEdit Talk public discussion group. If you have a 
feature request or need technical support, please email
"supp...@barebones.com" rather than posting to the group.
Follow @bbedit on Twitter: <https://www.twitter.com/bbedit>
--- 
You received this message because you are subscribed to the Google Groups 
"BBEdit Talk" group.
To unsubscribe from this group and stop receiving emails from it, send an email 
to bbedit+unsubscr...@googlegroups.com.
To post to this group, send email to bbedit@googlegroups.com.
Visit this group at https://groups.google.com/group/bbedit.

Re: One-liner to replace multiple spaces between words (only words) with one space isn't working

[Bruce Linde]

why do we care about word boundaries? and, marek did provide a 
bbedit-specific solution above... which is the one i use all the time.

search for:

   xx+ (where the x's are spaces... meaning 'find two or more spaces')

replace with:

   x (a single space)

i suppose you could just search for 'one or more spaces' but we don't care 
about single spaces so why bother finding them? we only care about two or 
more spaces
 



On Monday, January 14, 2019 at 9:05:13 AM UTC-8, Lewis Butler wrote:
>
> On 12 Jan 2019, at 18:32, Dj > wrote: 
> > I'm trying to replace spaces between words so a sentence like this: 
> > 
> > "this line has  really   messed  upspacing” 
>
> It doesn’t look to me like this was actually answered. All the replace 
> multiple space will replace ALL multiple spaces, not simply those between 
> words. 
>
>
> Grep search for: \> +\< 
> Replace with: “ “ # no quotes 
>
> Should do it. No need to involve perl at all. 
>
> (The pattern \> matches the “end of word boundary” and \< matches the 
> “start of word boundary”.) 
>
> -- 
> 'Can't argue with the truth, sir.' 'In my experience, Vimes, you can 
> argue with anything.’ 
>
>

-- 
This is the BBEdit Talk public discussion group. If you have a 
feature request or need technical support, please email
"supp...@barebones.com" rather than posting to the group.
Follow @bbedit on Twitter: 
--- 
You received this message because you are subscribed to the Google Groups 
"BBEdit Talk" group.
To unsubscribe from this group and stop receiving emails from it, send an email 
to bbedit+unsubscr...@googlegroups.com.
To post to this group, send email to bbedit@googlegroups.com.
Visit this group at https://groups.google.com/group/bbedit.

Re: BBEdit 12.5.1 failed to "show invisibles"

[Bruce Linde]

problems should be reported to supp...@barebones.com





On Thursday, December 6, 2018 at 9:56:25 AM UTC-5, Dawn Song wrote:
>
> When I check "View" > "Text Display" > "Show Invisibles", BBEdit failed to 
> show the invisible symbol between "hybrid=1" and "=7".
> It works before.
>

-- 
This is the BBEdit Talk public discussion group. If you have a 
feature request or need technical support, please email
"supp...@barebones.com" rather than posting to the group.
Follow @bbedit on Twitter: 
--- 
You received this message because you are subscribed to the Google Groups 
"BBEdit Talk" group.
To unsubscribe from this group and stop receiving emails from it, send an email 
to bbedit+unsubscr...@googlegroups.com.
To post to this group, send email to bbedit@googlegroups.com.
Visit this group at https://groups.google.com/group/bbedit.

Re: PHP development ?

[bruce linde]

Well my partner and I have multiple sites in motion and we can just clone a 
vagrant box to get a whole bunch of core functionality we’ve already built... 
When I’m working by myself I just use mamp 





bruce linde
5 happiness webmaster
510.530.1331 office
510.206.9730 mobile
http://www.5happy.com

(please excuse brevity... sent from my iPhone)




> On Jul 20, 2018, at 8:42 PM, Greg Raven  wrote:
> 
> You use Vagrant to set up a development environment (in VirtualBox, for 
> example). There used to be a program called Hobo that made this easier, but 
> it's always seemed non-trivial to me. The benefit is that once you have a 
> Vagrant process (or whatever they are called) set up, you can run it at any 
> time to set up a new instance for other projects, or simply to scrap and 
> reorder the one you're currently using. If you are working with a team, you 
> can also share Vagrant processes so that everyone is using the same 
> development environment.
> 
> For me, the game isn't worth the candle. I could have an entire website set 
> up and running by the time I figured out how to get Vagrant working. Your 
> mileage may vary.
> 
>> On Friday, July 20, 2018 at 8:21:41 PM UTC-7, Jean-Christophe Helary wrote:
>> 
>> 
>>> On Jul 21, 2018, at 0:06, bruce linde  wrote:
>>> 
>>> mamp, git, vagrant.
>>> 
>>> i’ve been using mamp forever but my partner pushed me to try vagrant... i’m 
>>> now running both.
>> 
>> I'm checking Vagrant and I'm not sure how I could use that for Web/PHP 
>> development. Could you develop on that ?
>> 
>> Jean-Christophe 
>> 
>> 
>>> On Jul 20, 2018, at 6:11 AM, Jean-Christophe Helary  
>>> wrote:
>> 
>>>>> On Jul 20, 2018, at 22:00, Greg Raven  wrote:
>>>>> 
>>>>> The best way I have found to do this is to have your PHP files in a 
>>>>> BBEdit project,
>>>> 
>>>> I've created a project for my files (I find projects hard to navigate, 
>>>> namely no apparent way to move around without having to use the mouse, but 
>>>> maybe I'm missing something). Basically a bunch of WP files.
>>>> 
>>>>> and then set the project settings to open a local website.
>>>> 
>>>> Can you be more specific ?
>>>> 
>>>>> To have a local website, you can use any of a number of methods, 
>>>>> including MAMP, HostBuddy, VirtualHostX, VirtualBox, etc.,
>>>> 
>>>> I'm using MAMP. I have the test site and the "production" site side by 
>>>> side, both managed under git and I'll be setting up sync to make sure I 
>>>> have everything under control. Then I need to find a way to sync to the 
>>>> ftp server (I don't have a clear idea how to do that but I'll get there 
>>>> eventually...)
>>>> 
>>>> Jean-Christophe 
>>>> 
>>>>> or you can set up your local Apache server to serve your site locally 
>>>>> with PHP. I just use the built-in Apache with modifications to the 
>>>>> httpd.conf, hosts, and vhosts files. There are a couple of fiddly bits 
>>>>> involved when doing it this way, but you don't have to download and 
>>>>> maintain anything and it works just fine.
>>>>> 
>>>>>> On Thursday, July 19, 2018 at 9:13:42 PM UTC-7, Jean-Christophe Helary 
>>>>>> wrote:
>>>>>> 
>>>>>> 
>>>>>>> On Jul 20, 2018, at 10:04, Scott in Pollock  
>>>>>>> wrote:
>>>>>>> 
>>>>>>> You'll need a local server running PHP. Google 'MAMP'.
>>>>>> 
>>>>>> Sorry if that was not clear. I do have everything set up already.
>>>>>> 
>>>>>> I just need BBedit to "preview" my files not by calling file://... but 
>>>>>> by calling http/localhost/...
>>>>>> 
>>>>>> What's happening now is that I edit/save PHP on BBedit and the switch to 
>>>>>> Safari and reload. That's not practical. Is there a way to do call that 
>>>>>> preview from BBedit directly ?
>> 
>> 
>> Jean-Christophe Helary
>> ---
>> http://mac4translators.blogspot.com @brandelune
>> 
>> 
> 
> -- 
> This is the BBEdit Talk public discussion group. If you have a 
> feature request or would like to report a problem, please email
> "supp...@barebones.com" rather than post

Re: PHP development ?

[bruce linde]

mamp, git, vagrant.

i’ve been using mamp forever but my partner pushed me to try vagrant... i’m now 
running both.







> On Jul 20, 2018, at 6:11 AM, Jean-Christophe Helary  
> wrote:
> 
> 
> 
>> On Jul 20, 2018, at 22:00, Greg Raven  wrote:
>> 
>> The best way I have found to do this is to have your PHP files in a BBEdit 
>> project,
> 
> I've created a project for my files (I find projects hard to navigate, namely 
> no apparent way to move around without having to use the mouse, but maybe I'm 
> missing something). Basically a bunch of WP files.
> 
>> and then set the project settings to open a local website.
> 
> Can you be more specific ?
> 
>> To have a local website, you can use any of a number of methods, including 
>> MAMP, HostBuddy, VirtualHostX, VirtualBox, etc.,
> 
> I'm using MAMP. I have the test site and the "production" site side by side, 
> both managed under git and I'll be setting up sync to make sure I have 
> everything under control. Then I need to find a way to sync to the ftp server 
> (I don't have a clear idea how to do that but I'll get there eventually...)
> 
> Jean-Christophe 
> 
>> or you can set up your local Apache server to serve your site locally with 
>> PHP. I just use the built-in Apache with modifications to the httpd.conf, 
>> hosts, and vhosts files. There are a couple of fiddly bits involved when 
>> doing it this way, but you don't have to download and maintain anything and 
>> it works just fine.
>> 
>>> On Thursday, July 19, 2018 at 9:13:42 PM UTC-7, Jean-Christophe Helary 
>>> wrote:
>>> 
>>> 
 On Jul 20, 2018, at 10:04, Scott in Pollock  wrote:
 
 You'll need a local server running PHP. Google 'MAMP'.
>>> 
>>> Sorry if that was not clear. I do have everything set up already.
>>> 
>>> I just need BBedit to "preview" my files not by calling file://... but by 
>>> calling http/localhost/...
>>> 
>>> What's happening now is that I edit/save PHP on BBedit and the switch to 
>>> Safari and reload. That's not practical. Is there a way to do call that 
>>> preview from BBedit directly ?
>>> 
>>> 
>>> Jean-Christophe Helary
>>> ---
>>> http://mac4translators.blogspot.com @brandelune
>>> 
>>> 
>> 
>> 
>> -- 
>> This is the BBEdit Talk public discussion group. If you have a 
>> feature request or would like to report a problem, please email
>> "supp...@barebones.com" rather than posting to the group.
>> Follow @bbedit on Twitter: 
>> --- 
>> You received this message because you are subscribed to the Google Groups 
>> "BBEdit Talk" group.
>> To unsubscribe from this group and stop receiving emails from it, send an 
>> email to bbedit+unsubscr...@googlegroups.com.
>> To post to this group, send email to bbedit@googlegroups.com.
>> Visit this group at https://groups.google.com/group/bbedit.
> 
> Jean-Christophe Helary
> ---
> http://mac4translators.blogspot.com @brandelune
> 
> 
> -- 
> This is the BBEdit Talk public discussion group. If you have a 
> feature request or would like to report a problem, please email
> "supp...@barebones.com" rather than posting to the group.
> Follow @bbedit on Twitter: 
> --- 
> You received this message because you are subscribed to the Google Groups 
> "BBEdit Talk" group.
> To unsubscribe from this group and stop receiving emails from it, send an 
> email to bbedit+unsubscr...@googlegroups.com.
> To post to this group, send email to bbedit@googlegroups.com.
> Visit this group at https://groups.google.com/group/bbedit.

-- 
This is the BBEdit Talk public discussion group. If you have a 
feature request or would like to report a problem, please email
"supp...@barebones.com" rather than posting to the group.
Follow @bbedit on Twitter: 
--- 
You received this message because you are subscribed to the Google Groups 
"BBEdit Talk" group.
To unsubscribe from this group and stop receiving emails from it, send an email 
to bbedit+unsubscr...@googlegroups.com.
To post to this group, send email to bbedit@googlegroups.com.
Visit this group at https://groups.google.com/group/bbedit.

Re: Preview phone/ipad size?

[Bruce Linde]

preview in safari and then develop --> enter responsive design mode?







On Wednesday, June 13, 2018 at 10:33:45 AM UTC-7, Lewis Butler wrote:
>
> I’ve been updating a page and I am needing to check it at three sizes, 
> phone (portrait), iPad (portrait), and 1280x800. 
>
> Is there anyway to either have three preview windows for a document on my 
> second display, or quickly move between three pre-set sizes for the preview 
> window? 
>
>
>

-- 
This is the BBEdit Talk public discussion group. If you have a 
feature request or would like to report a problem, please email
"supp...@barebones.com" rather than posting to the group.
Follow @bbedit on Twitter: 
--- 
You received this message because you are subscribed to the Google Groups 
"BBEdit Talk" group.
To unsubscribe from this group and stop receiving emails from it, send an email 
to bbedit+unsubscr...@googlegroups.com.
To post to this group, send email to bbedit@googlegroups.com.
Visit this group at https://groups.google.com/group/bbedit.

Re: Duplicate quotation marks

[bruce linde]

yes… it’s in prefs… one of the auto-complete settings…




> On Feb 3, 2018, at 1:12 PM, David Brostoff <dav...@earthlink.net 
> <mailto:dav...@earthlink.net>> wrote:
> 
> With BBEdit 12.0.2 (MacBook Pro 2017 15-inch, macOS 10.13.2, ABC - Extended 
> keyboard in System Preferences), whenever I type a double quotation mark, two 
> sets of double quotation marks are displayed.
> 
> In other words, when I type ", the result is "", with the cursor placed 
> between the two quotation marks.
> 
> I think this started with 10.13.
> 
> Maybe a preference needs to be changed?
> 
> Thank you,
> 
> David
> 
> -- 
> This is the BBEdit Talk public discussion group. If you have a 
> feature request or would like to report a problem, please email
> "supp...@barebones.com <mailto:supp...@barebones.com>" rather than posting to 
> the group.
> Follow @bbedit on Twitter: <http://www.twitter.com/bbedit 
> <http://www.twitter.com/bbedit>>
> --- 
> You received this message because you are subscribed to the Google Groups 
> "BBEdit Talk" group.
> To unsubscribe from this group and stop receiving emails from it, send an 
> email to bbedit+unsubscr...@googlegroups.com 
> <mailto:bbedit+unsubscr...@googlegroups.com>.
> To post to this group, send email to bbedit@googlegroups.com 
> <mailto:bbedit@googlegroups.com>.
> Visit this group at https://groups.google.com/group/bbedit 
> <https://groups.google.com/group/bbedit>.





bruce linde
5 happiness webmaster (four more than the competition!)
http://www.5happy.com/ <http://www.5happy.com/>
http://www.5happy.com/blahg
510.530.1331 office (and best place to leave messages)
510.206.9730 mobile

(shift key available upon request)







-- 
This is the BBEdit Talk public discussion group. If you have a 
feature request or would like to report a problem, please email
"supp...@barebones.com" rather than posting to the group.
Follow @bbedit on Twitter: <http://www.twitter.com/bbedit>
--- 
You received this message because you are subscribed to the Google Groups 
"BBEdit Talk" group.
To unsubscribe from this group and stop receiving emails from it, send an email 
to bbedit+unsubscr...@googlegroups.com.
To post to this group, send email to bbedit@googlegroups.com.
Visit this group at https://groups.google.com/group/bbedit.

Re: HTML5 support

[Bruce Linde]

uhm... methinks he has a point... the html5 doctype is there for me under 
the markup menu, but not off of the html palette... version 12.1 (410021, 
64-bit)














On Tuesday, January 23, 2018 at 2:52:16 PM UTC-8, Greg Raven wrote:
>
> What version of BBEdit are you using? The HTML5 option has been there 
> forever.
>
>
>
> On Tuesday, January 23, 2018 at 9:22:40 AM UTC-8, Robert wrote:
>>
>> On Thursday, January 18, 2018 at 10:48:35 PM UTC-5, Greg Raven wrote:
>>>
>>> I have created and/or manage tens of thousands of HTML pages using 
>>> HTML5. What is it you think is missing?
>>>
>>
>> If you create a new document from the palette there is an HTML5 document 
>>  type. However, there is no "HTML5" doctype under the "Doc Type" option. So 
>> that at least inconsistent.
>>
>> Also, based on on your other answer. I did not mean there was NO support 
>> for HTML5. I've been playing around more and things work for HTML5 like 
>> "Check Syntax".
>>
>> -- 
>> Bob
>>
>

-- 
This is the BBEdit Talk public discussion group. If you have a 
feature request or would like to report a problem, please email
"supp...@barebones.com" rather than posting to the group.
Follow @bbedit on Twitter: 
--- 
You received this message because you are subscribed to the Google Groups 
"BBEdit Talk" group.
To unsubscribe from this group and stop receiving emails from it, send an email 
to bbedit+unsubscr...@googlegroups.com.
To post to this group, send email to bbedit@googlegroups.com.
Visit this group at https://groups.google.com/group/bbedit.

just another 'god, i love bbedit' comment... commented

[Bruce Linde]

just working in some css, and was thinking "man, it would be great if 
bbedit's commenting functionality were context sensitive and knew i was 
working in css so i didn't have to comment manually. i had never tried it 
before so i did... and voila! how do i love bbedit? let me count the ways...

note: commenting in HERETO blocks in php is still not perfect, but still... 
  8-)




-- 
This is the BBEdit Talk public discussion group. If you have a 
feature request or would like to report a problem, please email
"supp...@barebones.com" rather than posting to the group.
Follow @bbedit on Twitter: 
--- 
You received this message because you are subscribed to the Google Groups 
"BBEdit Talk" group.
To unsubscribe from this group and stop receiving emails from it, send an email 
to bbedit+unsubscr...@googlegroups.com.
To post to this group, send email to bbedit@googlegroups.com.
Visit this group at https://groups.google.com/group/bbedit.

Re: Working with a directory view, can I show hidden files?

[Bruce Linde]

patrick -

is this per project? is there a way to make it a global setting? the manual 
seems to imply per project...

bruce





On Friday, March 31, 2017 at 6:21:09 AM UTC-7, Patrick Woolsey wrote:
>
> Please see pages 67 & 196 of the (current) PDF manual, which you 
> can open at any time via Help -> User Manual. :-) 
>
> Regards, 
>
>   Patrick Woolsey 
> == 
> Bare Bones Software, Inc.  
>
>
>
> On 3/30/17 at 12:09 AM, do...@donnamcmaster.com  (Donna 
> McMaster) wrote: 
>
> >Thanks! I sure wish this information was in the documentation! :) 
> >On Wednesday, August 19, 2015 at 6:57:51 AM UTC-7, Patrick Woolsey wrote: 
> >> 
> >>On 8/18/15 at 7:37 PM, goo...@kwaping.com  
> >>(Kwaping) wrote: 
> >>>I like to open directories in BBEdit. Sometimes those 
> >>>directories have hidden files or folders in them (aka 
> >>>dotfiles). Is there a way I can tell the directory view 
> >>>window to show these dotfiles? I couldn't find anything via 
> >>>searching the manual. 
> >> 
> >> 
> >>Yup :-), you can make BBEdit display _all_ files within a 
> >>project's file list, including invisibles, by clicking the 
> >>magnifying glass at the bottom of the list (aka the Filter 
> >>popup) and selecting the "Everything" option. 
> >> 
> >>Regards, 
> >>Patrick Woolsey == Bare Bones Software, Inc. <
> http://www.barebones.com/> 
> >> 
> > 
>
>

-- 
This is the BBEdit Talk public discussion group. If you have a 
feature request or would like to report a problem, please email
"supp...@barebones.com" rather than posting to the group.
Follow @bbedit on Twitter: 
--- 
You received this message because you are subscribed to the Google Groups 
"BBEdit Talk" group.
To unsubscribe from this group and stop receiving emails from it, send an email 
to bbedit+unsubscr...@googlegroups.com.
To post to this group, send email to bbedit@googlegroups.com.
Visit this group at https://groups.google.com/group/bbedit.

Re: Unindicted co-conspirators

[Bruce Linde]

here's the list i see... which includes me. of course, i paid pat $500 for 
the privilege...

*unindicted co-conspirators*

Mike Cote

Kerri Hicks

Michael Kahl

John McEnerney

bruce linde







On Friday, March 10, 2017 at 5:16:49 PM UTC-8, Nestor Aguilera wrote:
>
> With the new release of BBEdit, I noticed that I am an "unindicted 
> co-conspirator". 
>
> I don't know for how long I have held that position, but my sincere 
> thanks--and laughs--for the distinguished title to the wonderful people who 
> do the real work. 
>
> It is really nice to belong to this group. 
>
> All the best, 
>
> Nestor

-- 
This is the BBEdit Talk public discussion group. If you have a 
feature request or would like to report a problem, please email
"supp...@barebones.com" rather than posting to the group.
Follow @bbedit on Twitter: <http://www.twitter.com/bbedit>
--- 
You received this message because you are subscribed to the Google Groups 
"BBEdit Talk" group.
To unsubscribe from this group and stop receiving emails from it, send an email 
to bbedit+unsubscr...@googlegroups.com.
To post to this group, send email to bbedit@googlegroups.com.
Visit this group at https://groups.google.com/group/bbedit.

Re: "Saved State" problem: BBEdit 11.6.4 is re-opening 2 copies of each window

[Bruce Linde]

support questions should go directly to supp...@barebones.com... they're 
quite responsive and will take care of you.

this forum is for tips, tricks, how-tos, etc.:


*This is the BBEdit Talk public discussion group. If you have a *
*feature request or would like to report a problem, please email*
*"supp...@barebones.com " rather than posting to the 
group.*








On Wednesday, March 1, 2017 at 6:21:26 PM UTC-8, Michelle wrote:
>
> Hello, 
>
> Since updating from 11.6.3 to 11.6.4, BBEdit now opens two (2) copies of 
> each window that was open at the time that the application was last closed. 
>  I have trashed the "com.barebones.bbedit.savedState" folder, but that did 
> not fix the problem.  Please advise.
>
> Thanks!
>

-- 
This is the BBEdit Talk public discussion group. If you have a 
feature request or would like to report a problem, please email
"supp...@barebones.com" rather than posting to the group.
Follow @bbedit on Twitter: 
--- 
You received this message because you are subscribed to the Google Groups 
"BBEdit Talk" group.
To unsubscribe from this group and stop receiving emails from it, send an email 
to bbedit+unsubscr...@googlegroups.com.
To post to this group, send email to bbedit@googlegroups.com.
Visit this group at https://groups.google.com/group/bbedit.

Re: How to Undo Multi-File Find and Replace

[Bruce Linde]

got backups?






On Sunday, February 26, 2017 at 2:09:35 PM UTC-8, Tom Robinson wrote:
>
> That was my thought, but looks like OP managed to change text which varied 
> for each link, to a fixed string in all the files :[ 
>
>
> > On 2017-02-27, at 10:39, Jean-Christophe Helary <
> jean.christ...@gmail.com > wrote: 
> > 
> > You can use a regex to fix the broken links :) There's plenty of hope. 
> > 
> > Now what it the pattern of those broken links ? 
>
>

-- 
This is the BBEdit Talk public discussion group. If you have a 
feature request or would like to report a problem, please email
"supp...@barebones.com" rather than posting to the group.
Follow @bbedit on Twitter: 
--- 
You received this message because you are subscribed to the Google Groups 
"BBEdit Talk" group.
To unsubscribe from this group and stop receiving emails from it, send an email 
to bbedit+unsubscr...@googlegroups.com.
To post to this group, send email to bbedit@googlegroups.com.
Visit this group at https://groups.google.com/group/bbedit.

Re: Customer post: How to quickly create html form-fields via grep search & replace

[Bruce Linde]

here are some canned/stored grep patterns i use all the time... i have a 
bunch. all of the ones related to forms start with FORMS:, all of the one 
related to php start with PHP:, etc.



FORMS: generate radio buttons
   USAGE: any amount of field names, one per line. select all and then 
REPLACE ALL - selection only
   FIND: ^([^\r]+)\r
   REPLACE ALL:  Yes\r No\r\r

SUCH AS:
do i love bbedit?
could i imagine using any other program than bbedit?
where's my winning lottery ticket already?!?!?

WHICH RESULTS IN:

 Yes
 No

 Yes
 No

 Yes
 No





FORMS: init post vars from a list of field names
   USAGE: any amount of field names, one per line. select all and then 
REPLACE ALL - selection only
   FIND: ^([^\r]+)\r
   REPLACE ALL: \tif ( isset($_POST['\1']) ) {\r\t\t$\1 = 
$_POST['\1'];\r\t} else {\r\t\t$\1 = "";\r\t}\r\r

SUCH AS:
wombat
toaster_oven
lumbago

WHICH RESULTS IN:

if ( isset($_POST['wombat']) ) {
$wombat = $_POST['wombat'];
} else {
$wombat = "";
}

if ( isset($_POST['toaster_oven']) ) {
$toaster_oven = $_POST['toaster_oven'];
} else {
$toaster_oven = "";
}

if ( isset($_POST['lumbago']) ) {
$lumbago = $_POST['lumbago'];
} else {
$lumbago = "";
}






FORMS: init post AND session vars from a list of field names
   USAGE: any amount of field names, one per line. select all and then 
REPLACE ALL - selection only
   FIND: ^(.+)\r
   REPLACE ALL: \t$the_\1 = $_POST['\1'];\r\t\t$_SESSION['\1'] = \$the_\1;\r

SUCH AS:
wombat
toaster_oven
lumbago

WHICH RESULTS IN:

$the_wombat = $_POST['wombat'];
$_SESSION['wombat'] = $the_wombat;
$the_toaster_oven = $_POST['toaster_oven'];
$_SESSION['toaster_oven'] = $the_toaster_oven;
$the_lumbago = $_POST['lumbago'];
$_SESSION['lumbago'] = $the_lumbago;








On Thursday, February 23, 2017 at 11:53:14 AM UTC-8, Patrick Woolsey wrote:
>
> Good afternoon folks, 
>
> We just heard from a customer who's written a handy tutorial 
> about creating HTML form fields using BBEdit, so I'm posting a 
> link here for anyone who may find this helpful: 
>
> How to quickly create html form-fields using BBEdit’s GREP 
> search and replace function -- by Ole Kristian Ek Hornnes: 
>
> <
> https://tech.humlesite.eu/2017/02/21/how-to-quickly-create-html-form-fields-using-bbedits-grep-search-and-replace-function/>
>  
>
>
>
> Regards, 
>
>   Patrick Woolsey 
> == 
> Bare Bones Software, Inc.  
>
>

-- 
This is the BBEdit Talk public discussion group. If you have a 
feature request or would like to report a problem, please email
"supp...@barebones.com" rather than posting to the group.
Follow @bbedit on Twitter: 
--- 
You received this message because you are subscribed to the Google Groups 
"BBEdit Talk" group.
To unsubscribe from this group and stop receiving emails from it, send an email 
to bbedit+unsubscr...@googlegroups.com.
To post to this group, send email to bbedit@googlegroups.com.
Visit this group at https://groups.google.com/group/bbedit.

Re: Sidebar: Project Folder Collapse All?

['Bruce Linde' via BBEdit Talk]

i keep all of my client folders in Sites. i will create a new project in a 
client folder, and then drag the enclosing folder ( i.e., Sites/client.com/ 
 ) into the sidebar to add everything to the project.

from there, just toggling the top level/enclosing client.com folder in the 
sidebar will collapse everything. the cool part is that you can open 
sub-folders and work away, but when you need to quickly start over 
collapsing that top folder will re-collapse (new word!) the sub-folders as 
well... and you can just start over.




On Saturday, January 21, 2017 at 9:25:06 AM UTC-8, Kyle David wrote:
>
> Hello- I have a large group of directories and subdirectories within a 
> project that requires drilling down a bit.
> When I open the project it seems that many of the folders are unfolded 
> making navigation cumbersome,
> How do I collapse or fold all the folders?
>
> Thanks!
>

-- 
This is the BBEdit Talk public discussion group. If you have a 
feature request or would like to report a problem, please email
"supp...@barebones.com" rather than posting to the group.
Follow @bbedit on Twitter: 
--- 
You received this message because you are subscribed to the Google Groups 
"BBEdit Talk" group.
To unsubscribe from this group and stop receiving emails from it, send an email 
to bbedit+unsubscr...@googlegroups.com.
To post to this group, send email to bbedit@googlegroups.com.
Visit this group at https://groups.google.com/group/bbedit.

Re: Regex to find blank lines and lines with only spaces

['Bruce Linde' via BBEdit Talk]

your first expression says find all blank lines or those containing only 
white space

your second expression says find all lines containing at least one or more 
(specified by the plus sign) white space characters. you've specifically 
told it to ignore empty lines that do not contain at least one white space 
character.





On Monday, January 9, 2017 at 7:27:20 AM UTC-8, Mike Pullen wrote:
>
> 1. This regular expression works in BBEdit to find all blank lines and all 
> lines containing only whitespace:   ^\n|^\s+\n
>
>
> 2. However, this regular expression does not find all of those same lines: 
>  ^\s+$
>
>
> I've attached the file (test.txt) that I am using to test both regex's.
>
>
> I would like to understand why the second regex doesn't work.
>
>
> Help, please.
>
>
> Thanks.
>
>
>
>
>
>

-- 
This is the BBEdit Talk public discussion group. If you have a 
feature request or would like to report a problem, please email
"supp...@barebones.com" rather than posting to the group.
Follow @bbedit on Twitter: 
--- 
You received this message because you are subscribed to the Google Groups 
"BBEdit Talk" group.
To unsubscribe from this group and stop receiving emails from it, send an email 
to bbedit+unsubscr...@googlegroups.com.
To post to this group, send email to bbedit@googlegroups.com.
Visit this group at https://groups.google.com/group/bbedit.

Re: Red "Evaluation Ended" text

['Bruce Linde' via BBEdit Talk]

joshua -

you're (obviously) not a 'terrible person'... but please do note the 
incredible loyalty to barebones and bbedit from us long-time 
users/supporters.

don't need the additional features offered by bbedit and can get by with 
text wrangler? vaya con dios, hermano.

on the other hand, if you want (need?) the full monty offered by bbedit, 
you'd get a big bang for the buck.

for a complete comparison of what each app offers, please see: 
https://goo.gl/A3gu1

fyi... i've built hundred of websites using bbedit and do all of my coding 
(mostly php), craigslist ads, whatever using the app... even so, i'm sure i 
don't use a lot of the functionality it offers... kind of like having a 
ferrari and only using it to drive to the safeway a mile and a half away... 
but it's an awesome ride!   8-)

you didn't say what you're using the app(s) for, but it might help inform 
the discussion.

and... sorry we all jumped on you!














On Wednesday, December 14, 2016 at 2:44:08 PM UTC-8, Joshua Root wrote:
>
> On Thursday, 15 December 2016 07:52:15 UTC+11, Rich Siegel wrote:
>>
>> On Wednesday, December 14, 2016, Joshua Root 
>>  wrote: 
>>
>> >Would it be possible to stop this being shown in the title bar 
>> >of every window? It's annoying enough to make me want to switch 
>> >back to TextWrangler. 
>>
>> Is there a specific functional issue that you're having with this? 
>>
>
> The red draws the eye and suggests that there is cause for alarm.
>  
>
>> >It would also be nice to be able to just hide all the unusable 
>> >menu items starting with "Upgrade". 
>>
>> You can use the "Menus & Shortcuts" preferences to hide any menu 
>> commands that you don't ever use. 
>>
>  
> Thanks, that's very helpful.
>
> As for everyone else: OK, I get it, I'm a terrible person for using 
> TextWrangler instead of buying BBEdit. I just read that BBEdit in 
> unregistered mode would be replacing TextWrangler, and this was a 
> noticeable difference between the two.
>

-- 
This is the BBEdit Talk public discussion group. If you have a 
feature request or would like to report a problem, please email
"supp...@barebones.com" rather than posting to the group.
Follow @bbedit on Twitter: 
--- 
You received this message because you are subscribed to the Google Groups 
"BBEdit Talk" group.
To unsubscribe from this group and stop receiving emails from it, send an email 
to bbedit+unsubscr...@googlegroups.com.
To post to this group, send email to bbedit@googlegroups.com.
Visit this group at https://groups.google.com/group/bbedit.

Re: Red "Evaluation Ended" text

['Bruce Linde' via BBEdit Talk]

absolutely... cough up $50. bbedit is not a free app. there is a 30-day 
evaluation, after which you have the choice of paying for it or living with 
upgrade/evaluation messages. either way, you get to use the ultimate 
text/coding power tool... but there's always a choice. if you don't like 
the ones bbedit offers, you could go back to text wrangler... but bbedit 
(essentially) pays my mortgage, and has done so for a very long time. i'm 
thrilled to support barebones and bbedit.




On Wednesday, December 14, 2016 at 10:15:55 AM UTC-8, Joshua Root wrote:
>
> Would it be possible to stop this being shown in the title bar of every 
> window? It's annoying enough to make me want to switch back to 
> TextWrangler. It would also be nice to be able to just hide all the 
> unusable menu items starting with "Upgrade".
>

-- 
This is the BBEdit Talk public discussion group. If you have a 
feature request or would like to report a problem, please email
"supp...@barebones.com" rather than posting to the group.
Follow @bbedit on Twitter: 
--- 
You received this message because you are subscribed to the Google Groups 
"BBEdit Talk" group.
To unsubscribe from this group and stop receiving emails from it, send an email 
to bbedit+unsubscr...@googlegroups.com.
To post to this group, send email to bbedit@googlegroups.com.
Visit this group at https://groups.google.com/group/bbedit.

Re: Use BBEdit to update several hundred rows in a 3 column table?

['Bruce Linde' via BBEdit Talk]

i'm confused... although bbedit can easily help you accomplish what you're 
trying to accomplish why do you need different exports? if you just create 
one export that has:

   part number|description|price_wholesale|price_retail

all of the required info would already by there... you would then only have 
to have you php code pick and choose which fields to use/display.

$lines = file("my_fmpDB_export.tab");
foreach ( $lines as $the_line ) {
$this_one = explode("\t",$the_line);
$this_part_number = $the_line[0];
$this_description = $the_line[1];
$this_price_wholesale = $the_line[2];
$this_price_retail = $the_line[3];
// generate/display some dynamic php here
}
wouldn't that address all of your needs? one exported .tab file parsed on 
the fly by your php?

 it sounds to me like you're describing a php thing and not a bbedit thing. 
what am i missing?








On Monday, December 12, 2016 at 9:18:01 AM UTC-8, Peter White wrote:
>
> I use a Filemaker Pro database in my business. We use all Macs with macOS. 
> I need to send out a spreadsheet from time to time with wholesale prices to 
> some customers, and keep my website current with retail prices. I export a 
> .tab file from the database to a spreadsheet .xlsx that has several 
> columns; part numbers, descriptions, wholesale and retail prices. I can 
> email this spreadsheet to wholesale customers. Then, from Excel I want to 
> export to .html to post on the website after converting to a .php file.
>
> The .php file will look up prices in another .tab file on the website. 
> That file is just a table with part numbers and retail prices for 
> everything I sell. I can update the prices on that file from time to time 
> as needed just by creating a new one from the database.
>
> The .php file people will see on the web site will have three columns 
> displayed on the website; Part number, description and retail price. I'm 
> hoping I can use BBEdit to copy the part number from the first column into 
> the .php code in the third column. That way, when I update prices in my 
> database I can easily update both the wholesale price list spreadsheet, and 
> the .php web pages. When I look at the code on file to be published on the 
> web, I want to see only the .php code and the part number in the third 
> column of the table. I should only see the retail price in that column when 
> it's viewed in the web browser.
>
> The problem is, I'm reading the BBEdit manual about grep and my head 
> starts to spin. So I'm hoping that someone here can point me to a quick and 
> easy bit of code that will do the job.
>
> Thank you,
>
> Peter White
> Hillsborough, NH
> USA
>

-- 
This is the BBEdit Talk public discussion group. If you have a 
feature request or would like to report a problem, please email
"supp...@barebones.com" rather than posting to the group.
Follow @bbedit on Twitter: 
--- 
You received this message because you are subscribed to the Google Groups 
"BBEdit Talk" group.
To unsubscribe from this group and stop receiving emails from it, send an email 
to bbedit+unsubscr...@googlegroups.com.
To post to this group, send email to bbedit@googlegroups.com.
Visit this group at https://groups.google.com/group/bbedit.

Re: Sort email addresses by domain name...

[Bruce Linde]

fletcher -

you have to be effing kidding... if i had a dollar for every time i've 
opened that sort dialog and never realized i could do this, i'd be stinkin' 
rich.

who was it who said "RTFM"?!?!?!?!   8-)

thank you

bruce



p.s.: good to get my 'what a dork i am!' moment of the day out of the way 
early...8-)







On Wednesday, July 6, 2016 at 10:33:54 AM UTC-7, flet...@cumuli.com wrote:
>
> Choose Sort Lines... from the Text menu and check the Sort by Pattern 
> option with the following Searching Pattern and the Entire Match sub-option.
>
> @.*
>
> Hope this helps,
>
> [fletcher]
>
> On Jul 6, 2016, at 8:53 AM, DrBoBo  
> wrote:
>
> How does one sort email addresses by domain name?
>
> -- 
> This is the BBEdit Talk public discussion group. If you have a 
> feature request or would like to report a problem, please email
> "sup...@barebones.com " rather than posting to the group.
> Follow @bbedit on Twitter: 
>
> --- 
> You received this message because you are subscribed to the Google Groups 
> "BBEdit Talk" group.
> To unsubscribe from this group and stop receiving emails from it, send an 
> email to bbedit+un...@googlegroups.com .
> To post to this group, send email to bbe...@googlegroups.com 
> .
>
>
>

-- 
This is the BBEdit Talk public discussion group. If you have a 
feature request or would like to report a problem, please email
"supp...@barebones.com" rather than posting to the group.
Follow @bbedit on Twitter: 

--- 
You received this message because you are subscribed to the Google Groups 
"BBEdit Talk" group.
To unsubscribe from this group and stop receiving emails from it, send an email 
to bbedit+unsubscr...@googlegroups.com.
To post to this group, send email to bbedit@googlegroups.com.

Re: How does one preview anything?

[Bruce Linde]

under the markup menu you will find several 'preview' options.

pls note that if you're trying to preview a .php page you'll need to have 
php running, create a project and run it through apache... 

i've got command+control+p set to preview, and must hit that keyboard 
equiv. dozens of times each day.

b







On Thursday, April 28, 2016 at 5:21:10 PM UTC-7, Richard Cook wrote:
>
> The 'preview command' is referenced a lot but I cannot find said command. 
>
> How is this done?
>
> R
>

-- 
This is the BBEdit Talk public discussion group. If you have a 
feature request or would like to report a problem, please email
"supp...@barebones.com" rather than posting to the group.
Follow @bbedit on Twitter: 

--- 
You received this message because you are subscribed to the Google Groups 
"BBEdit Talk" group.
To unsubscribe from this group and stop receiving emails from it, send an email 
to bbedit+unsubscr...@googlegroups.com.
To post to this group, send email to bbedit@googlegroups.com.

Re: Inverted question marks and carriage returns

[Bruce Linde]

exactly. because bbedit does such a great job of handling this in the 
background, i had no idea one could have an inconsistent mix of line 
returns... or that that was the cause of the red questions marks... or that 
there was a simple menu item for dealing with same.













On Monday, April 18, 2016 at 3:50:01 PM UTC-7, Tom Robinson wrote:
>
> I realise sarcasm is engaged, but BBEdit does normally handle line breaks 
> transparently, so there’s probably an inconsistent mixture in those docs. 
>
> Cheers 
>
>
> > On 2016-04-19, at 03:44, Bruce Linde <bli...@5happy.com > 
> wrote: 
> > 
> > why is it on us to RTFM? why can't bbedit just 'know' when line returns 
> need normalizing, and automatically take care of it? for that matter, why 
> can't bbedit figure out why my code doesn't work? or why i have to pay 
> property taxes? or why i lost that particular eBay auction? 
>

-- 
This is the BBEdit Talk public discussion group. If you have a 
feature request or would like to report a problem, please email
"supp...@barebones.com" rather than posting to the group.
Follow @bbedit on Twitter: <http://www.twitter.com/bbedit>

--- 
You received this message because you are subscribed to the Google Groups 
"BBEdit Talk" group.
To unsubscribe from this group and stop receiving emails from it, send an email 
to bbedit+unsubscr...@googlegroups.com.
To post to this group, send email to bbedit@googlegroups.com.

Re: Inverted question marks and carriage returns

[Bruce Linde]

are you kidding me? 'normalize line endings'?

i thought SOP was "try a bunch of encodings only to find that none of them 
work. then try to copy and paste the upside-down question marks into the 
search and replace dialog box only to find that they paste in as a line 
return or nothing. beat head on wall. view source in a browser and then 
copy and paste the source into a new document."

why is it on us to RTFM? why can't bbedit just 'know' when line returns 
need normalizing, and automatically take care of it? for that matter, why 
can't bbedit figure out why my code doesn't work? or why i have to pay 
property taxes? or why i lost that particular eBay auction?

seriously... just another great feature i never noticed before... but 
needed. and now have.

thanks (as always) for a rockin' app.







On Monday, April 18, 2016 at 5:37:45 AM UTC-7, Patrick Woolsey wrote:
>
> On 4/17/16 at 5:33 PM, chi...@gmail.com  (Gary Chike) wrote: 
>
> >Hi everyone, 
> >I noticed that when I save an HTML file in other editors like 
> >Espresso or Chocolat and open that file in BBedit, the carriage 
> >returns are replaced with red inverted question marks. TextMate 
> >shows "" everywhere in the same file. Interestingly enough, 
> >when I save the same file in Sublime Text or Flux 6, the red 
> >inverted question marks disappear and the formatting returns to 
> >normal in both BBedit and TextMate. Any thoughts? 
>
>
> Since such a file almost certainly contains mixed line endings, 
> please choose Text -> Normalize Line Endings, then save the 
> file, and it should display correctly everywhere. 
>
>
> Regards, 
>
>   Patrick Woolsey 
> == 
> Bare Bones Software, Inc.  
>
>
>

-- 
This is the BBEdit Talk public discussion group. If you have a 
feature request or would like to report a problem, please email
"supp...@barebones.com" rather than posting to the group.
Follow @bbedit on Twitter: 

--- 
You received this message because you are subscribed to the Google Groups 
"BBEdit Talk" group.
To unsubscribe from this group and stop receiving emails from it, send an email 
to bbedit+unsubscr...@googlegroups.com.
To post to this group, send email to bbedit@googlegroups.com.

Re: Problem with "Multi-File Search" results

[Bruce Linde]

michelle -

as good as barebones is as anticipating the needs of the majority of their 
customers, you have to admit that this is a bit of an unusual situation. it 
is far more likely that filenames will end with .php or .html, etc.

either way, this is (IMHO) more of a feature request than a bug report... 
yes, it doesn't work as expected (for you). yes, it would be cool if the 
results window sorted your files the way you want it to. in my experience 
the guys are responsive, and will tell you right up front whether your 
request is going to happen or whether there are reasons why it probably 
won't.

it sounds like this is something you deal with all the time... is it? what 
is kicking out text files with that particular naming convention? i usually 
append a number to the filename and then add a .txt file extension... but i 
supposed 'filename_10.txt' and 'filename_1.txt' might exhibit the same sort 
wonkiness you're reporting.

email support... and pls share their response.

good luck,
bruce















On Thursday, April 7, 2016 at 10:22:50 AM UTC-7, Kerri Hicks wrote:
>
> Have you tried sending an email to sup...@barebones.com ? If 
> there's a setting, they'll know. If there's not, you can make a feature 
> request. They actually answer emails. It's kind of remarkable. :-)
>
> --Kerri
>
> On Thu, Apr 7, 2016 at 12:51 PM, Michelle  > wrote:
>
>> Anyone? 
>>
>> -- 
>> This is the BBEdit Talk public discussion group. If you have a 
>> feature request or would like to report a problem, please email
>> "sup...@barebones.com " rather than posting to the group.
>> Follow @bbedit on Twitter: 
>>
>> --- 
>> You received this message because you are subscribed to the Google Groups 
>> "BBEdit Talk" group.
>> To unsubscribe from this group and stop receiving emails from it, send an 
>> email to bbedit+un...@googlegroups.com .
>> To post to this group, send email to bbe...@googlegroups.com 
>> .
>>
>
>

-- 
This is the BBEdit Talk public discussion group. If you have a 
feature request or would like to report a problem, please email
"supp...@barebones.com" rather than posting to the group.
Follow @bbedit on Twitter: 

--- 
You received this message because you are subscribed to the Google Groups 
"BBEdit Talk" group.
To unsubscribe from this group and stop receiving emails from it, send an email 
to bbedit+unsubscr...@googlegroups.com.
To post to this group, send email to bbedit@googlegroups.com.

Re: BBEdit - Wacom Table Bug

[Bruce Linde]

it may be irritating, but if it's a bug it should be reported directly to 
supp...@barebones.com. i have found the guys wonderfully responsive and 
helpful.

fyi, i have a wacom tablet and am experiencing nothing but joy with bbedit.






On Friday, March 4, 2016 at 6:24:15 AM UTC-8, BB wrote:
>
> There is a bug now where BBEdit will scroll an open document up a few 
> lines whenever the Wacom pen is brought within proximity of the table. 
> without clicking or tapping. just automatically. take the pen away from the 
> table, then bring it over and close and the document will scroll up a few 
> lines. totally irritaing and this just started with the latest BBEdit 
> update as far as I can tell?
>
> What is being done about this? Is it being looked into?
>

-- 
This is the BBEdit Talk public discussion group. If you have a 
feature request or would like to report a problem, please email
"supp...@barebones.com" rather than posting to the group.
Follow @bbedit on Twitter: 

--- 
You received this message because you are subscribed to the Google Groups 
"BBEdit Talk" group.
To unsubscribe from this group and stop receiving emails from it, send an email 
to bbedit+unsubscr...@googlegroups.com.
To post to this group, send email to bbedit@googlegroups.com.

Re: Open Document window position

[Bruce Linde]

 Dude… The application rocks. The developers are responsive. The user support 
each other. Lose the adversarial tone.

-- 
This is the BBEdit Talk public discussion group. If you have a 
feature request or would like to report a problem, please email
"supp...@barebones.com" rather than posting to the group.
Follow @bbedit on Twitter: 

--- 
You received this message because you are subscribed to the Google Groups 
"BBEdit Talk" group.
To unsubscribe from this group and stop receiving emails from it, send an email 
to bbedit+unsubscr...@googlegroups.com.
To post to this group, send email to bbedit@googlegroups.com.

Re: Word wrap

[bruce linde]

chris -

check the ‘help’ menu and download the user manual (if you haven’t already).

you’re looking for ‘soft wrap’… also available in the top of your documents.

good luck!

bruce










> On Dec 2, 2015, at 12:38 PM, Chris Johnston <pctec...@gmail.com> wrote:
> 
> How do you do word wrap in BBEdit? Is Hard Wrap that I see in menu the same 
> thing? Does word wrap in BBEdit have somethig to do with the page line I see 
> running down my page. If not what is the line or area I am referring to? 
> Thanks for any help.
> 
> -- 
> This is the BBEdit Talk public discussion group. If you have a 
> feature request or would like to report a problem, please email
> "supp...@barebones.com" rather than posting to the group.
> Follow @bbedit on Twitter: <http://www.twitter.com/bbedit 
> <http://www.twitter.com/bbedit>>
> 
> --- 
> You received this message because you are subscribed to the Google Groups 
> "BBEdit Talk" group.
> To unsubscribe from this group and stop receiving emails from it, send an 
> email to bbedit+unsubscr...@googlegroups.com 
> <mailto:bbedit+unsubscr...@googlegroups.com>.
> To post to this group, send email to bbedit@googlegroups.com 
> <mailto:bbedit@googlegroups.com>.





bruce linde
5 happiness webmaster (four more than the competition!)
http://www.5happy.com/ <http://www.5happy.com/>
http://www.5happy.com/blahg <http://www.5happy.com/blahg>
510.530.1331 office (and best place to leave messages)
510.206.9730 mobile

(shift key available upon request)


"a man with a clock always knows the time. a man with two clocks is never sure."






-- 
This is the BBEdit Talk public discussion group. If you have a 
feature request or would like to report a problem, please email
"supp...@barebones.com" rather than posting to the group.
Follow @bbedit on Twitter: <http://www.twitter.com/bbedit>

--- 
You received this message because you are subscribed to the Google Groups 
"BBEdit Talk" group.
To unsubscribe from this group and stop receiving emails from it, send an email 
to bbedit+unsubscr...@googlegroups.com.
To post to this group, send email to bbedit@googlegroups.com.

Re: Control Window Size when Opening a Document

[Bruce Linde]

douglas -

i have the same setup.

i use dragthing and the following two applescripts for when i’m desk-bound 
or mobile.

please note that there are no doubt more elegant/simple ways to do this… my 
coding philosophy has always been ‘hey, it works… STFU!  8-)'

btw… the scripts position all of my windows so i can reconfigure my 
environment with one click… happy to share other code chunks if you’re 
interested… bli...@5happy.com

bruce




when plugged into apple 27 monitor...


tell application System Events
tell process BBEdit
repeat with x from 1 to (count windows)
set this_name to (name of window x) as text
--display dialog this_name
if this_name is not Utilities and this_name is not HTML Tools and 
this_name is not Windows and this_name is not Entities and this_name is 
not CSS and this_name is not Find and this_name is not Multi-File 
Search and this_name is not BBEdit Preferences and this_name is not 
System Events and this_name is not Clippings then
tell window x
set position to {135, 21}
set size to {1372, 1078}
end tell
end if
if this_name is HTML Tools then
tell window x
set position to {-500, 321}
end tell
end if
end repeat
end tell




when mobile... when just on mbp


tell application BBEdit to activate
tell application System Events
tell process BBEdit
repeat with x from 1 to (count windows)
set this_name to (name of window x) as text
--display dialog this_name
if this_name is not Utilities and this_name is not HTML Tools and 
this_name is not Windows and this_name is not Entities and this_name is 
not CSS and this_name is not Find and this_name is not Multi-File 
Search and this_name is not BBEdit Preferences and this_name is not 
System Events and this_name is not Clippings then
tell window x
set position to {11, 21}
set size to {1200, 975}
end tell
end if
end repeat
end tell
end tell










On Wednesday, August 26, 2015 at 4:49:22 PM UTC-7, Douglas von Roeder wrote:

 Using BBEdit 11.1.2 with a MacBook Pro and 27 iMac as an external 
 monitor. When opening a document, BBEdit opens it to the full height of the 
 iMac screen. If I want to move the window to my MBP, I have to manually 
 resize the window. 
 Is there a way to restrict the size of a window when it opens? 


-- 
This is the BBEdit Talk public discussion group. If you have a 
feature request or would like to report a problem, please email
supp...@barebones.com rather than posting to the group.
Follow @bbedit on Twitter: http://www.twitter.com/bbedit

--- 
You received this message because you are subscribed to the Google Groups 
BBEdit Talk group.
To unsubscribe from this group and stop receiving emails from it, send an email 
to bbedit+unsubscr...@googlegroups.com.
To post to this group, send email to bbedit@googlegroups.com.

Re: BBEdit 11.0.3 does not 'Ignore' or 'Learn' misspelled words

[Bruce Linde]

chris -

i had no idea that bbedit behaved any differently with larger files until 
my autocomplete stopped working on a current project file that is about 
1.5mb in size, with maybe 27k lines.

i'm not sure the expert pref i pointed out to michelle will fix her issue, 
but wanted to alert her/all who were unaware of app behavior changes 
depending on file size to that section of the expert prefs.

the MacDocumentLengthForCompletionTokenizer setting did fix my issue... i'm 
hoping the Editor_SpellCheckLengthLimit one might fix michelle's.

bruce













On Sunday, April 26, 2015 at 7:30:56 PM UTC-7, Christopher Stone wrote:

 On Apr 26, 2015, at 17:30, Bruce Linde bli...@5happy.com javascript: 
 wrote:

 Ok, just so no one confuses me with an expert bbedit user (or one who 
 actually rtfm)... i recently got bit by a similar problem when bbedit 
 stopped autocompleting variable names in a rather large .php script.

 I was led gently to the solution by patrick woolsey, who deserves full 
 credit for pointing me to the appropriate expert pref, which happens to be 
 adjacent to the one you need.

 __

 Hey Bruce,

 defaults write com.barebones.bbedit Editor_SpellCheckLengthLimit -int NN

 The documentation in the expert prefs help indicates this setting only 
 applies to the Find All Misspelled Words command.

 If I understand you correctly this is actually not so.

 Autocomplete is affected and other aspects of the spell-checker.

 If that is indeed the case then the documentation should be changed to 
 reflect this more overarching effect.  In my opinion.

 Examining the expert prefs a little further it appears that completion is 
 affected by a different setting:

- 

*Text completions* that depend on examining the document's contents 
(both for tokens in the document, and for possible completions from the 
system spelling checker) are now skipped when the document is above a 
certain size. The cutoff can be adjusted:

defaults write com.barebones.bbedit 
MaxDocumentLengthForCompletionTokenizer -int NN

where NN is some decimal value. Use -int 0 to suppress the limit 
altogether.

 Can you elaborate?

 --
 Best Regards,
 Chris



-- 
This is the BBEdit Talk public discussion group. If you have a 
feature request or would like to report a problem, please email
supp...@barebones.com rather than posting to the group.
Follow @bbedit on Twitter: http://www.twitter.com/bbedit

--- 
You received this message because you are subscribed to the Google Groups 
BBEdit Talk group.
To unsubscribe from this group and stop receiving emails from it, send an email 
to bbedit+unsubscr...@googlegroups.com.
To post to this group, send email to bbedit@googlegroups.com.

Re: BBEdit 11.0.3 does not 'Ignore' or 'Learn' misspelled words

[Bruce Linde]

michelle -

it's not broken... it's a feature. from bbedit help -- expert preferences:

Since Find All Misspelled Words is pretty much pointless on files over a 
certain size, the maximum amount of text checked by this command is limited 
to 1M (1024 squared) characters. This may be adjusted with an expert 
preference:

defaults write com.barebones.bbedit Editor_SpellCheckLengthLimit -int NN

where NN is some decimal value. Use -int 0 to suppress the limit 
altogether.


you would execute the 'defaults write... ' command from the command line 
using the 'terminal' app.

bruce






On Sunday, April 26, 2015 at 2:06:07 PM UTC-7, Michelle wrote:

 Hello,

 I am currently working with an 8.7 MB text file that contains over 150,000 
 Web page titles.  I am trying to correct all misspelled words.  In the 
 Spelling Panel, there are the following options:

 -
 Change
 Find Next
 Ignore
 Learn
 Define
 Guess
 -

 When trying to correct spelling throughout a large document, the Ignore 
 and Learn options are the most important because they are supposed to 
 prevent the user from having to deal with the same misspelled words 
 repeatedly.  However, the functionality is broken.  The Ignore and 
 Learn options simply do not work.  When I apply either one of those 
 options to a given misspelled word (such as a person's last name, 
 lower-case acronym, brand name, etc.), BBEdit does NOT remember.  The same 
 misspelled words continue to appear every time I click Find Next. 
  Therefore, it is taking me about 10 times longer than it could/should to 
 complete my task.

 Is there a solution to this problem?

 Thank you in advance for your help!

 Michelle


-- 
This is the BBEdit Talk public discussion group. If you have a 
feature request or would like to report a problem, please email
supp...@barebones.com rather than posting to the group.
Follow @bbedit on Twitter: http://www.twitter.com/bbedit

--- 
You received this message because you are subscribed to the Google Groups 
BBEdit Talk group.
To unsubscribe from this group and stop receiving emails from it, send an email 
to bbedit+unsubscr...@googlegroups.com.
To post to this group, send email to bbedit@googlegroups.com.

Re: BBEdit 11.0.3 does not 'Ignore' or 'Learn' misspelled words

[Bruce Linde]

ok, just so no one confuses me with an expert bbedit user (or one who 
actually rtfm)... i recently got bit by a similar problem when bbedit 
stopped autocompleting variable names in a rather large .php script.

i was led gently to the solution by patrick woolsey, who deserves full 
credit for pointing me to the appropriate expert pref, which happens to be 
adjacent to the one you need.

all hail patrick. all hail barebones. all hail bbedit.











On Sunday, April 26, 2015 at 3:16:48 PM UTC-7, Bruce Linde wrote:

 michelle -

 it's not broken... it's a feature. from bbedit help -- expert preferences:

 Since Find All Misspelled Words is pretty much pointless on files over a 
 certain size, the maximum amount of text checked by this command is limited 
 to 1M (1024 squared) characters. This may be adjusted with an expert 
 preference:

 defaults write com.barebones.bbedit Editor_SpellCheckLengthLimit -int NN

 where NN is some decimal value. Use -int 0 to suppress the limit 
 altogether.


 you would execute the 'defaults write... ' command from the command line 
 using the 'terminal' app.

 bruce






 On Sunday, April 26, 2015 at 2:06:07 PM UTC-7, Michelle wrote:

 Hello,

 I am currently working with an 8.7 MB text file that contains over 
 150,000 Web page titles.  I am trying to correct all misspelled words.  In 
 the Spelling Panel, there are the following options:

 -
 Change
 Find Next
 Ignore
 Learn
 Define
 Guess
 -

 When trying to correct spelling throughout a large document, the Ignore 
 and Learn options are the most important because they are supposed to 
 prevent the user from having to deal with the same misspelled words 
 repeatedly.  However, the functionality is broken.  The Ignore and 
 Learn options simply do not work.  When I apply either one of those 
 options to a given misspelled word (such as a person's last name, 
 lower-case acronym, brand name, etc.), BBEdit does NOT remember.  The same 
 misspelled words continue to appear every time I click Find Next. 
  Therefore, it is taking me about 10 times longer than it could/should to 
 complete my task.

 Is there a solution to this problem?

 Thank you in advance for your help!

 Michelle



-- 
This is the BBEdit Talk public discussion group. If you have a 
feature request or would like to report a problem, please email
supp...@barebones.com rather than posting to the group.
Follow @bbedit on Twitter: http://www.twitter.com/bbedit

--- 
You received this message because you are subscribed to the Google Groups 
BBEdit Talk group.
To unsubscribe from this group and stop receiving emails from it, send an email 
to bbedit+unsubscr...@googlegroups.com.
To post to this group, send email to bbedit@googlegroups.com.