[PHP] SimpleXMLElement and gb2312 or big5
I use the following code to get rss and parse it, but the code
occasionally have issues with gb2312 or big-5 encoded feeds, and fails to
parse them. However other times may appear just okay. Any thoughts? Maybe
SimpleXMLElement is simply not meant for other language encodings...
$page = file_get_contents($rss);
try {
$feed = new SimpleXMLElement($page);
--
PHP General Mailing List (http://www.php.net/)
To unsubscribe, visit: http://www.php.net/unsub.php
[PHP] SimpleXMLElement occasionally fails to parse gb2312 or big5 feeds
I use the following code to get rss and parse it, but the code
occasionally have issues with gb2312 or big-5 encoded feeds, and fails to
parse them. However other times may appear just okay. Any thoughts? Maybe
SimpleXMLElement is simply not meant for other language encodings...
$page = file_get_contents($rss);
try {
$feed = new SimpleXMLElement($page);
--
Using Opera's revolutionary e-mail client: http://www.opera.com/mail/
--
PHP General Mailing List (http://www.php.net/)
To unsubscribe, visit: http://www.php.net/unsub.php
Re: [PHP] Re: optimizing PHP for microseconds
That's impossible to answer given the brief layout of what you've described.
However, rule of thumb: optimizing for microseconds only makes sense
when the microseconds together make up a significant amount of time.
An example might be in order:
for ($i = 0; $i count($stuff); $i++)
{
// do other stuffs
}
The above loop is NOT optimal (as most people will tell you) because
you'll be doing a count() every loop. However, there's an enormous
difference between doing 100 counts and 1.000.000 counts. Microseconds
only count when there's enough of them to make up seconds.
The best thing to do is adopt the normal good coding standards: don't
using functions in loops like the above, for instance.
However, be skeptic about tips: single-quotes are not faster than
double-quotes, for instance.
Regards
Peter
On 29 March 2010 10:28, Bastien Helders eldroskan...@gmail.com wrote:
I have a question as a relatively novice PHP developper.
Let's say you have this Intranet web application, that deals with the
generation of file bundles that could become quite large (let say in the 800
MB) after some kind of selection process. It should be available to many
users on this Intranet, but shouldn't require any installation. Would it be
a case where optimizing for microseconds would be recommended? Or would PHP
not be the language of choice?
I'm not asking to prove that there could be corner case where it could be
useful, but I am genuinely interested as I am in the development of such a
project, and increasing the performance of this web application is one of my
goal.
2010/3/28 Nathan Rixham nrix...@gmail.com
mngghh, okay, consider me baited.
Daevid Vincent wrote:
Per Jessen wrote:
Tommy Pham wrote:
(I remember a list member, not mentioning his name, does optimization
of PHP coding for just microseconds. Do you think how much more he'd
benefit from this?)
Anyone who optimizes PHP for microseconds has lost touch with reality -
or at least forgotten that he or she is using an interpreted language.
But sometimes it's just plain fun to do it here on the list with
everyone further optimizing the last optimized snippet :)
Cheers,
Rob.
Was that someone me? I do that. And if you don't, then you're the kind of
person I would not hire (not saying that to sound mean). I use single
quotes instead of double where applicable. I use -- instead of ++. I use
$boolean = !$boolean to alternate (instead of mod() or other incrementing
solutions). I use LIMIT 1 on select, update, delete where appropriate.
I
use the session to cache the user and even query results. I don't use
bloated frameworks (like Symfony or Zend or Cake or whatever else tries
to
be one-size-fits-all). The list goes on.
That's not optimization, at best it's just an awareness of PHP syntax
and a vague awareness of how the syntax will ultimately be interpreted.
Using LIMIT 1 is not optimizing it's just saying you only want one
result returned, the SQL query could still take five hours to run if no
indexes, a poorly normalised database, wrong datatypes, and joins all
over the place.
Using the session to cache the user is the only thing that comes
anywhere near to application optimisation in all you've said; and
frankly I would take to be pretty obvious and basic stuff (yet pointless
in most scenario's where you have to cater for possible bans and
de-authorisations) - storing query results in a session cache is only
ever useful in one distinct scenario, when the results of that query are
only valid for the owner of the session, and only for the duration of
that session, nothing more, nothing less. This is a one in a million
scenario.
Bloated frameworks, most of the time they are not bloated, especially
when you use them properly and only include what you need on a need to
use basis; then the big framework can only be considered a class or two.
Sure the codebase seems more bloated, but at runtime it's easily
negated. You can use these frameworks for any size project, enterprise
included, provided you appreciated the strengths and weaknesses of the
full tech stack at your disposal. Further, especially on enterprise
projects it makes sense to drop development time by using a common
framework, and far more importantly, to have a code base developers know
well and can hit the ground running with.
Generally unless you have unlimited learning time and practically zero
budget constraints frameworks like the ones you mentioned should always
be used for large team enterprise applications, although perhaps
something more modular like Zend is suited. They also cover your own
back when you are the lead developer, because on the day when a more
experienced developer than yourself joins the project and points out all
your mistakes, you're going to feel pretty shite and odds are very high
that the project will go sour, get fully re-written or you'll have to
leave due to stress (of being
Re: [PHP] Allowing multiple, simultaneous, non-blocking queries.
Hi Richard At the end of discussion, the best bet for something that approaches a threaded version of multiple queries would be something like: 1. open connection to database 2. issue query using asynchronous call (mysql and postgresql support this, haven't checked the others) 3. pick up result when ready To get the threaded-ness, just open a connection per query you want to run asynchronous and pick it up when you're ready for it - i.e. iterate over steps 1-2, then do step 3 when things are ready. Regards Peter On 26 March 2010 12:45, Richard Quadling rquadl...@googlemail.com wrote: Hi. As I understand things, one of the main issues in the When will PHP grow up thread was the ability to issue multiple queries in parallel via some sort of threading mechanism. Due to the complete overhaul required of the core and extensions to support userland threading, the general consensus was a big fat No!. As I understand things, it is possible, in userland, to use multiple, non-blocking sockets for file I/O (something I don't seem to be able to achieve on Windows http://bugs.php.net/bug.php?id=47918). Can this process be leveraged to allow for non-blocking queries? Being able to throw out multiple non-blocking queries would allow for the queries in parallel issue. My understanding is that at the base level, all queries are running on a socket in some way, so isn't this facility nearly already there in some way? Regards, Richard. -- - Richard Quadling Standing on the shoulders of some very clever giants! EE : http://www.experts-exchange.com/M_248814.html EE4Free : http://www.experts-exchange.com/becomeAnExpert.jsp Zend Certified Engineer : http://zend.com/zce.php?c=ZEND002498r=213474731 ZOPA : http://uk.zopa.com/member/RQuadling -- PHP General Mailing List (http://www.php.net/) To unsubscribe, visit: http://www.php.net/unsub.php -- hype WWW: http://plphp.dk / http://plind.dk LinkedIn: http://www.linkedin.com/in/plind Flickr: http://www.flickr.com/photos/fake51 BeWelcome: Fake51 Couchsurfing: Fake51 /hype -- PHP General Mailing List (http://www.php.net/) To unsubscribe, visit: http://www.php.net/unsub.php
Re: [PHP] Will PHP ever grow up and have threading?
On 25 March 2010 19:37, Tommy Pham tommy...@gmail.com wrote: On Thu, Mar 25, 2010 at 3:55 AM, Per Jessen p...@computer.org wrote: Tommy Pham wrote: On Thu, Mar 25, 2010 at 1:46 AM, Per Jessen p...@computer.org wrote: * If you could implement threads and run those same queries in 2+ threads, the total time saved from queries execution is 1/2 sec or more, which is pass along as the total response time reduced. Is it worth it for you implement threads if you're a speed freak? Use mysqlnd - asynchronous mysql queries. You're assuming that everyone in the PHP world uses MySQL 4.1 or newer. What about those who don't? They don't get to use threading, nor asynchronous mysql queries. Come on, you're asking about a future feature in PHP 7.x , but would like to support someone who is seriously backlevel on mysql?? -- Per Jessen, Zürich (16.9°C) I'm not talking about MySQL 4.0 or older. I'm talking about other RDBMS. I think you should open your eyes a bit wider and take a look at the bigger picture (Firebird, MSSQL, Oracle, PostgreSQL, etc). http://www.php.net/manual/en/function.pg-send-query.php Looks to me like the PHP postgresql library already handles that. Not to mention: you're not presenting an argument for threads, you're presenting an argument for implementing asynchronous queries in the other DBMS libraries. Of course, the problem could also be solved by introducing threads in PHP. I'd personally guess modifying DBMS libraries would be less costly, but as I haven't been involved in writing the PHP code my guess isn't worth much. Regards Peter -- PHP General Mailing List (http://www.php.net/) To unsubscribe, visit: http://www.php.net/unsub.php -- hype WWW: http://plphp.dk / http://plind.dk LinkedIn: http://www.linkedin.com/in/plind Flickr: http://www.flickr.com/photos/fake51 BeWelcome: Fake51 Couchsurfing: Fake51 /hype -- PHP General Mailing List (http://www.php.net/) To unsubscribe, visit: http://www.php.net/unsub.php
Re: [PHP] Will PHP ever grow up and have threading?
On 25 March 2010 20:09, Tommy Pham tommy...@gmail.com wrote: On Thu, Mar 25, 2010 at 12:02 PM, Peter Lind peter.e.l...@gmail.com wrote: On 25 March 2010 19:37, Tommy Pham tommy...@gmail.com wrote: On Thu, Mar 25, 2010 at 3:55 AM, Per Jessen p...@computer.org wrote: Tommy Pham wrote: On Thu, Mar 25, 2010 at 1:46 AM, Per Jessen p...@computer.org wrote: * If you could implement threads and run those same queries in 2+ threads, the total time saved from queries execution is 1/2 sec or more, which is pass along as the total response time reduced. Is it worth it for you implement threads if you're a speed freak? Use mysqlnd - asynchronous mysql queries. You're assuming that everyone in the PHP world uses MySQL 4.1 or newer. What about those who don't? They don't get to use threading, nor asynchronous mysql queries. Come on, you're asking about a future feature in PHP 7.x , but would like to support someone who is seriously backlevel on mysql?? -- Per Jessen, Zürich (16.9°C) I'm not talking about MySQL 4.0 or older. I'm talking about other RDBMS. I think you should open your eyes a bit wider and take a look at the bigger picture (Firebird, MSSQL, Oracle, PostgreSQL, etc). http://www.php.net/manual/en/function.pg-send-query.php Looks to me like the PHP postgresql library already handles that. Not to mention: you're not presenting an argument for threads, you're presenting an argument for implementing asynchronous queries in the other DBMS libraries. Of course, the problem could also be solved by introducing threads in PHP. I'd personally guess modifying DBMS libraries would be less costly, but as I haven't been involved in writing the PHP code my guess isn't worth much. Regards Peter I'm presenting the argument for threading. Per is presenting the work around using asynchronous queries via mysqlnd. I did read that link a few days ago, Although the user can send multiple queries at once, multiple queries cannot be sent over a busy connection. If a query is sent while the connection is busy, it waits until the last query is finished and discards all its results. Which sounds like threads - multiple connections to not run into that problem. Have you looked into what it would cost in development to improve the library? Have you compared that to the cost in development to introduce threads into PHP? No, I don't think you're presenting the argument for threading - but I don't expect you to see it that way. -- hype WWW: http://plphp.dk / http://plind.dk LinkedIn: http://www.linkedin.com/in/plind Flickr: http://www.flickr.com/photos/fake51 BeWelcome: Fake51 Couchsurfing: Fake51 /hype -- PHP General Mailing List (http://www.php.net/) To unsubscribe, visit: http://www.php.net/unsub.php
Re: [PHP] Will PHP ever grow up and have threading?
On 25 March 2010 20:19, Tommy Pham tommy...@gmail.com wrote: Aren't all feature requests must be analyzed the same way? Example, namespace, how many of us actually uses it now when there is an alternative solution- subfolders - that we've been using since who knows how long. I don't know if threads was asked a feature prior namespace was implemented. Yes, you're right. But feature requests are not equal: some present a bigger payoff than others, and some will be more problematic to implement than others. If a given language can solve the problems it meets based on it's current structure, should you necessarily implement new shiny features, that may present problems? I'm not against threads in PHP per se ... I just haven't seen a very convincing reason for them yet, which is why I'm not very positive about the thing. The DB scenario could be handled without threads and current libraries could be improved ... and as long as that's cheaper than implementing threads, then - personally - I'd need to see more powerful reasons for threads. Luckily, I have no say in the development of PHP, so I won't get in anyone's way should they choose to implement threads :) -- hype WWW: http://plphp.dk / http://plind.dk LinkedIn: http://www.linkedin.com/in/plind Flickr: http://www.flickr.com/photos/fake51 BeWelcome: Fake51 Couchsurfing: Fake51 /hype -- PHP General Mailing List (http://www.php.net/) To unsubscribe, visit: http://www.php.net/unsub.php
Re: [PHP] Will PHP ever grow up and have threading?
On 25 March 2010 20:59, Tommy Pham tommy...@gmail.com wrote: On Thu, Mar 25, 2010 at 12:28 PM, Peter Lind peter.e.l...@gmail.com wrote: On 25 March 2010 20:19, Tommy Pham tommy...@gmail.com wrote: Aren't all feature requests must be analyzed the same way? Example, namespace, how many of us actually uses it now when there is an alternative solution- subfolders - that we've been using since who knows how long. I don't know if threads was asked a feature prior namespace was implemented. Yes, you're right. But feature requests are not equal: some present a bigger payoff than others, and some will be more problematic to implement than others. If a given language can solve the problems it meets based on it's current structure, should you necessarily implement new shiny features, that may present problems? I'm not against threads in PHP per se ... I just haven't seen a very convincing reason for them yet, which is why I'm not very positive about the thing. The DB scenario could be handled without threads and current libraries could be improved ... and as long as that's cheaper than implementing threads, then - personally - I'd need to see more powerful reasons for threads. Luckily, I have no say in the development of PHP, so I won't get in anyone's way should they choose to implement threads :) Here's my analysis, let's say that you have 1000 requests / second on the web server. Each request has multiqueries which take a total of 1 second to complete. In that one second, how many of those 1000 arrive at the same time (that one instant of micro/nano second)? You see how threads come in? If you have threads that are able finish the requests that come in that instant and able to complete them before the next batch of requests in that same second, wouldn't you agree then that you're delivering faster response time to all your users? That sounds like your webserver spawning new processes dealing with requests ... possibly combined with connection pooling and asynchronous queries and load balancing, etc, etc. So no, I'm not convinced that PHP with threads would actually deliver much faster than a properly built setup that makes good usage of technology you'll have to use anyway. -- hype WWW: http://plphp.dk / http://plind.dk LinkedIn: http://www.linkedin.com/in/plind Flickr: http://www.flickr.com/photos/fake51 BeWelcome: Fake51 Couchsurfing: Fake51 /hype -- PHP General Mailing List (http://www.php.net/) To unsubscribe, visit: http://www.php.net/unsub.php
Re: [PHP] Will PHP ever grow up and have threading?
On 25 March 2010 22:51, Lester Caine les...@lsces.co.uk wrote: Per Jessen wrote: Tommy Pham wrote: I'm presenting the argument for threading. Per is presenting the work around using asynchronous queries via mysqlnd. I did read that link a few days ago, Although the user can send multiple queries at once, multiple queries cannot be sent over a busy connection. If a query is sent while the connection is busy, it waits until the last query is finished and discards all its results. Which sounds like threads - multiple connections to not run into that problem. You must have read the wrong page. This is NOT about multiple queries, it's about _asynchronous_ queries. The only problem here is what the database client can handle. If it can only handle one active query, then that is all that can be used. It can be started asynchronously and then you come back to pick up the results later, and so you can be formating the page ready to insert the results. PDO requires that you start a different connection in a different transaction for each of these queries, but that is another hot potato. Running 10 asynchronous queries would require 10 connections as that is how the database end works. Adding threading to PHP is going to make no difference? Actually, this sounds very close to having 10 threads each opening a connection to the database and running the query ... which was the solution to the scenario presented, if memory serves. -- Lester Caine - G8HFL - Contact - http://lsces.co.uk/wiki/?page=contact L.S.Caine Electronic Services - http://lsces.co.uk EnquirySolve - http://enquirysolve.com/ Model Engineers Digital Workshop - http://medw.co.uk// Firebird - http://www.firebirdsql.org/index.php -- PHP General Mailing List (http://www.php.net/) To unsubscribe, visit: http://www.php.net/unsub.php -- hype WWW: http://plphp.dk / http://plind.dk LinkedIn: http://www.linkedin.com/in/plind Flickr: http://www.flickr.com/photos/fake51 BeWelcome: Fake51 Couchsurfing: Fake51 /hype -- PHP General Mailing List (http://www.php.net/) To unsubscribe, visit: http://www.php.net/unsub.php
Re: [PHP] Will PHP ever grow up and have threading?
On 25 March 2010 23:23, Tommy Pham tommy...@gmail.com wrote: There's the code example from that same link. You may have executed the queries asynchronously, but the process of the results are still serial. Let's face it, all of our processing of queries are not a simple echo. We iterate/loop through the results and display them in the desired format. Having execute the query and the processing of the result in threads/parallel, you get the real performance boost which I've been trying to convey the concept of serial versus parallel. Actually, you haven't mentioned the processing as part of what the threads do until now. I see your point though: if you split that part off, you might gain some performance, that would otherwise be hard to get at. I wonder though, if the performance is worth it in the tradeoff for the maintenance nightmare it is when you split out content processing between 10 different threads. I wouldn't personally touch it unless I had no other option, but that's just my opinion. Anyway, I don't think either of us will change point of view much at this point - so we should probably just give the mailing list a rest by now. Thanks for the posts, it's been interesting to read :) -- PHP General Mailing List (http://www.php.net/) To unsubscribe, visit: http://www.php.net/unsub.php -- hype WWW: http://plphp.dk / http://plind.dk LinkedIn: http://www.linkedin.com/in/plind Flickr: http://www.flickr.com/photos/fake51 BeWelcome: Fake51 Couchsurfing: Fake51 /hype -- PHP General Mailing List (http://www.php.net/) To unsubscribe, visit: http://www.php.net/unsub.php
Re: [PHP] PHP to access shell script to print barcodes
The problem you're getting is that your web-server interprets the
request as a request for a normal file and just sends it - in effect,
you're not outputting the postscript file, you're just sending the
.php file. Normally, you'll only get your php executed if the file
requested is a .php or .phtml - unless you've changed your server
config.
Try creating a serveps.php that uses the header(Content-Disposition:
attachment; filename: 'serveps.ps') instead, see if that helps you.
Regards
On 24 March 2010 06:09, Rob Gould gould...@me.com wrote:
Well, that did something, and it does sound like it should work. I've
scoured the web and haven't found anyone with code that does what I'm trying
to do.
I've got a working, hardcoded Postscript file here:
http://www.winecarepro.com/kiosk/fast/shell/barcodemerge.ps
But I need to somehow serve it with PHP, so I can change some variables in it.
By putting headers in place with PHP, and then doing an echo of the
postscript, I get postscript errors (though Preview doesn't tell me what the
error is):
http://www.winecarepro.com/kiosk/fast/shell/serverps.ps
Trying to trick the web-browser into thinking it's receiving Postscript from
a PHP file is tricky. I don't know what to do next.
Here's the code I was using in the above url:
http://www.winecarepro.com/kiosk/fast/shell/serveps.php.zip
It's not clear to me if the server is parsing the postscript first and then
serving it, or if the server is server the postscript as-is and the browser
sends it to Preview which interprets it.
I basically want to replicate the functionality found here:
http://blog.maniac.nl/webbased-pdf-lto-barcode-generator/
On Mar 23, 2010, at 5:37 PM, Peter Lind wrote:
You can create a .php script that sets a proper header to make the
browser download the file rather than display it. That also allows you
to set the filename for the download. What you'd need to do is include
something like:
header(Content-Disposition: attachment; filename: 'barcodemerge.ps');
That tells the browser to download the file. You can also try setting
the content-type
header('Content-type: application/postscript');
Either of the above might do the trick for you.
Regards
Peter
On 23 March 2010 22:10, Rob Gould gould...@me.com wrote:
I love the idea of using PHP to insert data into Postscript. I'm just not
sure how to make it happen.
The good news is that I've got barcodes drawing just the way I need them:
http://www.winecarepro.com/kiosk/fast/shell/barcodemerge.ps
The bad news is that's all hard-coded Postscript. I'd like to take your
suggestion and use PHP to loop-through and draw the barcodes - - - however,
if I put anything that resembles PHP in my .ps file, bad things happen.
Anyone know the secret to creating a postscript .ps file that had PHP code
injecting data into it?
Here's the source file that works. Where PHP would be handy is at the very
bottom of the script
http://www.winecarepro.com/kiosk/fast/shell/barcodemerge.ps.zip
On Mar 23, 2010, at 7:48 AM, Richard Quadling wrote:
On 23 March 2010 05:48, Jochem Maas joc...@iamjochem.com wrote:
Op 3/23/10 3:27 AM, Rob Gould schreef:
I am trying to replicate the functionality that I see on this site:
http://blog.maniac.nl/webbased-pdf-lto-barcode-generator/
Notice after you hit SUBMIT QUERY, you get a PDF file with a page of
barcodes. That's _exactly_ what I'm after.
Fortunately, the author gives step-by-step instructions on how to do
this on this page:
http://blog.maniac.nl/2008/05/28/creating-lto-barcodes/
So I've gotten through all the steps, and have created the
barcode_with_samples.ps file, and have it hosted here:
http://www.winecarepro.com/kiosk/fast/shell/
Notice how the last few lines contain the shell-script that renders the
postscript:
#!/bin/bash
BASE=”100″;
NR=$BASE
for hor in 30 220 410
do
ver=740
while [ $ver -ge 40 ];
do
printf -v FNR “(%06dL3)” $NR
echo “$hor $ver moveto $FNR (includetext height=0.55) code39 barcode”
let ver=$ver-70
let NR=NR+1
done
done
I need to somehow create a PHP script that executes this shell script.
And after doing some research, it sounds like
I need to use the PHP exec command, so I do that with the following file:
http://www.winecarepro.com/kiosk/fast/shell/printbarcodes.php
Which has the following script:
?php
$command=http://www.winecarepro.com/kiosk/fast/shell/barcode_with_sample.ps;;
exec($command, $arr);
echo $arr;
?
And, as you can see, nothing works. I guess firstly, I'd like to know:
A) Is this PHP exec call really the way to go with executing this shell
script? Is there a better way? It seems to me like it's not really
executing.
that's what exec() is for. $command need to contain a *local* path to the
command in question, currently your
trying to pass a url to bash ... which obviously doesn't do much.
the shell script in question needs to have
Re: [PHP] Will PHP ever grow up and have threading?
On 24 March 2010 10:38, Rene Veerman rene7...@gmail.com wrote: and if threading and shared memory aren't implemented, then hey, the php dev team can build something else in that these naysayers DO need eh... lol... Do you have any idea how sad and pathetic you come across? I'm very sorry to say this, but really, now's the time to stop posting and step back, take a deep breath, then focus on something else. On Wed, Mar 24, 2010 at 11:36 AM, Rene Veerman rene7...@gmail.com wrote: unless the actual php development team would like to weigh in on this matter of course. yes, i do consider it that important. these nay-sayers usually also lobby the dev-team to such extent that these features would actually not make it into php. On Wed, Mar 24, 2010 at 11:31 AM, Rene Veerman rene7...@gmail.com wrote: php is not a hammer, its a programming language. one that i feel needs to stay ahead of the computing trend if it is to be considered a language for large scale applications. but you nay-sayers here have convinced me; i'll be shopping for another language with which to serve my applications and the weboutput they produce.. thanks for opening my eyes and telling to abandon ship in time. On Wed, Mar 24, 2010 at 11:22 AM, Stuart Dallas stut...@gmail.com wrote: Heh, you guys are funny! On 24 Mar 2010, at 08:58, Rene Veerman wrote: On Wed, Mar 24, 2010 at 10:47 AM, Per Jessen p...@computer.org wrote: Rene Veerman wrote: popular : facebook youtube etc Rene, I must be missing something here. That sort of size implies millions in advertising revenue, so why are we discussing how much performance we can squeeze out of a single box? I mean, I'm all for efficient use of system resources, but if I have a semi-scalable application, it's a lot easier just getting another box than trying to change the implementation language. OTOH, if my design is not scalable, it's probably also easier to redo it than trying to change the implementation language. again: a) you're determining the contents of my toolset, without it affecting you at all. the way you want it php will degrade into a toy language. And how exactly are you defining a toy language? If you want features like threading, why not switch to a language that already supports it? b) i will aim for all possible decreases in development time and operating costs during, not only in the grow phase but also in hard economic times. any business person knows why. Yup, this is very good practice, but deciding that one particular tool is the only option is a fatal business decision. Use the right tool for the job! What you're trying to do here is akin to taking a hammer and whittling a screwdriver in to the handle. It's ridiculously inefficient, and imo, pretty stupid. and you're still trying to impose a toolset on me. I didn't think I was - you're the one who seem to be fixed on PHP as the only solution, and advocating that it be enhanced to suit your purposes. no, php is just my toolset of choice, and i think it should grow with the times and support threading and shared memory. maybe even a few cool features to enable use-as-a-cloud. PHP is a hammer, and a bloody good one at that, but you seem to want it to be a tool shed. Accept that it's a hammer, go visit a DIY store, find the right tool for the job and get on with your life! The fact is that even if we all agree that PHP needs threading, and one or more people start working on putting it into the core, it will likely be many months before you see any sight of a working version, and even longer before you see a stable release. -Stuart -- http://stut.net/ -- PHP General Mailing List (http://www.php.net/) To unsubscribe, visit: http://www.php.net/unsub.php -- hype WWW: http://plphp.dk / http://plind.dk LinkedIn: http://www.linkedin.com/in/plind Flickr: http://www.flickr.com/photos/fake51 BeWelcome: Fake51 Couchsurfing: Fake51 /hype -- PHP General Mailing List (http://www.php.net/) To unsubscribe, visit: http://www.php.net/unsub.php
Re: [PHP] Will PHP ever grow up and have threading?
On 24 March 2010 11:53, Tommy Pham tommy...@gmail.com wrote: On Wed, Mar 24, 2010 at 3:44 AM, Per Jessen p...@computer.org wrote: Tommy Pham wrote: On Wed, Mar 24, 2010 at 3:20 AM, Per Jessen p...@computer.org wrote: Tommy Pham wrote: What I find funny is that one of opponents of PHP threads earlier mentioned that how silly it would be to be using C in a web app. Now I hear people mentioning C when they need productivity or speed... I think I was the one to mention the latter, but as I started out saying, and as others have said too, it's about the right tool for the right job. When choosing a tool, there are a number of factors to consider - developer productivity, available skills, future maintenance, performance, scalability, portability, parallelism, performance etcetera. Funny you should mention all that. Let's say that you're longer with that company, either by direct employment or contract consultant. You've implemented C because you need 'thread'. Now your replacement comes in and has no clue about C even though your replacement is a PHP guru. How much headache is maintenance gonna be? Scalability? Portability? wow Who was the idi... who hired someone who wasn't suited for the job? Tommy, that's a moot argument. You can't fit a square peg in a round hole. -- Per Jessen, Zürich (12.5°C) Suited for the job? You mean introduce more complexity to a problem that what could be avoided to begin with if PHP has thread support? hmmm Except, you already introduced complexity into the problem. You see, working with threads is another requirement, whether it be done in PHP or not. Hence, hiring the right guy is independent of whether you have threads in PHP or not - your problem is no less nor no more complex whether you do threading inside or outside PHP. You just assume that adding thread support to PHP will solve the problem, but there's no actual basis to believe this. -- PHP General Mailing List (http://www.php.net/) To unsubscribe, visit: http://www.php.net/unsub.php -- hype WWW: http://plphp.dk / http://plind.dk LinkedIn: http://www.linkedin.com/in/plind Flickr: http://www.flickr.com/photos/fake51 BeWelcome: Fake51 Couchsurfing: Fake51 /hype -- PHP General Mailing List (http://www.php.net/) To unsubscribe, visit: http://www.php.net/unsub.php
Re: [PHP] Will PHP ever grow up and have threading?
On 24 March 2010 12:04, Tommy Pham tommy...@gmail.com wrote: On Wed, Mar 24, 2010 at 3:52 AM, Lester Caine les...@lsces.co.uk wrote: Tommy Pham wrote: How exactly will threading in PHP help with the size of the database? That makes no sense to me, please help me understand how you think threading will help in this scenario. Looking at my example, not just the rows There are other features that require queries to a DB for simple request of a category by a shopper, instead of running those queries in series, running them in parallel would yield better response time. Database size issues are tackled with clustering, caching and DB optimisation. Threading in the language accessing the DB has no advantage here. Yes, it does. As mentioned several times, instead of running the queries in series, run them in parallel. If each of the queries takes about .05 to .15 seconds. How long would it take to run them in serial? How long do you it take to run them in parallel? Any you have a database that can actually handle that? If the database is taking 0.1 seconds per query, and you have 10 queries, then getting the data is going to take 1 second to generate. If you want some slow query to be started, and come back for the data later, then I thought we already had that? But again this is part of the database driver anyway. No need to add threading to PHP to get the database connection to pull data in the most efficient way. And one does not write the driver in PHP? We are using C there already? -- Lester Caine - G8HFL - Contact - http://lsces.co.uk/wiki/?page=contact L.S.Caine Electronic Services - http://lsces.co.uk EnquirySolve - http://enquirysolve.com/ Model Engineers Digital Workshop - http://medw.co.uk// Firebird - http://www.firebirdsql.org/index.php -- PHP General Mailing List (http://www.php.net/) To unsubscribe, visit: http://www.php.net/unsub.php Exactly my point. 10 queries taking .1 second each running in serial is 1 second total. How long would it take to run all those same queries simultaneously??? What's so difficult about the concept of serial vs parallel? Hmm, just wondering, but how long do you think it will take your high-traffic site to buckle under the load of the database queries you want to execute when now you want all of them to execute at the same time? Going with the 10 queries of .1 second each ... how far do you think you can scale that before you overload your database server? I'm just wondering here, I could be completely off the bat. -- PHP General Mailing List (http://www.php.net/) To unsubscribe, visit: http://www.php.net/unsub.php -- hype WWW: http://plphp.dk / http://plind.dk LinkedIn: http://www.linkedin.com/in/plind Flickr: http://www.flickr.com/photos/fake51 BeWelcome: Fake51 Couchsurfing: Fake51 /hype -- PHP General Mailing List (http://www.php.net/) To unsubscribe, visit: http://www.php.net/unsub.php
Re: [PHP] Will PHP ever grow up and have threading?
On 24 March 2010 12:14, Tommy Pham tommy...@gmail.com wrote: On Wed, Mar 24, 2010 at 4:09 AM, Peter Lind peter.e.l...@gmail.com wrote: On 24 March 2010 12:04, Tommy Pham tommy...@gmail.com wrote: On Wed, Mar 24, 2010 at 3:52 AM, Lester Caine les...@lsces.co.uk wrote: Tommy Pham wrote: How exactly will threading in PHP help with the size of the database? That makes no sense to me, please help me understand how you think threading will help in this scenario. Looking at my example, not just the rows There are other features that require queries to a DB for simple request of a category by a shopper, instead of running those queries in series, running them in parallel would yield better response time. Database size issues are tackled with clustering, caching and DB optimisation. Threading in the language accessing the DB has no advantage here. Yes, it does. As mentioned several times, instead of running the queries in series, run them in parallel. If each of the queries takes about .05 to .15 seconds. How long would it take to run them in serial? How long do you it take to run them in parallel? Any you have a database that can actually handle that? If the database is taking 0.1 seconds per query, and you have 10 queries, then getting the data is going to take 1 second to generate. If you want some slow query to be started, and come back for the data later, then I thought we already had that? But again this is part of the database driver anyway. No need to add threading to PHP to get the database connection to pull data in the most efficient way. And one does not write the driver in PHP? We are using C there already? -- Lester Caine - G8HFL - Contact - http://lsces.co.uk/wiki/?page=contact L.S.Caine Electronic Services - http://lsces.co.uk EnquirySolve - http://enquirysolve.com/ Model Engineers Digital Workshop - http://medw.co.uk// Firebird - http://www.firebirdsql.org/index.php -- PHP General Mailing List (http://www.php.net/) To unsubscribe, visit: http://www.php.net/unsub.php Exactly my point. 10 queries taking .1 second each running in serial is 1 second total. How long would it take to run all those same queries simultaneously??? What's so difficult about the concept of serial vs parallel? Hmm, just wondering, but how long do you think it will take your high-traffic site to buckle under the load of the database queries you want to execute when now you want all of them to execute at the same time? Going with the 10 queries of .1 second each ... how far do you think you can scale that before you overload your database server? I'm just wondering here, I could be completely off the bat. IIRC, one of opponents of PHP thread mention load balancer/cluster or another opponent mention 'throw money into the hardware problem' Yes. If you can accept that solution for this problem, why not for the other problem? Please keep in mind that I'm not for or against threads in PHP. I think they can solve some problems and I think they'll create a host of others - currently I have no idea if the benefits would outweigh the costs. I just have a huge problem understanding why alternative solutions to problems are thrown out with No! That won't work when they haven't been shown to be problematic. So far, we've seen no examples of situations where PHP would be the best choice of language and would need threads to solve the problem at hand. Assuming that you have a right to use a threaded version of PHP amounts to walking into your favourite tool-store and demanding that you get a hammer that doubles as a phone. And when none are available, you start yelling at other customers for suggesting the use of a phone and hammer in combination. -- PHP General Mailing List (http://www.php.net/) To unsubscribe, visit: http://www.php.net/unsub.php -- hype WWW: http://plphp.dk / http://plind.dk LinkedIn: http://www.linkedin.com/in/plind Flickr: http://www.flickr.com/photos/fake51 BeWelcome: Fake51 Couchsurfing: Fake51 /hype -- hype WWW: http://plphp.dk / http://plind.dk LinkedIn: http://www.linkedin.com/in/plind Flickr: http://www.flickr.com/photos/fake51 BeWelcome: Fake51 Couchsurfing: Fake51 /hype -- PHP General Mailing List (http://www.php.net/) To unsubscribe, visit: http://www.php.net/unsub.php
Re: [PHP] Properly handling multiple constructors.
Hmmm, that looks to me like you're trying to solve a problem in PHP
with a c/c++c/# overloading solution. I'd give the builder pattern a
try instead: http://en.wikipedia.org/wiki/Builder_pattern
On 24 March 2010 13:01, Richard Quadling rquadl...@googlemail.com wrote:
Hi.
I have a scenario where I would _like_ to have multiple constructors
for a class.
Each constructor has a greater number of parameters than the previous one.
e.g.
?php
class myClass {
__construct(string $Key) // use key to get the complex details.
__construct(string $Part1, string $Part2, string $Part3) //
Alternative route to the complex details.
__construct(array $Complex) // All the details
}
Essentially, SimpleKey is a key to a set of predefined rules. Part1, 2
and 3 are the main details and well documented defaults for the rest
of the rules. Complex is all the rules.
Each constructor will end up with all the parts being known ($Key,
$Part1, $Part2, $Part3, $Complex).
But, PHP doesn't support multiple constructors.
Initially I thought about this ...
__construct($Key_Part1_Complex, $Part2=Null, $Part3=Null)
But then documenting the first param as being 1 of three different
meanings is pretty much a no go.
So I'm looking for a clean and easily understood way to provide this.
I won't be the only user of the code and not everyone has the same
knowledge level, hence a mechanism that is easily documentable.
I think I may need a factory with multiple methods (FactoryKey,
FactoryPart1To3, FactoryComplex). Make the factory a static/singleton.
All these methods eventually call the real class with the complex
rule.
Is that obvious enough?
Regards,
Richard.
--
-
Richard Quadling
Standing on the shoulders of some very clever giants!
EE : http://www.experts-exchange.com/M_248814.html
EE4Free : http://www.experts-exchange.com/becomeAnExpert.jsp
Zend Certified Engineer : http://zend.com/zce.php?c=ZEND002498r=213474731
ZOPA : http://uk.zopa.com/member/RQuadling
--
PHP General Mailing List (http://www.php.net/)
To unsubscribe, visit: http://www.php.net/unsub.php
--
hype
WWW: http://plphp.dk / http://plind.dk
LinkedIn: http://www.linkedin.com/in/plind
Flickr: http://www.flickr.com/photos/fake51
BeWelcome: Fake51
Couchsurfing: Fake51
/hype
--
PHP General Mailing List (http://www.php.net/)
To unsubscribe, visit: http://www.php.net/unsub.php
Re: [PHP] Properly handling multiple constructors.
And how exactly does that differ from building the same pizza in
different ways? Builder doesn't mean you have to create different
objects, it means taking the complexity in building a given object or
set of objects and storing it in one place.
In your case, it allows you to build your object in different ways
while documenting it properly and avoid the huge switch inside your
constructor that Nilesh proposed.
On 24 March 2010 13:35, Richard Quadling rquadl...@googlemail.com wrote:
On 24 March 2010 12:06, Peter Lind peter.e.l...@gmail.com wrote:
Hmmm, that looks to me like you're trying to solve a problem in PHP
with a c/c++c/# overloading solution. I'd give the builder pattern a
try instead: http://en.wikipedia.org/wiki/Builder_pattern
On 24 March 2010 13:01, Richard Quadling rquadl...@googlemail.com wrote:
Hi.
I have a scenario where I would _like_ to have multiple constructors
for a class.
Each constructor has a greater number of parameters than the previous one.
e.g.
?php
class myClass {
__construct(string $Key) // use key to get the complex details.
__construct(string $Part1, string $Part2, string $Part3) //
Alternative route to the complex details.
__construct(array $Complex) // All the details
}
Essentially, SimpleKey is a key to a set of predefined rules. Part1, 2
and 3 are the main details and well documented defaults for the rest
of the rules. Complex is all the rules.
Each constructor will end up with all the parts being known ($Key,
$Part1, $Part2, $Part3, $Complex).
But, PHP doesn't support multiple constructors.
Initially I thought about this ...
__construct($Key_Part1_Complex, $Part2=Null, $Part3=Null)
But then documenting the first param as being 1 of three different
meanings is pretty much a no go.
So I'm looking for a clean and easily understood way to provide this.
I won't be the only user of the code and not everyone has the same
knowledge level, hence a mechanism that is easily documentable.
I think I may need a factory with multiple methods (FactoryKey,
FactoryPart1To3, FactoryComplex). Make the factory a static/singleton.
All these methods eventually call the real class with the complex
rule.
Is that obvious enough?
Regards,
Richard.
--
-
Richard Quadling
Standing on the shoulders of some very clever giants!
EE : http://www.experts-exchange.com/M_248814.html
EE4Free : http://www.experts-exchange.com/becomeAnExpert.jsp
Zend Certified Engineer : http://zend.com/zce.php?c=ZEND002498r=213474731
ZOPA : http://uk.zopa.com/member/RQuadling
--
PHP General Mailing List (http://www.php.net/)
To unsubscribe, visit: http://www.php.net/unsub.php
--
hype
WWW: http://plphp.dk / http://plind.dk
LinkedIn: http://www.linkedin.com/in/plind
Flickr: http://www.flickr.com/photos/fake51
BeWelcome: Fake51
Couchsurfing: Fake51
/hype
I'm not building different types of pizza. Just the same pizza via
different routes.
Along the lines of ...
Pizza = new Pizza('MyFavouritePizza') // A ham+pineapple+cheese pizza.
Pizza = new Pizza('ham', 'pineapple', 'cheese'); // A generic
ham+pineapple+cheese pizza
Pizza = new Pizza(array('base' = 'thin', 'toppings' = array('ham',
'pineapple'), 'cheese'=true)); // A complex description.
I suppose the interfaces are beginner, intermediate and advanced, but
ultimately all generate identical objects.
Richard.
--
-
Richard Quadling
Standing on the shoulders of some very clever giants!
EE : http://www.experts-exchange.com/M_248814.html
EE4Free : http://www.experts-exchange.com/becomeAnExpert.jsp
Zend Certified Engineer : http://zend.com/zce.php?c=ZEND002498r=213474731
ZOPA : http://uk.zopa.com/member/RQuadling
--
hype
WWW: http://plphp.dk / http://plind.dk
LinkedIn: http://www.linkedin.com/in/plind
Flickr: http://www.flickr.com/photos/fake51
BeWelcome: Fake51
Couchsurfing: Fake51
/hype
--
PHP General Mailing List (http://www.php.net/)
To unsubscribe, visit: http://www.php.net/unsub.php
Re: [PHP] Properly handling multiple constructors.
One of the main points of the OP was that you can document the code
properly. Your example doesn't allow for nice docblocks in any way, as
you'll either have to param points or a whole lot of noise.
Quick note: __ prefixed functions are reserved, you shouldn't use
that prefix for any of your own functions. However unlikely it is that
PHP will ever have a __construct_bluh() function ...
On 24 March 2010 15:22, Robert Cummings rob...@interjinn.com wrote:
Robert Cummings wrote:
Richard Quadling wrote:
Hi.
I have a scenario where I would _like_ to have multiple constructors
for a class.
Each constructor has a greater number of parameters than the previous
one.
e.g.
?php
class myClass {
__construct(string $Key) // use key to get the complex details.
__construct(string $Part1, string $Part2, string $Part3) //
Alternative route to the complex details.
__construct(array $Complex) // All the details
}
Essentially, SimpleKey is a key to a set of predefined rules. Part1, 2
and 3 are the main details and well documented defaults for the rest
of the rules. Complex is all the rules.
Each constructor will end up with all the parts being known ($Key,
$Part1, $Part2, $Part3, $Complex).
But, PHP doesn't support multiple constructors.
Initially I thought about this ...
__construct($Key_Part1_Complex, $Part2=Null, $Part3=Null)
But then documenting the first param as being 1 of three different
meanings is pretty much a no go.
So I'm looking for a clean and easily understood way to provide this.
I won't be the only user of the code and not everyone has the same
knowledge level, hence a mechanism that is easily documentable.
I think I may need a factory with multiple methods (FactoryKey,
FactoryPart1To3, FactoryComplex). Make the factory a static/singleton.
All these methods eventually call the real class with the complex
rule.
Is that obvious enough?
Factory method is probably the cleanest and simplest solution. Just pass
an ID as the first parameter to the real constructor and then it can route
to the appropriate behaviour:
Here's a better example (tested):
?php
class Foo
{
const CONSTRUCT_BLAH = 1;
const CONSTRUCT_BLEH = 2;
const CONSTRUCT_BLUH = 3;
function __construct( $constructId )
{
static $map = array
(
self::CONSTRUCT_BLAH = '__construct_blah',
self::CONSTRUCT_BLEH = '__construct_bleh',
self::CONSTRUCT_BLUH = '__construct_bluh',
);
$obj = null;
if( isset( $map[$constructId] ) )
{
$args = func_get_args();
$args = array_shift( $args );
call_user_func_array(
array( 'self', $map[$constructId] ), $args );
}
else
{
// Generate an error or exception.
}
}
static function __construct_bleh( $arg1 )
{
echo Called: .__FUNCTION__.( $arg1 )\n;
}
static function __construct_blah( $arg1 )
{
echo Called: .__FUNCTION__.( $arg1 )\n;
}
static function __construct_bluh( $arg1 )
{
echo Called: .__FUNCTION__.( $arg1 )\n;
}
static function getBlah( $arg1 )
{
return new Foo( self::CONSTRUCT_BLAH, $arg1 );
}
static function getBleh( $arg1 )
{
return new Foo( self::CONSTRUCT_BLEH, $arg1 );
}
static function getBluh( $arg1 )
{
return new Foo( self::CONSTRUCT_BLUH, $arg1 );
}
}
$obj = Foo::getBlah( 'blah' );
$obj = Foo::getBleh( 'bleh' );
$obj = Foo::getBluh( 'bluh' );
?
Cheers,
Rob.
--
http://www.interjinn.com
Application and Templating Framework for PHP
--
PHP General Mailing List (http://www.php.net/)
To unsubscribe, visit: http://www.php.net/unsub.php
--
hype
WWW: http://plphp.dk / http://plind.dk
LinkedIn: http://www.linkedin.com/in/plind
Flickr: http://www.flickr.com/photos/fake51
BeWelcome: Fake51
Couchsurfing: Fake51
/hype
--
PHP General Mailing List (http://www.php.net/)
To unsubscribe, visit: http://www.php.net/unsub.php
Re: [PHP] Properly handling multiple constructors.
On 24 March 2010 15:33, Robert Cummings rob...@interjinn.com wrote:
Peter Lind wrote:
One of the main points of the OP was that you can document the code
properly. Your example doesn't allow for nice docblocks in any way, as
you'll either have to param points or a whole lot of noise.
I dunno, seems highly documentable to me. Each route is handled by it's own
method with the parameters being fully declared in the handler method's
signature.
Only problem is the OP wanted to be able to created objects with
variable amounts of arguments. I.e. passing just one argument to the
constructor wasn't an option, far as I could tell. That's why he was
looking at c++/c# overloading: creating a constructor for each
scenario because the amount and kind of arguments varied.
Which means that the docblock for your constructor will look something like
/**
* dynamic constructor
*
* @param int $constructor_type
* @param string|array|object|whatever_you_could_think_to_throw_at_it $something
* @param string|array|object|whatever_you_could_think_to_throw_at_it
$something this is optional
* @param etc
*
* @access public
* @return void
*/
Quick note: __ prefixed functions are reserved, you shouldn't use
that prefix for any of your own functions. However unlikely it is that
PHP will ever have a __construct_bluh() function ...
Yeah, I know... I threw caution to the wind in this quick example. But for
the sake of archives and newbies reading them, I shouldn't have :)
Cheers,
Rob.
On 24 March 2010 15:22, Robert Cummings rob...@interjinn.com wrote:
Robert Cummings wrote:
Richard Quadling wrote:
Hi.
I have a scenario where I would _like_ to have multiple constructors
for a class.
Each constructor has a greater number of parameters than the previous
one.
e.g.
?php
class myClass {
__construct(string $Key) // use key to get the complex details.
__construct(string $Part1, string $Part2, string $Part3) //
Alternative route to the complex details.
__construct(array $Complex) // All the details
}
Essentially, SimpleKey is a key to a set of predefined rules. Part1, 2
and 3 are the main details and well documented defaults for the rest
of the rules. Complex is all the rules.
Each constructor will end up with all the parts being known ($Key,
$Part1, $Part2, $Part3, $Complex).
But, PHP doesn't support multiple constructors.
Initially I thought about this ...
__construct($Key_Part1_Complex, $Part2=Null, $Part3=Null)
But then documenting the first param as being 1 of three different
meanings is pretty much a no go.
So I'm looking for a clean and easily understood way to provide this.
I won't be the only user of the code and not everyone has the same
knowledge level, hence a mechanism that is easily documentable.
I think I may need a factory with multiple methods (FactoryKey,
FactoryPart1To3, FactoryComplex). Make the factory a static/singleton.
All these methods eventually call the real class with the complex
rule.
Is that obvious enough?
Factory method is probably the cleanest and simplest solution. Just pass
an ID as the first parameter to the real constructor and then it can
route
to the appropriate behaviour:
Here's a better example (tested):
?php
class Foo
{
const CONSTRUCT_BLAH = 1;
const CONSTRUCT_BLEH = 2;
const CONSTRUCT_BLUH = 3;
function __construct( $constructId )
{
static $map = array
(
self::CONSTRUCT_BLAH = '__construct_blah',
self::CONSTRUCT_BLEH = '__construct_bleh',
self::CONSTRUCT_BLUH = '__construct_bluh',
);
$obj = null;
if( isset( $map[$constructId] ) )
{
$args = func_get_args();
$args = array_shift( $args );
call_user_func_array(
array( 'self', $map[$constructId] ), $args );
}
else
{
// Generate an error or exception.
}
}
static function __construct_bleh( $arg1 )
{
echo Called: .__FUNCTION__.( $arg1 )\n;
}
static function __construct_blah( $arg1 )
{
echo Called: .__FUNCTION__.( $arg1 )\n;
}
static function __construct_bluh( $arg1 )
{
echo Called: .__FUNCTION__.( $arg1 )\n;
}
static function getBlah( $arg1 )
{
return new Foo( self::CONSTRUCT_BLAH, $arg1 );
}
static function getBleh( $arg1 )
{
return new Foo( self::CONSTRUCT_BLEH, $arg1 );
}
static function getBluh( $arg1 )
{
return new Foo( self::CONSTRUCT_BLUH, $arg1 );
}
}
$obj = Foo::getBlah( 'blah' );
$obj = Foo::getBleh( 'bleh' );
$obj = Foo::getBluh( 'bluh' );
?
Cheers,
Rob.
--
http://www.interjinn.com
Application and Templating Framework for PHP
--
PHP General Mailing List (http://www.php.net/)
To unsubscribe, visit: http://www.php.net/unsub.php
--
http://www.interjinn.com
Application and Templating Framework for PHP
--
hype
WWW: http://plphp.dk / http://plind.dk
Re: [PHP] Properly handling multiple constructors.
On 24 March 2010 16:09, Robert Cummings rob...@interjinn.com wrote: Peter Lind wrote: On 24 March 2010 15:33, Robert Cummings rob...@interjinn.com wrote: Peter Lind wrote: One of the main points of the OP was that you can document the code properly. Your example doesn't allow for nice docblocks in any way, as you'll either have to param points or a whole lot of noise. I dunno, seems highly documentable to me. Each route is handled by it's own method with the parameters being fully declared in the handler method's signature. Only problem is the OP wanted to be able to created objects with variable amounts of arguments. I.e. passing just one argument to the constructor wasn't an option, far as I could tell. That's why he was looking at c++/c# overloading: creating a constructor for each scenario because the amount and kind of arguments varied. Which means that the docblock for your constructor will look something like /** * dynamic constructor * * @param int $constructor_type * @param string|array|object|whatever_you_could_think_to_throw_at_it $something * @param string|array|object|whatever_you_could_think_to_throw_at_it $something this is optional * @param etc * * @access public * @return void */ Actually, I would write it more like the following: /** * dynamic constructor that delegates construction and parameters to a * registered alternate constructor. See specific constructors for * supported parameters. * * @param int $constructor_type * @param mixed $param, * * @access public * @return void */ The ,... is a supported syntax. Then I'd add the appropriate docblock for the alternate constructors. It might be but in effect the documentation you're left with is vague and has double the amount of documentation lookups, to find out which parameters you can pass. Using a separate object to create the one you want avoids this. However, which solution fits the problem best is determined by the angle you're looking from. If you want to avoid extra classes, having a constructor like you're supposing is probably the best idea. Cheers, Rob. -- http://www.interjinn.com Application and Templating Framework for PHP -- hype WWW: http://plphp.dk / http://plind.dk LinkedIn: http://www.linkedin.com/in/plind Flickr: http://www.flickr.com/photos/fake51 BeWelcome: Fake51 Couchsurfing: Fake51 /hype -- PHP General Mailing List (http://www.php.net/) To unsubscribe, visit: http://www.php.net/unsub.php
Re: [PHP] Properly handling multiple constructors.
On 24 March 2010 16:23, Robert Cummings rob...@interjinn.com wrote: Peter Lind wrote: On 24 March 2010 16:09, Robert Cummings rob...@interjinn.com wrote: Peter Lind wrote: On 24 March 2010 15:33, Robert Cummings rob...@interjinn.com wrote: Peter Lind wrote: One of the main points of the OP was that you can document the code properly. Your example doesn't allow for nice docblocks in any way, as you'll either have to param points or a whole lot of noise. I dunno, seems highly documentable to me. Each route is handled by it's own method with the parameters being fully declared in the handler method's signature. Only problem is the OP wanted to be able to created objects with variable amounts of arguments. I.e. passing just one argument to the constructor wasn't an option, far as I could tell. That's why he was looking at c++/c# overloading: creating a constructor for each scenario because the amount and kind of arguments varied. Which means that the docblock for your constructor will look something like /** * dynamic constructor * * @param int $constructor_type * @param string|array|object|whatever_you_could_think_to_throw_at_it $something * @param string|array|object|whatever_you_could_think_to_throw_at_it $something this is optional * @param etc * * @access public * @return void */ Actually, I would write it more like the following: /** * dynamic constructor that delegates construction and parameters to a * registered alternate constructor. See specific constructors for * supported parameters. * * @param int $constructor_type * @param mixed $param, * * @access public * @return void */ The ,... is a supported syntax. Then I'd add the appropriate docblock for the alternate constructors. It might be but in effect the documentation you're left with is vague and has double the amount of documentation lookups, to find out which parameters you can pass. Using a separate object to create the one you want avoids this. But then you need to keep track of many different classes/objects rather than a single. You also run into confusion as to what the difference is when really they are the same, just built differently. In this context you have even more document points to review since you must read the class information in addition to the method signature. Also using a separate class just to facilitate a different constructor seems abusive of class semantics since the objects are intended to be identical, just built differently. I would find this more unwieldy to deal with in an environement than just viewing the alternate methods. Yes, you have to keep track of two different objects instead of one. Managing complexity by delegating responsibility is normally a good thing. And no, there is no confusion: you're building the same object in different ways, so you're getting the same object, not one that merely looks the same. As for abusing class semantics ... I don't see it. Using separate classes for different things is what OOP is about. If your constructor is trying to do 15 different things you're designing it wrong - methods shouldn't have to rely upon massive switches or the equivalent done using foreach loops and arrays. As for more documentation: You'd have two class docblocks plus a docblock for each build method, so I suppose you're right, that is one extra docblock. However, which solution fits the problem best is determined by the angle you're looking from. If you want to avoid extra classes, having a constructor like you're supposing is probably the best idea. Extra classes is also more code, probably more files (if you put them in separate files), more points of management. Yes. What does your code look like? One big file containing everything? Cheers, Rob. -- http://www.interjinn.com Application and Templating Framework for PHP -- hype WWW: http://plphp.dk / http://plind.dk LinkedIn: http://www.linkedin.com/in/plind Flickr: http://www.flickr.com/photos/fake51 BeWelcome: Fake51 Couchsurfing: Fake51 /hype -- PHP General Mailing List (http://www.php.net/) To unsubscribe, visit: http://www.php.net/unsub.php
Re: [PHP] Properly handling multiple constructors.
On 24 March 2010 16:48, Robert Cummings rob...@interjinn.com wrote: Peter Lind wrote: The ,... is a supported syntax. Then I'd add the appropriate docblock for the alternate constructors. It might be but in effect the documentation you're left with is vague and has double the amount of documentation lookups, to find out which parameters you can pass. Using a separate object to create the one you want avoids this. But then you need to keep track of many different classes/objects rather than a single. You also run into confusion as to what the difference is when really they are the same, just built differently. In this context you have even more document points to review since you must read the class information in addition to the method signature. Also using a separate class just to facilitate a different constructor seems abusive of class semantics since the objects are intended to be identical, just built differently. I would find this more unwieldy to deal with in an environement than just viewing the alternate methods. Yes, you have to keep track of two different objects instead of one. Managing complexity by delegating responsibility is normally a good thing. Absolutely, delegating responsibility to manage complexity is very good. My proposed solution does this. And no, there is no confusion: you're building the same object in different ways, so you're getting the same object, not one that merely looks the same. No, you're getting different objects. If they come from different classes then they are different. Yes they may be subclasses, but the OP indicated they differ only by how they are built. Adding 10 different subclasses just to facilitate constructor overloading seems egregious, especially if the object already has logical subclasses. As I suspected, you didn't understand what I meant. The builder pattern lets you build complex objects in steps, separating out complexity. It's equally well suited to building one object as many objects and what I had in mind was a simplified builder/factory. Which means you have: class ObjectBuilder class Object where ObjectBuilder comes with several different ways of building Object. That's two objects, not the list of objects extending something you posted. class Dog class Dog_construct1 extends Dog class Dog_construct2 extends Dog class Dog_construct3 extends Dog class Dog_construct4 extends Dog class Dalmation extends Dog class Dalmation_construct1 extends Dog_construct1 class Dalmation_construct2 extends Dog_construct2 class Dalmation_construct3 extends Dog_construct3 class Dalmation_construct4 extends Dog_construct4 But now Dalmation_construct1 isn't related to Dalmation... or do you propose the following: class Dalmation extends Dalmation class Dalmation_construct1 extends Dalmation class Dalmation_construct2 extends Dalmation class Dalmation_construct3 extends Dalmation class Dalmation_construct4 extends Dalmation But now Dalmation_construct1 isn't related Dog_construct1. This seems problematic from a design perspective unless I'm missing something in your proposal. As for abusing class semantics ... I don't see it. Using separate classes for different things is what OOP is about. If your constructor is trying to do 15 different things you're designing it wrong - methods shouldn't have to rely upon massive switches or the equivalent done using foreach loops and arrays. Sorry, switches, foreach, and isset are not equivalent. My approach is O( lg n ). Foreach and switches are O( n ) to find a candidate. Additionally, my constructor does 1 thing, it delegates to the appropriate constructor which does one thing also... builds the object according to intent. Yes, your constructor does one thing, which is indirectly related to constructing instead of carrying out the actual constructing. I prefer constructors to construct something, but that's a matter of preference I expect. As for more documentation: You'd have two class docblocks plus a docblock for each build method, so I suppose you're right, that is one extra docblock. However, which solution fits the problem best is determined by the angle you're looking from. If you want to avoid extra classes, having a constructor like you're supposing is probably the best idea. Extra classes is also more code, probably more files (if you put them in separate files), more points of management. Yes. What does your code look like? One big file containing everything? No, I said probably because I put classes in separate files. I was saying there is probably another added maintenance headache of all these new class files. There would be if one were to use your scheme of subclassing. What I proposed doesn't do that in any way, so there's not much of a maintenance headache. Anyway, all this is theoretical seeing as you can equally well use a set of static methods
Re: [PHP] Filtering all output to STDERR
Ahh, I see why my suggestions had no effect - I assumed you were dealing with normal php errors, not something done customly by the code. I'm afraid the only option I see is that of debugging the problem script to find out where it opens STDERR - if you're certain that the script specifically outputs messages to STDERR, then it's opening that stream somewhere before the output. Regards Peter On 23 March 2010 11:28, Marten Lehmann lehm...@cnm.de wrote: Have you tried with http://dk2.php.net/manual/en/function.error-reporting.php or just the @ operator? Yes. But this does not work, because error levels and the @ operator only relate to errors thrown by the PHP runtime and have nothing to do with STDERR. But I need a way to close the STDERR file handle at the beginning of a script or at least catch and remove all output sent to STDERR. Regards Marten -- PHP General Mailing List (http://www.php.net/) To unsubscribe, visit: http://www.php.net/unsub.php -- hype WWW: http://plphp.dk / http://plind.dk LinkedIn: http://www.linkedin.com/in/plind Flickr: http://www.flickr.com/photos/fake51 BeWelcome: Fake51 Couchsurfing: Fake51 /hype -- PHP General Mailing List (http://www.php.net/) To unsubscribe, visit: http://www.php.net/unsub.php
Re: [PHP] PHP to access shell script to print barcodes
You can create a .php script that sets a proper header to make the
browser download the file rather than display it. That also allows you
to set the filename for the download. What you'd need to do is include
something like:
header(Content-Disposition: attachment; filename: 'barcodemerge.ps');
That tells the browser to download the file. You can also try setting
the content-type
header('Content-type: application/postscript');
Either of the above might do the trick for you.
Regards
Peter
On 23 March 2010 22:10, Rob Gould gould...@me.com wrote:
I love the idea of using PHP to insert data into Postscript. I'm just not
sure how to make it happen.
The good news is that I've got barcodes drawing just the way I need them:
http://www.winecarepro.com/kiosk/fast/shell/barcodemerge.ps
The bad news is that's all hard-coded Postscript. I'd like to take your
suggestion and use PHP to loop-through and draw the barcodes - - - however,
if I put anything that resembles PHP in my .ps file, bad things happen.
Anyone know the secret to creating a postscript .ps file that had PHP code
injecting data into it?
Here's the source file that works. Where PHP would be handy is at the very
bottom of the script
http://www.winecarepro.com/kiosk/fast/shell/barcodemerge.ps.zip
On Mar 23, 2010, at 7:48 AM, Richard Quadling wrote:
On 23 March 2010 05:48, Jochem Maas joc...@iamjochem.com wrote:
Op 3/23/10 3:27 AM, Rob Gould schreef:
I am trying to replicate the functionality that I see on this site:
http://blog.maniac.nl/webbased-pdf-lto-barcode-generator/
Notice after you hit SUBMIT QUERY, you get a PDF file with a page of
barcodes. That's _exactly_ what I'm after.
Fortunately, the author gives step-by-step instructions on how to do this
on this page:
http://blog.maniac.nl/2008/05/28/creating-lto-barcodes/
So I've gotten through all the steps, and have created the
barcode_with_samples.ps file, and have it hosted here:
http://www.winecarepro.com/kiosk/fast/shell/
Notice how the last few lines contain the shell-script that renders the
postscript:
#!/bin/bash
BASE=”100″;
NR=$BASE
for hor in 30 220 410
do
ver=740
while [ $ver -ge 40 ];
do
printf -v FNR “(%06dL3)” $NR
echo “$hor $ver moveto $FNR (includetext height=0.55) code39 barcode”
let ver=$ver-70
let NR=NR+1
done
done
I need to somehow create a PHP script that executes this shell script.
And after doing some research, it sounds like
I need to use the PHP exec command, so I do that with the following file:
http://www.winecarepro.com/kiosk/fast/shell/printbarcodes.php
Which has the following script:
?php
$command=http://www.winecarepro.com/kiosk/fast/shell/barcode_with_sample.ps;;
exec($command, $arr);
echo $arr;
?
And, as you can see, nothing works. I guess firstly, I'd like to know:
A) Is this PHP exec call really the way to go with executing this shell
script? Is there a better way? It seems to me like it's not really
executing.
that's what exec() is for. $command need to contain a *local* path to the
command in question, currently your
trying to pass a url to bash ... which obviously doesn't do much.
the shell script in question needs to have the executable bit set in order
to run (either that or change to command to
run bash with your script as an argument)
I'd also suggest putting the shell script outside of your webroot, or at
least in a directory that's not accessable
from the web.
--
PHP General Mailing List (http://www.php.net/)
To unsubscribe, visit: http://www.php.net/unsub.php
I think this is a translation of the script to PHP.
?php
$BASE = 100;
$NR = $BASE;
foreach(array(30, 220, 410) as $hor) {
$ver = 740;
while ($ver = 40) {
printf($hor $ver moveto (%06dL3) (includetext height=0.55)
code39
barcode\n, $NR);
$ver -= 70;
++$NR;
}
}
It produces output like ...
30 740 moveto (000100L3) (includetext height=0.55) code39 barcode
30 670 moveto (000101L3) (includetext height=0.55) code39 barcode
30 600 moveto (000102L3) (includetext height=0.55) code39 barcode
30 530 moveto (000103L3) (includetext height=0.55) code39 barcode
30 460 moveto (000104L3) (includetext height=0.55) code39 barcode
30 390 moveto (000105L3) (includetext height=0.55) code39 barcode
30 320 moveto (000106L3) (includetext height=0.55) code39 barcode
30 250 moveto (000107L3) (includetext height=0.55) code39 barcode
30 180 moveto (000108L3) (includetext height=0.55) code39 barcode
30 110 moveto (000109L3) (includetext height=0.55) code39 barcode
30 40 moveto (000110L3) (includetext height=0.55) code39 barcode
220 740 moveto (000111L3) (includetext height=0.55) code39 barcode
220 670 moveto (000112L3) (includetext height=0.55) code39 barcode
220 600 moveto (000113L3) (includetext height=0.55) code39 barcode
220 530 moveto (000114L3) (includetext height=0.55) code39 barcode
220 460
Re: [PHP] Filtering all output to STDERR
You could consider suppressing errors for the duration of the problematic call - if indeed you're looking at a warning that doesn't grind everything to a halt. On 22 March 2010 18:01, Marten Lehmann lehm...@cnm.de wrote: Hello, we have a strange problem here: - Our ISP is merging STDERR and STDOUT to STDOUT - We are calling a non-builtin function within PHP 5.2 which includes a lot of code and calls a lot of other functions - When calling this function, we receive the output Cannot open on STDERR. But since STDERR and STDOUT are merged, this Cannot open breaks the required HTTP-header which needs to be sent first. We really tried a lot to find out where this message comes from, we even used strace and ran PHP on the command line. But we cannot figure out the origin, so all we want to do is to get rid of the output sent to STDERR. We tried to close STDERR, but it didn't work out. We thought of using ob_start() and ob_end_clean(), but we cannot get it working with STDERR. Any ideas? Kind regards Marten -- PHP General Mailing List (http://www.php.net/) To unsubscribe, visit: http://www.php.net/unsub.php -- hype WWW: http://plphp.dk / http://plind.dk LinkedIn: http://www.linkedin.com/in/plind Flickr: http://www.flickr.com/photos/fake51 BeWelcome: Fake51 Couchsurfing: Fake51 /hype -- PHP General Mailing List (http://www.php.net/) To unsubscribe, visit: http://www.php.net/unsub.php
Re: [PHP] Global Var Disappearing After Function
On Mon, 22 Mar 2010 16:58:33 -0400 APseudoUtopia apseudouto...@gmail.com wrote: Hey list, I have a very odd problem which has been driving me crazy for two days. I've been trying to debug my code and gave up. I finally coded a very simple representation of what the code does, and I get the same problem. However, I still don't understand what's causing it. The representational code: http://pastie.org/private/fz3lgvsjopz3dhid8cf9a As you can see, it's very simple. A variable is set, then a function is called which modifies the variable in the global scope. However, the modifications CANNOT BE SEEN after the function is called. The output from the script is here: http://pastie.org/private/29r5mrr1k7rtqmw7eyoja As you can see, the modifications in do_test() cannot be seen after the function is called. What is causing this? And how can I fix it? Thanks! From PHP.net: If a globalized variable is unset() inside of a function, only the local variable is destroyed. The variable in the calling environment will retain the same value as before unset() was called. [1] [1] http://php.net/manual/en/function.unset.php -- Peter van der Does GPG key: E77E8E98 IRC: Ganseki on irc.freenode.net Twitter: @petervanderdoes WordPress Plugin Developer Blog: http://blog.avirtualhome.com Forums: http://forums.avirtualhome.com Twitter: @avhsoftware -- PHP General Mailing List (http://www.php.net/) To unsubscribe, visit: http://www.php.net/unsub.php
Re: [PHP] Filtering all output to STDERR
Have you tried with http://dk2.php.net/manual/en/function.error-reporting.php or just the @ operator? On 22 March 2010 23:56, Marten Lehmann lehm...@cnm.de wrote: Hello, You could consider suppressing errors for the duration of the problematic call yes, but how? Regards Marten -- PHP General Mailing List (http://www.php.net/) To unsubscribe, visit: http://www.php.net/unsub.php -- hype WWW: http://plphp.dk / http://plind.dk LinkedIn: http://www.linkedin.com/in/plind Flickr: http://www.flickr.com/photos/fake51 BeWelcome: Fake51 Couchsurfing: Fake51 /hype -- PHP General Mailing List (http://www.php.net/) To unsubscribe, visit: http://www.php.net/unsub.php
Re: [PHP] no svn checkout of the current PHP development repo?
You should probably have a look at the internals list - there's a lot of discussion going on as to what should happen in terms of SVN structure. Regards Peter On 20 March 2010 12:32, Robert P. J. Day rpj...@crashcourse.ca wrote: just for fun, i figured i'd check out the current PHP development stream. however, if you read the web page here: http://php.net/svn.php there's no mention of the trunk, simply references to branches such as 5.2 and 5.3. i popped over to: http://svn.php.net/viewvc/php/php-src/ and, sure enough, there's no trunk directory. am i just missing something? because if i click on the PHP 6 link up there on the right (which represents exactly what i'd expect for the URL of the trunk), bad things happen: An Exception Has Occurred Unknown location: /php/php-src/trunk HTTP Response Status 404 Not Found thoughts? i'll assume this is just a temporary thing but, in any event, if the trunk is normally available, the PHP svn page should really mention it explicitly, not just the 5.x branches. rday -- Robert P. J. Day Waterloo, Ontario, CANADA Linux Consulting, Training and Kernel Pedantry. Web page: http://crashcourse.ca Twitter: http://twitter.com/rpjday -- PHP General Mailing List (http://www.php.net/) To unsubscribe, visit: http://www.php.net/unsub.php -- hype WWW: http://plphp.dk / http://plind.dk LinkedIn: http://www.linkedin.com/in/plind Flickr: http://www.flickr.com/photos/fake51 BeWelcome: Fake51 Couchsurfing: Fake51 /hype -- PHP General Mailing List (http://www.php.net/) To unsubscribe, visit: http://www.php.net/unsub.php
Re: [PHP] web sniffer
You should be able to do that by setting context options: http://www.php.net/manual/en/context.http.php On 19 March 2010 08:53, Jochen Schultz jschu...@sportimport.de wrote: Btw., when you use file_get_contets, is there a good way to tell the script to stop recieving the file after let's say 2 seconds - just in case the server is not reachable - to avoid using fsockopen? regards Jochen madunix schrieb: okay ..it works now i use ?php $data=file_get_contents(http://www.my.com;); echo $data; ? On Fri, Mar 19, 2010 at 12:32 AM, Adam Richardson simples...@gmail.com wrote: On Thu, Mar 18, 2010 at 6:08 PM, Ashley Sheridan a...@ashleysheridan.co.uk wrote: On Fri, 2010-03-19 at 00:11 +0200, madunix wrote: trying http://us3.php.net/manual/en/function.fsockopen.php do you a piece of code that read parts pages. On Fri, Mar 19, 2010 at 12:00 AM, Ashley Sheridan a...@ashleysheridan.co.uk wrote: On Fri, 2010-03-19 at 00:03 +0200, madunix wrote: I've been trying to read the contents from a particular URL into a string in PHP, and can't get it to work. any help. Thanks -- If there is a way, I will find one...*** If there is none, I will make one...*** madunix ** How have you been trying to do it so far? There are a couple of ways. file_get_contents() and fopen() will work on URL's if the right ports are open. Most usually though cURL is used for this sort of thing. Thanks, Ash http://www.ashleysheridan.co.uk -- If there is a way, I will find one...*** If there is none, I will make one...*** madunix ** I think you're over-complicating things by using fsockopen(). Try one of the functions I mentioned in my last email Thanks, Ash http://www.ashleysheridan.co.uk I agree with Ashley, use one of the other options and then parse the response to get the part of the page you'd like to work with. -- Nephtali: PHP web framework that functions beautifully http://nephtaliproject.com -- Sport Import GmbH - Amtsgericht Oldenburg - Tel: +49-4405-9280-63 Industriestrasse 39 - HRB 1202900 - 26188 Edewecht - GF: Michael Müllmann -- PHP General Mailing List (http://www.php.net/) To unsubscribe, visit: http://www.php.net/unsub.php -- hype WWW: http://plphp.dk / http://plind.dk LinkedIn: http://www.linkedin.com/in/plind Flickr: http://www.flickr.com/photos/fake51 BeWelcome: Fake51 Couchsurfing: Fake51 /hype -- PHP General Mailing List (http://www.php.net/) To unsubscribe, visit: http://www.php.net/unsub.php
Re: [PHP] Re: PHP in HTML code
On 19 March 2010 10:17, Michael A. Peters mpet...@mac.com wrote: I don't care what people do in their code. I do not like released code with short tags, it has caused me problems when trying to run php webapps that use short tags, I have to go through the code and change them. So what people do with their private code, I could care less about. But if releasing php code for public consumption, I guess I'm a preacher asking people to get religion, because short tags do not belong in projects that are released to the public. Just like addslashes and magic quotes and most html entities should not be used in php code released for public consumption. What he said. Now, could we get over this discussion? It's not exactly going anywhere. -- hype WWW: http://plphp.dk / http://plind.dk LinkedIn: http://www.linkedin.com/in/plind Flickr: http://www.flickr.com/photos/fake51 BeWelcome: Fake51 Couchsurfing: Fake51 /hype -- PHP General Mailing List (http://www.php.net/) To unsubscribe, visit: http://www.php.net/unsub.php
Re: [PHP] Need routine to tell me number of dimensions in array.
This is one example where references actually decrease memory usage.
The main reason is the recursive nature of the function. Try
?php
echo memory_get_usage() . PHP_EOL;
$array = range(0,100);
$array[10] = range(0,10);
$array[20] = range(0,10);
$array[30] = range(0,10);
$array[40] = range(0,10);
$array[50] = range(0,10);
$array[60] = range(0,10);
$array[70] = range(0,10);
$array[80] = range(0,10);
$array[90] = range(0,10);
$array[100] = range(0,10);
echo memory_get_usage() . PHP_EOL;
carray($array);
function carray ($array)
{
foreach ($array as $value)
{
if (is_array($value)) carray($value);
}
echo memory_get_usage() . PHP_EOL;
echo count($array) . PHP_EOL;
}
echo memory_get_usage() . PHP_EOL;
And then compare with:
?php
echo memory_get_usage() . PHP_EOL;
$array = range(0,100);
$array[10] = range(0,10);
$array[20] = range(0,10);
$array[30] = range(0,10);
$array[40] = range(0,10);
$array[50] = range(0,10);
$array[60] = range(0,10);
$array[70] = range(0,10);
$array[80] = range(0,10);
$array[90] = range(0,10);
$array[100] = range(0,10);
echo memory_get_usage() . PHP_EOL;
carray($array);
function carray ($array)
{
$i = 0;
foreach ($array as $value)
{
if (is_array($value)) carray($value);
}
echo memory_get_usage() . PHP_EOL;
echo count($array) . PHP_EOL;
}
echo memory_get_usage() . PHP_EOL;
The memory usage spikes in the first example when you hit the second
array level - you don't see the same spike in the second example.
Regards
Peter
On 16 March 2010 15:46, Robert Cummings rob...@interjinn.com wrote:
Richard Quadling wrote:
On 15 March 2010 23:45, Daevid Vincent dae...@daevid.com wrote:
Anyone have a function that will return an integer of the number of
dimensions an array has?
/**
* Get the maximum depth of an array
*
* @param array $Data A reference to the data array
* @return int The maximum number of levels in the array.
*/
function arrayGetDepth(array $Data) {
static $CurrentDepth = 1;
static $MaxDepth = 1;
array_walk($Data, function($Value, $Key) use($CurrentDepth,
$MaxDepth) {
if (is_array($Value)) {
$MaxDepth = max($MaxDepth, ++$CurrentDepth);
arrayGetDepth($Value);
--$CurrentDepth;
}
});
return $MaxDepth;
}
Extending Jim and Roberts comments to this. No globals. By using a
reference to the array, large arrays are not copied (memory footprint
is smaller).
Using a reference actually increases overhead. References in PHP were mostly
useful in PHP4 when assigning objects would cause the object to be copied.
But even then, for arrays, a Copy on Write (COW) strategy was used (and is
still used) such that you don't copy any values. Try it for yourself:
?php
$copies = array();
$string = str_repeat( '*', 100 );
echo memory_get_usage().\n;
for( $i = 0; $i 1000; $i++ )
{
$copies[] = $string;
}
echo memory_get_usage().\n;
?
Cheers,
Rob.
--
http://www.interjinn.com
Application and Templating Framework for PHP
--
PHP General Mailing List (http://www.php.net/)
To unsubscribe, visit: http://www.php.net/unsub.php
--
hype
WWW: http://plphp.dk / http://plind.dk
LinkedIn: http://www.linkedin.com/in/plind
Flickr: http://www.flickr.com/photos/fake51
BeWelcome: Fake51
Couchsurfing: Fake51
/hype
--
PHP General Mailing List (http://www.php.net/)
To unsubscribe, visit: http://www.php.net/unsub.php
Re: [PHP] Need routine to tell me number of dimensions in array.
Hmm, will probably have to look inside PHP for this ... the foreach loop will copy each element as it loops over it (without actually copying, obviously), however there's no change happening to the element at any point and so there's nothing to suggest to the copy-on-write to create a new instance of the sub-array. It should look like this: $a = array(0, 1, 2, array(0, 1, 2, 3), 4, 5, 6, n); $b = $a[3]; doStuffs($b); Whether or not you loop over $a and thus move the internal pointer, you don't change (well, shouldn't, anyway) $b as that's a subarray which has it's own internal pointer, that isn't touched. Or maybe I've gotten this completely backwards ... Regards Peter On 16 March 2010 17:12, Robert Cummings rob...@interjinn.com wrote: Peter Lind wrote: This is one example where references actually decrease memory usage. The main reason is the recursive nature of the function. Try BTW, it's not the recursive nature of the function causing the problem. It's the movement of the internal pointer within the array. When it moves the COW realizes the copy's pointer has moved and splits off the copy. You can verify this by echoing the memory usage when you first enter carray(). The spike occurs inside the foreach loop. Cheers, Rob. -- http://www.interjinn.com Application and Templating Framework for PHP -- PHP General Mailing List (http://www.php.net/) To unsubscribe, visit: http://www.php.net/unsub.php -- hype WWW: http://plphp.dk / http://plind.dk LinkedIn: http://www.linkedin.com/in/plind Flickr: http://www.flickr.com/photos/fake51 BeWelcome: Fake51 Couchsurfing: Fake51 /hype -- PHP General Mailing List (http://www.php.net/) To unsubscribe, visit: http://www.php.net/unsub.php
Re: [PHP] ldap_bind() connectivity
You might want to check what the function outputs with:
var_dump($ldapbind);
after the call to ldap_bing(). That way you'll know what actually got
returned from the function.
On 15 March 2010 09:54, Ashley M. Kirchner ash...@pcraft.com wrote:
Thanks to Jochem Mass for helping earlier to the string splitting. Works
great (so far). Now on to my next problem, which has to do with
ldap_bind().
I have the following code:
$ldapconn = @ldap_connect($adServer);
$ldapbind = ldap_bind($ldapconn, $ldapuser, $ldappass);
if ($ldapbind) {
/** Successful authentication **/
$_SESSION['username'] = $username;
$_SESSION['password'] = $password;
} else {
/** Authentication failure **/
$form-setError($field, laquo; Invalid username or password
raquo;);
}
ldap_unbind($ldapconn);
The problem with this is that if the ldap_bind() fails in the second line,
it instantly spits text out to the browser:
Warning: ldap_bind() [function.ldap-bind
http://www.smartroute.org/contest/include/function.ldap-bind ]: Unable to
bind to server: Invalid credentials in /home/contest/include/session.php on
line 351
And because it does that, it never reaches the if routine right below it and
everything just bombs. If I call it with @ldap_bind($ldapconn .) nothing
happens. The error message gets suppressed but it also doesn't do anything
with the if routine afterwards. It's almost like $ldapbind isn't getting
set at all.
What am I missing here?
--
hype
WWW: http://plphp.dk / http://plind.dk
LinkedIn: http://www.linkedin.com/in/plind
Flickr: http://www.flickr.com/photos/fake51
BeWelcome: Fake51
Couchsurfing: Fake51
/hype
--
PHP General Mailing List (http://www.php.net/)
To unsubscribe, visit: http://www.php.net/unsub.php
Re: [PHP] Change displayed file name to download
You can set the name to display as you see fit, just change $filename to your liking right before the header() call. If you just want to cut the path, use basename($filename) Regards Peter On 14 March 2010 21:29, Php Developer pdevelo...@rocketmail.com wrote: Hi, I'm using the following code: $fp = fopen($filename, 'r+'); $content = fread($fp, filesize($filename)); fclose($fp); header(Content-type: application/msword); header(Content-Disposition: attachment; filename=$filename); echo $content; exit; ___ Now when downloading a file the default name that appears for the user is the realname of the file i the server with the real path the only difference is that the slashes are modified by underscore. My question is: is there any way how to control the name that will be displayed for the customer? Or at least skip the path and display just the file's name? Thank you __ Be smarter than spam. See how smart SpamGuard is at giving junk email the boot with the All-new Yahoo! Mail. Click on Options in Mail and switch to New Mail today or register for free at http://mail.yahoo.ca -- hype WWW: http://plphp.dk / http://plind.dk LinkedIn: http://www.linkedin.com/in/plind Flickr: http://www.flickr.com/photos/fake51 BeWelcome: Fake51 Couchsurfing: Fake51 /hype -- PHP General Mailing List (http://www.php.net/) To unsubscribe, visit: http://www.php.net/unsub.php
[PHP] Using ArrayObject
What is the advantage of using ArrayObject to build a Registry class? -- Peter van der Does GPG key: E77E8E98 IRC: Ganseki on irc.freenode.net Twitter: @petervanderdoes WordPress Plugin Developer Blog: http://blog.avirtualhome.com Forums: http://forums.avirtualhome.com Twitter: @avhsoftware -- PHP General Mailing List (http://www.php.net/) To unsubscribe, visit: http://www.php.net/unsub.php
[PHP] Registry class question.
Hi,
I've build a registry class to store settings I need to use in several
other classes.
Currently I've set it up with a static array in the registry class and
using two methods to access the settings and values
storeSetting($key,$value) {
$this-_settings[$key] = $value;
}
getSetting($key) {
return $this-_settings[$key];
}
The question is what the pros and cons are compared to setting a new
property with the value, like:
storeSetting($key,$value) {
$this-$key = $value;
}
and then instead of calling getSetting, you just use
$this-Registry-property
--
Peter van der Does
GPG key: E77E8E98
IRC: Ganseki on irc.freenode.net
Twitter: @petervanderdoes
WordPress Plugin Developer
Blog: http://blog.avirtualhome.com
Forums: http://forums.avirtualhome.com
Twitter: @avhsoftware
--
PHP General Mailing List (http://www.php.net/)
To unsubscribe, visit: http://www.php.net/unsub.php
Re: [PHP] Stored Proc - Date not inserting into the Record
Change the input argument type as a varchar instead of date
Ex:
CREATE definer=`do...@`` PROCEDURE `Insert_OHC_Sun`(theDate
VARCHAR(50),theDateRaw INT)
surly it will work
- Peter
Don Wieland wrote:
I nave 2 stored procedures:
DROP PROCEDURE IF EXISTS `Insert_OHC_Sun`;
DELIMITER $$
CREATE definer=`do...@`` PROCEDURE `Insert_OHC_Sun`(theDate
DATE,theDateRaw INT)
BEGIN
INSERT INTO Office_Hours_Cuttoff
(ohc_Date,ohc_Date_Raw,Office_Status)
VALUES (theDate,theDateRaw,Closed);
END
$$
DROP PROCEDURE IF EXISTS `Insert_OHC_Day`;
DELIMITER $$
CREATE definer=`do...@`` PROCEDURE `Insert_OHC_Day`(theDate
DATE,theDateRaw INT)
BEGIN
INSERT INTO Office_Hours_Cuttoff (ohc_Date,ohc_Date_Raw)
VALUES (theDate,theDateRaw);
END
$$
Then I have PHP Code to insert a YEAR of days in a table:
if($_POST['new_year']) {
//New Year
if(in_array($_POST['pick_year'], $ExistingYears)) {
$Message = brThe year .$_POST['pick_year']. is already
existing.brPlease use the DELETE YEAR feature first. Then ADD the
year again.br;
} else {
//Add Year
$first_day = mktime(0,0,0,1, 1, $_POST['pick_year']);
$last_day = mktime(0,0,0,12, 31, $_POST['pick_year']);
$cDate = $first_day;
$num = 1;
while($cDate = $last_day) {
$nDate = Date('Y-m-d', $cDate);
$db-next_result();
if(date('D', $cDate) == Sun) {
$db-query(CALL Insert_OHC_Sun({$nDate},{$cDate}));
}else{
$db-query(CALL Insert_OHC_Day({$nDate},{$cDate}));
}
$cDate+=86400;
$num++;
}
}
}
The records are inserting into the table BUT the field och_Dates is
not getting the proper value. It gets -00-00.
Frustrating. My code looks right and I echoed the value on the page
and it is formatted properly. The field in mySQL is formatted as a
DATE type.
Little help please :-)
Don Wieland
D W D a t a C o n c e p t s
~
d...@dwdataconcepts.com
Direct Line - (949) 305-2771
Integrated data solutions to fit your business needs.
Need assistance in dialing in your FileMaker solution? Check out our
Developer Support Plan at:
http://www.dwdataconcepts.com/DevSup.html
Appointment 1.0v9 - Powerful Appointment Scheduling for FileMaker Pro
9 or higher
http://www.appointment10.com
For a quick overview -
http://www.appointment10.com/Appt10_Promo/Overview.html
--
PHP General Mailing List (http://www.php.net/)
To unsubscribe, visit: http://www.php.net/unsub.php
Re: [PHP] Stored Proc - Date not inserting into the Record
FYI
Please Pass your input within quotes
$db-query(CALL Insert_OHC_Sun(*'*{$nDate}*'*,{$cDate}));
surly it will work
- Peter
Don Wieland wrote:
I nave 2 stored procedures:
DROP PROCEDURE IF EXISTS `Insert_OHC_Sun`;
DELIMITER $$
CREATE definer=`do...@`` PROCEDURE `Insert_OHC_Sun`(theDate
DATE,theDateRaw INT)
BEGIN
INSERT INTO Office_Hours_Cuttoff
(ohc_Date,ohc_Date_Raw,Office_Status)
VALUES (theDate,theDateRaw,Closed);
END
$$
DROP PROCEDURE IF EXISTS `Insert_OHC_Day`;
DELIMITER $$
CREATE definer=`do...@`` PROCEDURE `Insert_OHC_Day`(theDate
DATE,theDateRaw INT)
BEGIN
INSERT INTO Office_Hours_Cuttoff (ohc_Date,ohc_Date_Raw)
VALUES (theDate,theDateRaw);
END
$$
Then I have PHP Code to insert a YEAR of days in a table:
if($_POST['new_year']) {
//New Year
if(in_array($_POST['pick_year'], $ExistingYears)) {
$Message = brThe year .$_POST['pick_year']. is already
existing.brPlease use the DELETE YEAR feature first. Then ADD the
year again.br;
} else {
//Add Year
$first_day = mktime(0,0,0,1, 1, $_POST['pick_year']);
$last_day = mktime(0,0,0,12, 31, $_POST['pick_year']);
$cDate = $first_day;
$num = 1;
while($cDate = $last_day) {
$nDate = Date('Y-m-d', $cDate);
$db-next_result();
if(date('D', $cDate) == Sun) {
$db-query(CALL Insert_OHC_Sun({$nDate},{$cDate}));
}else{
$db-query(CALL Insert_OHC_Day({$nDate},{$cDate}));
}
$cDate+=86400;
$num++;
}
}
}
The records are inserting into the table BUT the field och_Dates is
not getting the proper value. It gets -00-00.
Frustrating. My code looks right and I echoed the value on the page
and it is formatted properly. The field in mySQL is formatted as a
DATE type.
Little help please :-)
Don Wieland
D W D a t a C o n c e p t s
~
d...@dwdataconcepts.com
Direct Line - (949) 305-2771
Integrated data solutions to fit your business needs.
Need assistance in dialing in your FileMaker solution? Check out our
Developer Support Plan at:
http://www.dwdataconcepts.com/DevSup.html
Appointment 1.0v9 - Powerful Appointment Scheduling for FileMaker Pro
9 or higher
http://www.appointment10.com
For a quick overview -
http://www.appointment10.com/Appt10_Promo/Overview.html
[PHP] Re: logic operands problem
Merlin Morgenstern wrote: Hello everybody, I am having trouble finding a logic for following problem: Should be true if: page = 1 OR page = 3, but it should also be true if page = 2 OR page = 3 The result should never contain 1 AND 2 in the same time. This obviously does not work: (page = 1 OR page = 3) OR (page = 2 OR page = 3) This also does not work: (page = 1 OR page = 3 AND page != 2) OR (page = 2 OR page = 3 AND page != 1) Has somebody an idea how to solve this? Thank you in advance for any help! Merlin Surely what you need is xor (exclusive-or) I can't believe a programmer has never heard of that! (page==1 XOR page==2) AND page==3 -- Peter Ford phone: 01580 89 Developer fax: 01580 893399 Justcroft International Ltd., Staplehurst, Kent -- PHP General Mailing List (http://www.php.net/) To unsubscribe, visit: http://www.php.net/unsub.php
[PHP] Re: Class not returning value
Pieter du Toit wrote:
Hi
This is my first class and it does not work, i do a return
$this-responseArray; with the public function getResult() method, but get
nothing. Can someone please help me.
Thsi is how i create the object
$number = new Smsgate($cell_numbers, $message, 27823361602, 27);
$result = $number-getResult();
Here is the code:
?php
/**
*
* @version 1.0
* @copyright 2009
*/
/**
*/
class Smsgate {
protected $number;
protected $message;
protected $sender_id;
protected $tofind;
private $result;
/**
* Constructor
*/
function __construct($number = , $message = , $sender_id = ,
$tofind = )
{
$this-message = $message;
$this-number = $number;
$this-sender_id = $sender_id;
$this-tofind = $tofind;
}
protected function display ($result)
{
return $result;
}
public function getResult()
{
return $this-processRequest();
}
public function numberErrors()
{
return $this-errorResult;
}
/**
* Smsgate::checknumbers()
*
* @return array of correct and incorrect formatted numbers
*/
private function processRequest()
{
echo nou by numers;
print_r($this-number);
// check if the property is an array and add to new array for
sending
if (is_array($this-number)) {
// check for starting digits
$this-result = ;
// loop through numbers and check for errors
foreach ($this-number as $this-val) {
$this-position = strpos($this-val , $this-tofind);
// number correct
if ($this-position === 0) {
echo is integer br/;
if ($this-result != ) {
$this-result .= ,;
}
// create comma seperated numbers to send as bulk in
sendSMS method
$this-result .= $this-val; //infobip multiple
recipients must be seperated by comma
// create an array to use with responseStringExplode in
sendSMS method
$this-cellarray[] = $this-val;
echo Result is . $this-result . br;
} else {
// numbers not in correct format
$this-errorResult[] = $this-val;
}
} //end foreach
$this-sendSMS();
} else {
$this-result = Not ok;
return $this-result;
}
}
private function sendSMS()
{
$this-smsUrl =
'http://www.infobip.com/Addon/SMSService/SendSMS.aspx?user=password=';
$this-post_data = 'sender=' . $this-sender_id . 'SMSText=' .
urlencode($this-message) . 'IsFlash=0GSM=' . $this-result;
$this-sendData = $this-sendWithCurl($this-smsUrl,
$this-post_data);
$this-responseStringExplode = explode(\n, $this-sendData);
$count=0;
foreach ($this-responseStringExplode as $this-rvalue) {
$this-responseArray[$this-rvalue] = ($this-cellarray[$count]);
$count = ++$count;
}
return $this-responseArray;
}
private function sendWithCurl($url, $postData) {
if (!is_resource($this-connection_handle)) {
// Try to create one
if (!$this-connection_handle = curl_init()) {
trigger_error('Could not start new CURL instance');
$this-error = true;
return;
}
}
curl_setopt($this-connection_handle, CURLOPT_URL, $url);
curl_setopt ($this-connection_handle, CURLOPT_POST, 1);
$post_fields = $postData;
curl_setopt ($this-connection_handle, CURLOPT_POSTFIELDS, $post_fields);
curl_setopt($this-connection_handle, CURLOPT_RETURNTRANSFER, 1);
$this-response_string = curl_exec($this-connection_handle);
curl_close($this-connection_handle);
return $this-response_string;
}
}
?
Based on a first scan of your code, it looks like the only return in
processRequest() is inside the else block, so nothing is returned unless the
processing fails.
--
Peter Ford phone: 01580 89
Developer fax: 01580 893399
Justcroft International Ltd., Staplehurst, Kent
--
PHP General Mailing List (http://www.php.net/)
To unsubscribe, visit: http://www.php.net/unsub.php
[PHP] Does PHP block requests?
I have a tricky problem.
I'm trying to make a progress feedback mechanism to keep users informed about a
slowish process on the server end of a web app. The backend is generating a PDF
file from a bunch of data which extends to many pages. I can keep tabs on the
progress of this generation by working out how many lines of data is present,
and how much of it has been processed. I use that information to set a session
variable with a unique name - so for each step I set
$_SESSION['some-unique-name']=Array('total'=$totalLines,'count'=$linesProcessedSoFar);
Now on the front end I'm doing an AJAX call to a script that just encodes this
session variable into a JSON string and sends it back.
The problem is that while the PDF is being generated, the AJAX calls to get the
progress data (on a 1-second interval) are being blocked and I don't get why.
The PDF generation is also triggered by an AJAX call to a script which generates
the PDF in a given file location, then returns a URL to retrieve it with.
So it appears that the problem is that I can't have two AJAX calls to different
PHP scripts at the same time? WTF?
Checking the requests with Wireshark confirms the the browser is certainly
sending the progress calls while the original PDF call is waiting, so it's not
the browser side that's the problem: and once the PDF call is finished the
outstanding progress calls are all serviced (returning 100% completion of course
- not much use!) Different browsers (Firefox, IE, Chrome at least) give the same
result.
For reference, the server is Apache 2.2.10 on a SuSE linux 11.1 box using
mod_php5 and mpm_prefork - is that part of the problem, and is there an
alternative?
--
Peter Ford phone: 01580 89
Developer fax: 01580 893399
Justcroft International Ltd., Staplehurst, Kent
--
PHP General Mailing List (http://www.php.net/)
To unsubscribe, visit: http://www.php.net/unsub.php
Re: [PHP] Lightweight web server for Windows?
O. Lavell wrote: Also, it is not for daily use. I have two desktop computers and a server for that. This is for when I have to go by train or something. Essentially it is just an extra plaything. Does the battery still hold enough charge for a train journey - that always seems to be the first thing that goes on old laptops. They make really good low-power servers for stuff like DNS or even firewalling (as long as you can plug in enough network cards), but only when on mains power :( -- Peter Ford phone: 01580 89 Developer fax: 01580 893399 Justcroft International Ltd., Staplehurst, Kent -- PHP General Mailing List (http://www.php.net/) To unsubscribe, visit: http://www.php.net/unsub.php
[PHP] How to call DLL in Javascript
Hi All,
I want to call dll in javascript
I tried the following script, but i got the error message 'ActiveXObject
is undefined'
(Note : i have the feedback.dll in the same path only)
HTML
HEAD
script type='text/javascript' language='javascript'
function comEventOccured()
{
try{
var myobject;
myobject = new ActiveXObject(feedback.dll);
}catch(e){
alert(e.description);
return false;
}
}
/script/head
body
input type=button value=Call the DLL onClick=comEventOccured()
/body
/html
Regards
Peter.
--
PHP General Mailing List (http://www.php.net/)
To unsubscribe, visit: http://www.php.net/unsub.php
[PHP] How to call a vc++ dll from a HTML form
Thanks to All.
I want to call a vc++ dll from a HTML form. The dll need to be triggered
on a button click in the HTML form.
I want to access the dll from the client end(javascrript) without using
the server.
Tell me whether its possible to call dll directly or through any interface ?
Please provide me your valuable inputs to solve this issue.
Regards
Peter
Nathan Rixham wrote:
Peter wrote:
Hi All,
I want to call dll in javascript
I tried the following script, but i got the error message 'ActiveXObject
is undefined'
(Note : i have the feedback.dll in the same path only)
HTML
HEAD
script type='text/javascript' language='javascript'
function comEventOccured()
{
try{
var myobject;
myobject = new ActiveXObject(feedback.dll);
}catch(e){
alert(e.description);
return false;
}
}
/script/head
body
input type=button value=Call the DLL onClick=comEventOccured()
/body
/html
Regards
Peter.
usually .dll should be running client side not server side
jscript and javascript are two different beasts based on ecmascript;
you'll be wanting to get some JScript (microsofts own version) help for
this.. http://msdn.microsoft.com/en-us/library/7sw4ddf8%28VS.85%29.aspx
but as somebody else mentioned, you won't get it working on all browsers
AFAIK.. so running DLL on server side and calling wrapper functions via
ajax is more appropriate.
an asp.net forum or suchlike will probably yield a more useful response
regards
[PHP] Re: fread() memory problems
Ashley Sheridan wrote: Ashley Sheridan wrote: I was just wondering why fread() seems to use so much memory when reading in a file. My php.ini has a script memory limit of 32MB, yet PHP hits its memory limit on a 19MB mbox file that I'm reading in. How is it possible that this function can use 150% of a files' size in memory?! Thanks, Ash http://www.ashleysheridan.co.uk Is it possible that the file is 8-bit characters and your PHP implementation is converting it to 16-bit characters? I'm not sure what settings would be involved for that, but no-one else has responded so I thought a vague idea might be better than nothing! -- Peter Ford phone: 01580 89 Developer fax: 01580 893399 Justcroft International Ltd., Staplehurst, Kent -- PHP General Mailing List (http://www.php.net/) To unsubscribe, visit: http://www.php.net/unsub.php
Re: [PHP] Multilingual website, texts in external JavaScriptproblem
leledumbo wrote: I don't see why you can't use inline script in XHTML 1.0 Strict Because I don't know about CDATA, thanks. Glad to be of service! As another regular contributor to this list often points out, there's always something new to learn :) -- Peter Ford phone: 01580 89 Developer fax: 01580 893399 Justcroft International Ltd., Staplehurst, Kent -- PHP General Mailing List (http://www.php.net/) To unsubscribe, visit: http://www.php.net/unsub.php
Re: [PHP] Multilingual website, texts in external JavaScript problem
leledumbo wrote: I need to create a multilingual website and my framework already gives me that facility. However, I also use JavaScript quite extensively and since XHTML 1.0 Strict doesn't allow inline script, I must use external .js file. The problem is in these scripts, there are strings that needs to be translated as well. How can I make PHP parse these scripts as well? Or are there alternative approaches? I don't see why you can't use inline script in XHTML 1.0 Strict: just put the script in CDATA sections, like script type=text/javascript /*![CDATA[*/ // Inline javascript here /*]]*/ /script That seems to validate fine in XHTML 1.0 Strict for me... -- Peter Ford phone: 01580 89 Developer fax: 01580 893399 Justcroft International Ltd., Staplehurst, Kent -- PHP General Mailing List (http://www.php.net/) To unsubscribe, visit: http://www.php.net/unsub.php
Re: [PHP] Spam opinions please
Ashley Sheridan wrote: Won't stop a bot worth it's salt either, hence the need for more complex and confusing captchas. The best way to stop spam, is to use linguistic testing on the content being offered, which protects against bot and human spammer alike. Thanks, Ash http://www.ashleysheridan.co.uk Unfortunately, it might also confound someone who doesn't speak the language. Admittedly, they would probably already be struggling with the rest of the site... I guess locale-dependent captchas are a possibility. -- Peter Ford phone: 01580 89 Developer fax: 01580 893399 Justcroft International Ltd., Staplehurst, Kent -- PHP General Mailing List (http://www.php.net/) To unsubscribe, visit: http://www.php.net/unsub.php
[PHP] Re: Fun with XSLT
Matthew Croud wrote:
Hi Guys,
Well i;ve been slaving on with my PHP XML endeavors and i'm loving it,
just finishing the meaty parts of my XSLT for dummies book too.
I have a question which asks is it possible?.
Using XSLT I can collect specific parts of my XML using something sexy
like xsl:template match=umbungo. Lets say however, that I need to
use XSLT, but I would want the user to select which element they
request. In other words, they are given a form with options and that
form can manipulate the .XSL file.
Now I know it could be done in a lengthly manner by just opening the XSL
file and manipulating it like fopen or something like that, but is there
a way to somehow embed the contents of the xml into the php code (like
using EOF for html), and being able to substitute the template match
string for a variable ?
Any ideas ?
Thanks Gamesmaster,
Matt
A bit off-topic (since XSLT is not PHP...) but here goes.
First I need to clarify what you are doing -
xsl:template match=umbongo ... /xsl:template
defines the template portion, and that is pretty immutable.
At some point you must have in your XSLT something like
xsl:apply-templates select=umbongo/
This is the bit you can play with:
so:
xsl:stylesheet version=1.0 xmlns:xsl=http://www.w3.org/1999/XSL/Transform;
xsl:output method=xml encoding=UTF-8 / !-- or whatever --
!-- Pass in a parameter to the XSL to define which thing we want to match --
xsl:parameter name='matchMe'/
!-- Define templates for all the things we might want to match --
xsl:template match='umbongo'xsl:apply-templates//xsl:template
xsl:template match='fivealive'xsl:apply-templates//xsl:template
!-- etc. --
!-- now the clever bit --
xsl:template match='/'
xsl:apply-templates select='//*[name()=$matchMe]'/
/xsl:template
/xsl:stylesheet
Essentially you need to apply the template of any element, but only those whose
name matches your request.
Note that
xsl:apply-templates select='$matchMe]'/
doesn't work... :(
So now if your PHP does something like
$xslDom = new DOMDocument();
$xslDom-load('matchMe.xsl');
$xslt = new XSLTProcessor();
$xslt-importStylesheet($xslDom);
$xslt-setParameter('','matchMe','umbongo');
$xmlDom = new DOMDocument();
$xmlDom-load('some_document_that_has_an_umbongo_tag.xml');
echo $xslt-transformToXML($xmlDom);
you should get the results of the 'umbongo' template (only)
'f course, this is not tested, but I have used this idea in working code
--
Peter Ford phone: 01580 89
Developer fax: 01580 893399
Justcroft International Ltd., Staplehurst, Kent
--
PHP General Mailing List (http://www.php.net/)
To unsubscribe, visit: http://www.php.net/unsub.php
[PHP] Re: Fun with XSLT
Matthew Croud wrote:
Hi Guys,
Well i;ve been slaving on with my PHP XML endeavors and i'm loving it,
just finishing the meaty parts of my XSLT for dummies book too.
I have a question which asks is it possible?.
Using XSLT I can collect specific parts of my XML using something sexy
like xsl:template match=umbungo. Lets say however, that I need to
use XSLT, but I would want the user to select which element they
request. In other words, they are given a form with options and that
form can manipulate the .XSL file.
Now I know it could be done in a lengthly manner by just opening the XSL
file and manipulating it like fopen or something like that, but is there
a way to somehow embed the contents of the xml into the php code (like
using EOF for html), and being able to substitute the template match
string for a variable ?
Any ideas ?
Thanks Gamesmaster,
Matt
Despite my other post, of course you can generate the XSL on the fly:
?php
$choice='umbongo';
$xslScript EoXSL
xsl:stylesheet version=1.0 xmlns:xsl=http://www.w3.org/1999/XSL/Transform;
xsl:output method=xml encoding=UTF-8 /
xsl:template match='/'
xsl:apply-templates/
/xsl:template
xsl:template match='{$choice}'xsl:apply-templates//xsl:template
/xsl:stylesheet
EoXSL
$xslt = new DOMDocument();
$xslt-loadXML($xslScript);
// ... etc...
?
--
Peter Ford phone: 01580 89
Developer fax: 01580 893399
Justcroft International Ltd., Staplehurst, Kent
--
PHP General Mailing List (http://www.php.net/)
To unsubscribe, visit: http://www.php.net/unsub.php
Re: [PHP] Spam opinions please
On Tue, 20 Oct 2009 14:31:53 -0400
Gary gwp...@ptd.net wrote:
I have several sites that are getting hit with form spam. I have the
script set up to capture the IP address so I know from where they
come. I found a short script that is supposed to stop these IP
addresses from accessing the form page, it redirects the spammer to
another page (I was going to redirect to a page that has lots of
pop-ups, scantily clad men and offers of joy beyond imagination), but
someone suggested I redirect to the Federal Trade Commission or
perhpas the FBI.
Any thoughts on the script and its effectivness?
?php
$deny = array(111.111.111, 222.222.222, 333.333.333);
if (in_array ($_SERVER['REMOTE_ADDR'], $deny)) {
header(location: http://www.google.com/;);
exit();
} ?Gary
There are several options to stop spammers, although none of them will
completely eliminate all spam. For a forum I prefer the .htaccess
method.
There is a website dedicated to keeping track of forum spammers,
http://stopforumspam.com and depending on your forum you could add an
anti-spam mod that will query their database. On the site they have
mods for phpbb, vBulletin and SMF.
I wrote a Python script that uses a Python Library that's also posted
on their site. The Python program basically use an Apache log file for
the IP's checks them at Stop Forum Spam and adds spam IP in
the .htaccess file. I have it set up in cron to run daily.
For a little bit more detailed description and the program itself:
http://blog.avirtualhome.com/2009/10/08/stop-spammers-in-your-htaccess/
--
Peter van der Does
GPG key: E77E8E98
IRC: Ganseki on irc.freenode.net
Twitter: @petervanderdoes
WordPress Plugin Developer
Blog: http://blog.avirtualhome.com
Forums: http://forums.avirtualhome.com
Twitter: @avhsoftware
--
PHP General Mailing List (http://www.php.net/)
To unsubscribe, visit: http://www.php.net/unsub.php
[PHP] Re: avoid Denial of Service
Gerardo Benitez wrote: Hi everybody! I want to get some tips about how avoid a attack of Denial of service. May be somebody can about your experience with Php o some configuration of apache, o other software that help in these case. Thanks in advance. Unplug the network cable :) -- Peter Ford phone: 01580 89 Developer fax: 01580 893399 Justcroft International Ltd., Staplehurst, Kent -- PHP General Mailing List (http://www.php.net/) To unsubscribe, visit: http://www.php.net/unsub.php
[PHP] Re: php/mysql Query Question.
ad...@buskirkgraphics.com wrote: Before most of you go on a rampage of how to please read below... As most of you already know when using MySQL from the shell you can write your queries in html format in an out file. Example: shellmysql -uyourmom -plovesme --html This now will return all results in an html format from all queries. Now I could “tee” this to a file and save the results returned if I so choose to save the result of the display . Let’s say I want to be lazy and write a php MySQL query to do the same so that any result I queried for would return the html results in a table without actually writing the table tags in the results. Is there a mysql_connect or select_db or mysql_query tag option to do that since mysql can display it from the shell? I think you'll find that the HTML output is a function of the mysql command line program (I tend to use PostgreSQL, where 'psql' is a similar program) so you can only access that functionality by calling the command line. I suspect that, since PHP is a HTML processing language (originally), the creators of the mysql_ functions figured that the user could sort out making HTML from the data returned... It's should be a simple operation to write a wrapper function to put HTML around the results. There might even be a PEAR extension or PHPClasses class to do it (I haven't looked yet) -- Peter Ford phone: 01580 89 Developer fax: 01580 893399 Justcroft International Ltd., Staplehurst, Kent -- PHP General Mailing List (http://www.php.net/) To unsubscribe, visit: http://www.php.net/unsub.php
Re: [PHP] Return XML attribute in DOM
Matthew Croud wrote:
Doesn't the DOM have the getAttribute() method?
Thanks,
Ash
http://www.ashleysheridan.co.uk
It's not in my reference, though I see it in the PHP manual now.
This is what I have:
_
$dom = new DomDocument();
$dom - load(items.xml);
$topics = $dom - getElementsByTagName(item);
echo(ul);
foreach ($topics as $node )
{
echo(li. $node - hasAttributes() ./li);
}
echo(/ul);
__
I'm replacing hasAttributes() with getAttribute() but its throwing me an
error, I'm probably using it incorrectly.
I think I'm drowning in the deep end =/
Could you advise Gamesmaster ?
It's a method on DomElement:
http://uk3.php.net/manual/en/function.domelement-get-attribute.php
and you need to tell it which attribute to get... :)
--
Peter Ford phone: 01580 89
Developer fax: 01580 893399
Justcroft International Ltd., Staplehurst, Kent
--
PHP General Mailing List (http://www.php.net/)
To unsubscribe, visit: http://www.php.net/unsub.php
Re: [PHP] IRC and English
tedd wrote: At 2:02 PM -0700 9/1/09, Jessi Berkelhammer wrote: As a monolingual North American, I am also very uncomfortable with this thread. A rant about abbreviations/IRC jargon is an appropriate discussion for list, but criticizing how non-native English speakers write English is not. This thread began with a mention of the attitude that non-native English speakers have, as if non-native English speakers are a unified group that are are more likely to have a bad attitude than native English speakers. Of course such a generalization could make people uncomfortable. -jessi tedd wrote: At 11:16 AM -0300 9/1/09, Martin Scotta wrote: As a non-english speaker I feel very uncomfortable with this thread. You shouldn't feel uncomfortable because no one is talking about you. As a fellow monolingual North American, I feel very uncomfortable about your statement as well. Does any other monolingual North American feel the same way as I do? Please expound on your feelings about this most disheartening and distasteful topic. (Boy has this thread degenerated into some politically correct bullsh#t, huh?) Look if you are not the one using u as a substitute for you, then I don't see any support for the discomfort you may feel about this thread. But you are free to feel as it is your nature (shudder). If non-English users (or anyone else for that matter) want to use u for you that's fine -- but I'll refrain from helping them as well. I am sure that if I were writing in their language and shortened it to uncomprehending gibberish, I would receive the same treatment from them. Why is this so hard to understand -- am I using words that are two lengthy? Cheers, tedd Words that are two lengthy: of, an, to, it (etc.) Words that are too lengthy: antidisestablishmentarianism, internationalisation and that other one that begins with flocci... something Sorry tedd :) +1 on hating l33tsp34k and txtspk though (not tho). The American standardisation of English spelling did quite enough damage to the beautiful language of Shakespeare (who couldn't even spell his own name consistently), without any more neologisms creeping in. -- Peter Ford phone: 01580 89 Developer fax: 01580 893399 Justcroft International Ltd., Staplehurst, Kent -- PHP General Mailing List (http://www.php.net/) To unsubscribe, visit: http://www.php.net/unsub.php
Re: [PHP] CodeWorks 09
Jim Lucas wrote: Elizabeth Naramore wrote: Hey all, Just wanted to make sure you knew about php|architect's upcoming CodeWorks conference, coming to 7 cities in 14 days: - San Francisco, CA: Sept 22-23 - Los Angeles, CA: Sept 24-25 - Dallas, TX: Sept 26-27 - Atlanta, GA: Sept 28-29 - Miami, FL: Sept 30 - Oct 1 - Washington, DC: Oct 2-3 - New York, NY: Oct 4-5 Each two-day event includes a day of *in-depth PHP tutorials* and a day of *PHP conference talks* arranged across three different tracks, all presented by the *best experts* in the business. Each event is limited to 300 attendees and prices increase the closer we get to each event. Get your tickets today before we run out or the price goes up! For more information and to register, you can go to http://cw.mtacon.com. Hope to see you there! -Elizabeth Is their anything like this in the Pacific NORTH WEST?? Seattle or Portland Oregon area would be great! Or even in the rest of the world - PHP is bigger than just the USA :) -- Peter Ford phone: 01580 89 Developer fax: 01580 893399 Justcroft International Ltd., Staplehurst, Kent -- PHP General Mailing List (http://www.php.net/) To unsubscribe, visit: http://www.php.net/unsub.php
Re: [PHP] Re: unset() something that doesn't exist
Stuart wrote: (among other things) If you ask me you are essentially describing engineers (or doers) as idiots and salespeople as morons. I won't debate the labels but unfortunately it's a fact of life that most management types in this world are ex-sales because they're the ones who know how to use their skills to further their career which them in a position to favour sales over engineering when it comes to salary and rewards. I think you'll find it's because the engineers like engineering and not managing, so they (if they can get away with it) avoid or decline the opportunities for promotion to management. ISTR the Royal Air Force has a Specialist Aircrew track where the really good pilots, who wanted to fly planes rather than desks, could be promoted to management ranks but avoid the management duties. I had the pleasure of meeting one of these chaps when I was at university - he had more flying hours than I had lived and flown just about everything with wings. A superb instructor, but far too much of a livewire to be a manager... -- Peter Ford phone: 01580 89 Developer fax: 01580 893399 Justcroft International Ltd., Staplehurst, Kent -- PHP General Mailing List (http://www.php.net/) To unsubscribe, visit: http://www.php.net/unsub.php
Re: [PHP] SESSIONS lost sometimes
Leon du Plessis wrote: It's not an issue, it's a feature. Thanks Arno...but it is a pain also. If I work with user A in Tab1 (window1), I want to work with user B separately in Tab2. When user in Tab2 logs off, I still want user A to work, and not suddenly have to re-login. Same with bank. If I work with my company account, then my personal account must not become an issue because I am on the same machine and site. I have no issue with using FF and IE to do testing as that takes care of browser compatibility testing at the same time :-), but I think when you start a new session with new values, it should be kept under that window/tab alone. Cookies can take care of more details, but my opinion is data should never be affected across windows/tabs unless the same user is logged in on botheven then I would expect PHP to keep data per session. Maybe it goes beyond being an IE or FF issue..the questiojn is...will PHP allow variables from session A become corrupted when session B is in progress when they should actually be handled seperately? In the end I think it is something I do wrong in PHP with the SESSION variables and how I clear themif so...I don't think PHP should allow clearing SESSION variables from other sessions. -Original Message- From: Arno Kuhl [mailto:ak...@telkomsa.net] Sent: 20 August 2009 10:03 AM To: 'Leon du Plessis'; php-general@lists.php.net Subject: RE: [PHP] SESSIONS lost sometimes -Original Message- From: Leon du Plessis [mailto:l...@dsgnit.com] Sent: 20 August 2009 09:44 AM To: php-general@lists.php.net Subject: RE: [PHP] SESSIONS lost sometimes Since we are on the subject: I have the following similar problem: When testing page on internet explorer, I find that one tab's variables can affect another tab's variables. Thus when having the same web-site open and using SESSION variables but for different users, Internet explorer can become disorientated. This also sometimes happen when I have two separate browsing windows open with Internet Explorer for the same site. I have yet to determine if this is an internet explorer, or PHP or combination of the two that is causing this condition. To my understanding _SESSION variables should be maintained per session, tab or window. If this has been addressed already, my apologies, but thought it worthwhile to mention. If someone perhaps have a solution or can confirm this as a known issue and maybe is the same or related to Angelo's problem? If different browser windows/tabs on the same client-side computer didn't share session info then you'd get the effect of being able to log onto a site with one browser window, but find in a second browser window that you were not yet logged on. Experience will tell you that you're logged on in both browser windows (try it with your online bank). It's not an issue, it's a feature. If you want to be able to use different browser windows as though they were different users then use different browsers e.g. IE and FF on the same client-side computer will look like two separate end users to the server, and they don't share session info or cookies. Cheers Arno The key thing is that both tabs (or windows) from the same browser are in the *same* session - they send the *same* PHPID cookie. PHP is essentially stateless - it doesn't care where the request comes from, and ties a session to the PHPID cookie if it gets one. As far as PHP knows, requests from different tabs with the same PHPID cookie are requests from the same place in the same session. To get a different session you need a different instance of the browser - that's the way browsers have been coded to work. It's not too hard with Firefox, since you can set up multiple profiles to have independent Firefox windows on the same screen. -- Peter Ford phone: 01580 89 Developer fax: 01580 893399 Justcroft International Ltd., Staplehurst, Kent -- PHP General Mailing List (http://www.php.net/) To unsubscribe, visit: http://www.php.net/unsub.php
Re: [PHP] Form Spam
On Thu, 20 Aug 2009 09:11:47 -0400 Gary gwp...@ptd.net wrote: I have a client with a form on his site and he is getting spammed. It appears not to be from bots but human generated. While they are coming from India, they do not all have the same IP address, but they all have gmail addresses, New York addresses are used in the input field and they all offer SEO services. It is not overwhleming, but about 5 a month. What is the best way to stop this. Thanks Gary One of the things you could check is if they do direct posting. What I mean by that if that sometimes a POST URL only is send. They figured out the fields you have in your form and directly send a POST with the appropriate fields. You could check this in the webserver logs. Just look for the IP and see if it only has a POST URL. If this is the case you could implement a nonce on your form and check it during the processing of the post. A second idea is to check the IP of the visitor during the POST process, with something like stopforumspam or project honey pot. If you want more info let me know. -- Peter van der Does GPG key: E77E8E98 IRC: Ganseki on irc.freenode.net Blog: http://blog.avirtualhome.com Forums: http://forums.avirtualhome.com Jabber ID: pvanderd...@gmail.com -- PHP General Mailing List (http://www.php.net/) To unsubscribe, visit: http://www.php.net/unsub.php
[PHP] is there any way to get realpath cache hit ratio of php?
hi, Is there any way to get realpath cache hit ratio of php? realpath_cache_size integer Determines the size of the realpath cache to be used by PHP. This value should be increased on systems where PHP opens many files, to reflect the quantity of the file operations performed. realpath_cache_ttl integer Duration of time (in seconds) for which to cache realpath information for a given file or directory. For systems with rarely changing files, consider increasing the value. -- PHP General Mailing List (http://www.php.net/) To unsubscribe, visit: http://www.php.net/unsub.php
[PHP] Is there any considerations for not putting php scripts in tmpfs?
Hi php-general, sorry if it is a wrong lists for this question. I have read many articles/messages about using tmpfs store temp files, for example, php session data, smarty compied templates and so on. An obvious reason for that is: it doesn't matter about data loss caused by machine restart/poweroff. since it is not that difficult to restore files on a tmpfs from a disk-based dir when machine boot up. so may i put all my php scripts on a tmpfs to speed it up? would that cause other issues? thanks for your advices.
Re: [PHP] Is there any considerations for not putting php scripts in tmpfs?
hi,thanks for your reply. On Mon, Aug 10, 2009 at 9:54 PM, Richard Quadling rquadl...@googlemail.comwrote: 2009/8/10 Peter Wang ptr.w...@gmail.com: Hi php-general, sorry if it is a wrong lists for this question. I have read many articles/messages about using tmpfs store temp files, for example, php session data, smarty compied templates and so on. An obvious reason for that is: it doesn't matter about data loss caused by machine restart/poweroff. since it is not that difficult to restore files on a tmpfs from a disk-based dir when machine boot up. so may i put all my php scripts on a tmpfs to speed it up? would that cause other issues? thanks for your advices. Considering that in the main PHP scripts are readonly, I would have thought the normal file and disk caching of the OS would suffice. normal file/disk caching of the OS works for small amount of files, but when your apps has huge amounts of files, that doesn't work any more. even with APC, it still cause many stat() system calls. -- - Richard Quadling Zend Certified Engineer : http://zend.com/zce.php?c=ZEND002498r=213474731 Standing on the shoulders of some very clever giants! ZOPA : http://uk.zopa.com/member/RQuadling
[PHP] Re: Clean break.
Paul Halliday wrote: Whats the cleanest (I have a really ugly) way to break this: [21/Jul/2009:00:00:47 -0300] into: date=21/jul/2009 time=00:00:47 Caveats: 1) if the day is 10 the beginning of the string will look like [space1/... 2) the -0300 will differ depending on DST or TZ. I don't need it though, it just happens to be there. This is what I have (it works unless day 10): $theParts = split([\], $theCLF); // IP and date/time $tmpParts = explode( , $theParts[0]); $theIP = $tmpParts[0]; $x = explode(:, $tmpParts[3]); $theDate = str_replace([,, $x[0]); $theTime = $x[1]:$x[2]:$x[3]; the full text for this part looks like: 10.0.0.1 - - [21/Jul/2009:00:00:47 -0300] ... more stuff here Anyway, any help would be appreciated. thanks. As far as I can tell from a brief test, date_create will happily parse your format, so something like $tmp = date_create($theParts[0]); $theDate = $tmp-format(d/m/Y); $theTime = $tmp-format(h:i:s); should do it -- Peter Ford phone: 01580 89 Developer fax: 01580 893399 Justcroft International Ltd., Staplehurst, Kent -- PHP General Mailing List (http://www.php.net/) To unsubscribe, visit: http://www.php.net/unsub.php
[PHP] Re: file upload question
seb wrote:
Hey all,
i am using move_upload function to upload files to the server, but i
want to add a feature that will allow files to be archived that have
been uploaded already.
so, the problem is:
i upload a file that i want to upgrade and move the old file to an
archive directory but I want to verify the NEW file is upload BEFORE
moving the old file (the file being uploaded might not have the same
filename as the old file currently on the server)..
i want to move the old file only when the new file was successfully
uploaded. something like:
if(move_uploaded_file())
{
rename(...);
}
only one problem.. then if both files have the same name it will be
overwritten before it moves the old one i want to save. if i move the
old one first, there still the possibility of the new upload failing so
i am back to square one..
i guess i can move_upload to a different directory, verify it's been
uploaded, move the old to the archive file, then move the new file back
to where it should be (where the archive file was)..
is that my only option? any suggestions?
I'd suggest you *copy* the old file (if it exists) to archive anyway, and then
*move* it back if the new version doesn't verify. That seems pretty safe to
me...
--
Peter Ford phone: 01580 89
Developer fax: 01580 893399
Justcroft International Ltd., Staplehurst, Kent
--
PHP General Mailing List (http://www.php.net/)
To unsubscribe, visit: http://www.php.net/unsub.php
Re: [PHP] fileinfo returning wrong mime type for Excel files
Christoph Boget wrote: /usr/share/file/magic /usr/share/file/magic has lots of rules to know its type and its just matching it. I know it has a lot of rules. Grepping it for excel shows that there are rules in it for those types of files as well. Maybe your file is quite strange . have you tried with other xls files? Yes, I have; the result is the same for all. what does file /path/to/my/excel.xls say $ file excel.xls excel.xls: Microsoft Office Document Interestingly... $ file word.doc word.doc: Microsoft Office Document So apparently, to the file command, there is no distinction. That seems both odd and wrong to me. But not nearly as wrong as fileinfo reporting application/msword as the mime type of an excel document. thnx, Christoph Have you tried using 'file -i' from the command line: after all you are looking for a MIME type with your fileinfo... Having said that, with file -i on my system, Word documents are 'application/msword' and Excel files are 'application/octet-stream' -- Peter Ford phone: 01580 89 Developer fax: 01580 893399 Justcroft International Ltd., Staplehurst, Kent -- PHP General Mailing List (http://www.php.net/) To unsubscribe, visit: http://www.php.net/unsub.php
Re: [PHP] Broken IF behavior? (Changing the branch changes the evaluation)
Matt Neimeyer wrote:
It's exactly what I would expect... The content of the row... But in
any case, what does changing the content of the { } branch have to do
with how the IF() itself is evaluated?
array(4) {
[0]=
string(8) CustName
[config]=
string(8) CustName
[1]=
string(11) Sample Cust
[value]=
string(11) Sample Cust
}
The if() *is* being evaluated *the same* whatever the content of that branch,
but when there's no content, you see no result...
It always looks odd to me to have empty if branches - why do you not just write
if ($Ret) { return $Ret; }
Anyway, the !$Ret branch is being executed because the fetch operation will
return NULL (or FALSE or something equivalent) when there are no results.
--
Peter Ford phone: 01580 89
Developer fax: 01580 893399
Justcroft International Ltd., Staplehurst, Kent
--
PHP General Mailing List (http://www.php.net/)
To unsubscribe, visit: http://www.php.net/unsub.php
[PHP] Re: newbie question - php parsing
João Cândido de Souza Neto wrote:
You made a mistake in your code:
?php the_title(); ?
must be:
?php echo the_title(); ?
Not necessarily: what if you have
function the_title()
{
echo Title;
}
for example...
In response to Sebastiano:
There would be not much point in using something like PHP if it ignored the if
statements in the code!
What effectively happens in a PHP source file is that all the bits outside of
the ?php ? tags are treated like an echo statement (except that it handles
quotes and stuff nicely)
Your original code:
?php if (the_title('','',FALSE) != 'Home') { ?
h2 class=entry-header?php the_title(); ?/h2
?php } ?
can be read like:
?php
if (the_title('','',FALSE) != 'Home') {
echo 'h2 class=entry-header';
the_title();
echo '/h2';
}
?
You might even find a small (but probably really, really, really small)
performance improvement if you wrote it that way, especially if it was in some
kind of loop.
Note that I prefer to keep HTML separate from PHP as much as possible because it
helps me to read it and helps my editor check my syntax and HTML structure
better...
--
Peter Ford phone: 01580 89
Developer fax: 01580 893399
Justcroft International Ltd., Staplehurst, Kent
--
PHP General Mailing List (http://www.php.net/)
To unsubscribe, visit: http://www.php.net/unsub.php
[PHP] Re: Undefined Index ...confusion
Miller, Terion wrote: I keep getting this error while trying to use the field 'ID' to pass in a url.. And it's odd because the query is pulling everything BUT the ID which is the first field... code: a href=view.php?ID=?php echo $_SESSION['fullRestaurantList']['ID']??php echo htmlspecialchars(stripslashes($_SESSION['fullRestaurantList'][$i]['name'])); ? What's the query? I find (I use PostgreSQL rather than the mySQL that many on this list use) that unless you explicitly ask for a field called ID (using SELECT ID ... ) you get a returned field in lower case So $resource = pg_query(SELECT ID, Foo FROM MyTable WHERE Foo='Bar'); $data = pg_fetch_all($resource) gives me an array $data of rows like $data[0]['id'] = '1' $data[0]['foo'] = 'Bar' To make sure $data[] has fields named ID and Foo I would have to do $resource = pg_query(SELECT ID AS \ID\, Foo AS \Foo\ FROM MyTable WHERE Foo='Bar'); -- Peter Ford phone: 01580 89 Developer fax: 01580 893399 Justcroft International Ltd., Staplehurst, Kent -- PHP General Mailing List (http://www.php.net/) To unsubscribe, visit: http://www.php.net/unsub.php
Re: [PHP] [GD] Image errors
Ash, Martin,
Seems you are both wandering around the obvious problem...
I suspect that $tipo (in the next line) is *supposed* to be $type - sounds like
a partial Italian translation to me...
So given that $type=imagecreatefrompng (for example, if the mime check returns
'png' - not very reliable, I suspect),
then
$immagine = $type($this-updir.$id.'.png')
should create a GD resource from the file, but the image appears to be empty.
My take on this is:
OP says he gets the same result from
$immagine = imagecreatefromjpeg(this-updir.$id.'.png')
- well I might expect to get an error message if I loaded a PNG expecting it to
be a JPEG, but I certainly wouldn't expect an image.
On some basic tests, I find that mime_content_type() is not defined on my
system, so ignoring that and trying to load a PNG file using imagecreatefromjpeg
results in pretty much the same result as the OP...
Conclusions:
First: if you use Italian for your variable names, don't change half of their
instances to English...
Second: Make sure you actually know the mime type of a file before you try to
load it into GD...
My version of this would test against known image types to try the GD function:
foreach (Array('png','jpeg','gif') as $typeName)
{
$type = 'imagecreatefrom'.$typeName;
$immagine = $type(this-updir.$id.'.png'le);
if (is_resource($immagine))
{
header('Content-type: image/jpeg');
imagejpeg($immagine,null,100);
imagedestroy($immagine);
break;
}
}
header('HTTP/1.0 500 File is not an allowed image type');
--
Peter Ford phone: 01580 89
Developer fax: 01580 893399
Justcroft International Ltd., Staplehurst, Kent
--
PHP General Mailing List (http://www.php.net/)
To unsubscribe, visit: http://www.php.net/unsub.php
Re: [PHP] [GD] Image errors
Martin Scotta wrote:
Why are you ussing GD?
All you need is output the image to the browser?
try this... I didn't test/run this code, but it may work...
public function showPicture( $id ) {
header('Content-type:' . mime_content_type( $this-updir . $id .
'.png' ) );
readfile( $this-updir . $id . '.png' );
}
hey, look, just 2 lines!
But it doesn't convert the image from whatever came in to a JPEG output, which
is what the OP's code appears to be trying to do (and possibly ought to work...)
--
Peter Ford phone: 01580 89
Developer fax: 01580 893399
Justcroft International Ltd., Staplehurst, Kent
--
PHP General Mailing List (http://www.php.net/)
To unsubscribe, visit: http://www.php.net/unsub.php
[PHP] Re: Scope woe
Luke wrote:
Hello again guys,
I was wondering the best way to tackle the following problem:
I've got a class, containing a property which is another object. So from
outside I should be able to do
$firstobject-propertycontainingobject-methodinsidethatobject();
The $firstobject variable is in the global namespace (having been made with
$firstobject = new FirstObject;), and I'm having a problem that I'm sure
many people have when accessing it inside another class, so:
class otherObject
{
static function messwithotherthings ()
{
$firstobject-propertycontainingobject-methodinsidethatobject();
}
}
But $firstobject is blank, which makes sense because in there it is pointing
to the local variable within the method.
To solve this, I could add 'global $firstobject' inside every method, but
this is very redundant and boring. I've tried a couple of things like
adding:
private $firstobject = $GLOBALS['firstobject'];
But apparently that's bad syntax. I was just wondering the best way to get
around this?
Thanks a lot for your help,
Set the value of $firstobject in the constructor of otherObject (that's what
constructors are for!):
eg.
class otherObject
{
private $firstobject;
function __construct()
{
$this-firstobject = $GLOBALS['firstobject'];
}
static function messwithotherthings ()
{
$this-firstobject-propertycontainingobject-methodinsidethatobject();
}
}
--
Peter Ford phone: 01580 89
Developer fax: 01580 893399
Justcroft International Ltd., Staplehurst, Kent
--
PHP General Mailing List (http://www.php.net/)
To unsubscribe, visit: http://www.php.net/unsub.php
Re: [PHP] Re: Scope woe
Luke wrote:
Thanks for the replies :)
Surely if I pass it as a parameter to the __construct then I would have to
make an instance of the otherObject, notice that messwithotherthings is
static?
Also, if I'm not using OOP properly, Eddie, how would I use it properly to
prevent this situation?
Thanks,
Hmmm, I didn't notice the method was static - that means my idea really won't
work...
I did have a bad feeling about this, and Eddie confirmed my unease with the
point about OOP.
Really, you should need your $firstobject to be a singleton:
eg.
class FirstObject
{
private static $theInstance = NULL;
public $propertyContainingObject;
protected function __construct()
{
// whatever
}
public static function getInstance()
{
if (!self::$theInstance)
{
self::$theInstance = new FirstObject();
}
return self::$theInstance;
}
// ... other methods ...
}
So then:
class OtherObject
{
static function messWithOtherThings()
{
$firstObject = FirstObject::getInstance();
$firstObject-propertyContainingObject-methodInsideThatObject();
}
}
I think that works, and is reasonable to the OOP purists...
--
Peter Ford phone: 01580 89
Developer fax: 01580 893399
Justcroft International Ltd., Staplehurst, Kent
--
PHP General Mailing List (http://www.php.net/)
To unsubscribe, visit: http://www.php.net/unsub.php
Re: [PHP] I've some doubts if I should go with 5.2 or go alreadywith 5.3 (for a course)
Robert Cummings wrote: Per Jessen wrote: Manuel Aude wrote: I'm giving a PHP course next semester (3 hours all saturdays for 22 weeks) and I just realized that PHP 5.3 is coming very soon (2 days now!). So, my plans of teaching PHP 5.2 are starting to change, and I think it's a good idea to teach them 5.3 already. Does it _really_ matter which one? I can't imagine there are that many revolutionary changes in a dot-release. Given the naming of PHP versions of PHP-x.y.z, I would agree that not much changes between versions at the .z level. But at the .y level there are usually significant changes. Coming to a PHP 5.3 near you are the following notable features: - namespaces - closures - late static binding - garbage collector to handle cyclic references - PHAR - goto Cheers, Rob. I read that last bit as PHAR togo Need coffee... -- Peter Ford phone: 01580 89 Developer fax: 01580 893399 Justcroft International Ltd., Staplehurst, Kent -- PHP General Mailing List (http://www.php.net/) To unsubscribe, visit: http://www.php.net/unsub.php
[PHP] Re: Echo result in a loop on each instance
Anton Heuschen wrote:
I have a question regarding echo of a var/string in a loop on each instance
A shortened example:
Lets say I have an array of values (rather big), and then I loop
through this array:
for or foreach :
{
$value = $arrValAll[$i];
echo test.$i.-- .$value;
}
When the script runs it will only start to echo values after certain
period ... it does not echo immediately ... how can I force it start
echo as soon as the first echo instance is done ? I thought ob_start
does this but I have tried it and not getting what I want.
Is there some other way/correct to do this?
call flush() after each echo to flush the buffer to the client.
That should work...
--
Peter Ford phone: 01580 89
Developer fax: 01580 893399
Justcroft International Ltd., Staplehurst, Kent
--
PHP General Mailing List (http://www.php.net/)
To unsubscribe, visit: http://www.php.net/unsub.php
[PHP] Re: accessing level above $_SERVER['DOCUMENT_ROOT']
LAMP wrote:
hi,
I have this structure:
/home/lamp/mydomain/html
/home/lamp/mydomain/logs
/home/lamp/mydomain/config
etc.
html directory is the only one accessible from outside.
to access config file I can use this:
required_once('/home/lamp/mydomain/config');
but this is the structure on my local/development machine. once the site
is done it will be moved to production server and the structure will be
/srv/www/mydomain/html
/srv/www/mydomain/logs
/srv/www/mydomain/config
etc.
to automate the document_root I define on the begining of the page
define('HTML_PATH', $_SERVER{DOCUMENT_ROOT']);
define('CONFIG_PATH', $_SERVER{DOCUMENT_ROOT'].'/../config');
define('LOGS_PATH', $_SERVER{DOCUMENT_ROOT'].'/../logs');
it works but I think it's not good solution. or at least - it's not nice
solution :-)
suggestions?
afan
Outside of a define, you could have used dirname($_SERVER[DOCUMENT_ROOT]), but
in a define, that's not going to work.
I think you're stuck with your inelegance...
--
Peter Ford phone: 01580 89
Developer fax: 01580 893399
Justcroft International Ltd., Staplehurst, Kent
--
PHP General Mailing List (http://www.php.net/)
To unsubscribe, visit: http://www.php.net/unsub.php
Re: [PHP] populate form input option dropdown box from existing data
PJ wrote:
I'm including the relevant code:
// select categories for book to be updated
$sql = SELECT id, category FROM categories, book_categories
WHERE book_categories.bookID = '$bid'
book_categories.categories_id = categories.id;
if ( ( $results = mysql_query($sql, $db) ) ) {
while ( $row = mysql_fetch_assoc($results) ) {
$selected[] = $row['id'];
}
}
else $selected = Array( 0 = '0');
echo $selected;
print_r($selected);
$sql = SELECT * FROM categories;
echo select name='categoriesIN[]' multiple size='8';
if ( ( $results = mysql_query($sql, $db) ) !== false ) {
while ( $row = mysql_fetch_assoc($results) ) {
if (in_array($row['id'], $selected)) {
echo option value=, $row['id'], selected='selected'
, $row['category'], /optionbr /;
}
else echo option value=, $row['id'], ,
$row['category'], /optionbr /;
}
}
Problem #1)in the first query result. I can't figure out how to deal
with it. The code works fine if there are categories assigned to the
book. If not, an undefined variable error is spewed out for selected.
That's because the test you use for the success of the query:
( ( $results = mysql_query($sql, $db) ) !== false )
is true if and only if the query succeeds, whether or not you get any rows
returned.
You then start looping over the fetched rows, and if there are none $selected
never gets anything assigned to it, and so never gets defined.
Since you don't rely on $selected being actually populated (in_array works fine
on an empty array...), you might be better off pre-setting $selected before you
start the first query:
$selected = Array();
$sql = SELECT id, category FROM categories, book_categories
WHERE book_categories.bookID = '$bid'
book_categories.categories_id = categories.id;
if ( ( $results = mysql_query($sql, $db) ) )
{
while ( $row = mysql_fetch_assoc($results) )
{
$selected[] = $row['id'];
}
}
Problem #2) in the second query, the selected is in the source code but
it is not highlited. Several times I did get the categories highlighted,
but I could never catch what it was that made it work. When I had the
$id problem, i was trying this code from Yuri (but I don't understand
where he got the $id from ) :
The HTML you generate in the selected case is not quite right - you should have
quotes around the value attribute's value, and you missed a closing '' off
the option tag...
while ( $row = mysql_fetch_assoc($results) )
{
if (in_array($row['id'], $selected))
{
echo option value=', $row['id'], ' selected='selected' ,
$row['category'], /optionbr /;
}
else
{
echo option value=, $row['id'], , $row['category'], /optionbr
/;
}
}
More succinctly:
while ( $row = mysql_fetch_assoc($results) )
{
$sel = in_array($row['id'], $selected) ? selected='selected':;
echo option value='{$row['id']}' $sel{$row['category']}/optionbr /;
}
Unless the code is seriously performance critical, I still think variable
interpolation is nicer to read than all those quotes and commas, and it keeps
the HTML structure together better...
Good luck
--
Peter Ford phone: 01580 89
Developer fax: 01580 893399
Justcroft International Ltd., Staplehurst, Kent
--
PHP General Mailing List (http://www.php.net/)
To unsubscribe, visit: http://www.php.net/unsub.php
[PHP] Re: aesthetic beauty in conception, execution
PJ wrote: I just thought I would share a revelation. Someone just pointed me to a site that IMHO is superb for elegance of artistic design and programming. I was blown away. http://www.apfq.ca You won't regret it. 8-) Il y a seulement une problème - je ne lis pas Française... I18N - it's important, you know... -- Peter Ford phone: 01580 89 Developer fax: 01580 893399 Justcroft International Ltd., Staplehurst, Kent -- PHP General Mailing List (http://www.php.net/) To unsubscribe, visit: http://www.php.net/unsub.php
[PHP] Re: Search/Replace in entire database?
Chris Payne wrote: Hi everyone, I am in the middle of creating an editor where you can search and replace on an individual column in a single table then I came across something I need to be able to do but not sure how. Is it posible (And if so please how :-) to search an entire database and all tables within a database and do a find/replace on keywords without having to specify each table/column within that table? The people I am working for have made some big changes and one of them is changing the names of one of their products, but this product name appears EVERYWHERE in many tables and in lots of different column names, and it would save so much time if I could do a single query that would just search EVERYTHING within the database. Thanks for any advice you can give me. Regards Chris Payne Chris, This is not really a PHP question, is it? More like a question for the support group that corresponds to your database software... However, in my experience databases don't allow a cross-table update in a single query - you won't be able to do it in one query. You will either have to 1. work out which columns and tables contain the name 2. script a query to make the changes for each separately 3. test it on a backup version of the database 4. fix the bugs 5 run the script on the live database. OR (possibly) 1. block access to the database (to prevent any changes while you are processing) 2. dump the whole DB to an SQL script 3. do a search and replace on the text of the SQL script 4. Drop the existing data and reload the database from your SQL dump 5. enable access again so that the users can find the (inevitable) mistakes. These are both pretty time-consuming - sorry! Then make a business case for the project of normalising the database, at least with respect to the product names... -- Peter Ford phone: 01580 89 Developer fax: 01580 893399 Justcroft International Ltd., Staplehurst, Kent -- PHP General Mailing List (http://www.php.net/) To unsubscribe, visit: http://www.php.net/unsub.php
[PHP] Re: Dynamic Titles
David Robley wrote:
Austin Caudill wrote:
Hello, im trying to make the CMS system im using more SEO friendly by
giving each page it's own title. Right now, the system assigns all pages
the same general title. I would like to use PHP to discertain which page
is being viewed and in turn, which title should be used.
I have put in the title tags the variable $title. As for the PHP im
using, I scripted the following:
$url = http://'.$_SERVER['SERVER_NAME']''.$_SERVER['REQUEST_URI']';
switch ( $url )
{
default:
$title = Photoshop tutorials, Flash tutorials, and more! Newtuts Tutorial
Search; break;
case $config[HTTP_SERVER]help.php :
$title = Newtuts Help;
break;
}
Right now, im getting this error:
Parse error: syntax error, unexpected T_ENCAPSED_AND_WHITESPACE, expecting
T_STRING or T_VARIABLE or T_NUM_STRING in
/home/a7201901/public_html/includes/classes/tutorial.php on line 803
Can someone please help me with this?
Thanks!
I'm guessing that line 803 is
$url = http://'.$_SERVER['SERVER_NAME']''.$_SERVER['REQUEST_URI']';
which is full of mismatched quotes :-) Try any of
$url = http://{$_SERVER['SERVER_NAME']}{$_SERVER['REQUEST_URI']};
$url = http://.$_SERVER['SERVER_NAME'].$_SERVER['REQUEST_URI'];
$url = 'http://'.$_SERVER['SERVER_NAME'].$_SERVER['REQUEST_URI'];
Cheers
Also the line:
case $config[HTTP_SERVER]help.php :
probably won't work very well : should be either
case $config[HTTP_SERVER].'help.php':
or
case {$config[HTTP_SERVER]}help.php:
according to whether you like interpolation in quotes or not.
I recommend finding a development environment or editor that does syntax
highlighting - that would catch all of these problems before you even save the
file.
--
Peter Ford phone: 01580 89
Developer fax: 01580 893399
Justcroft International Ltd., Staplehurst, Kent
--
PHP General Mailing List (http://www.php.net/)
To unsubscribe, visit: http://www.php.net/unsub.php
[PHP] Re: Any conflict with $_POST when 2 users concurrently submitting the same form using POST method?
Keith wrote: Let's say user A and user B submitting purchase order form with order.php at the same time, with method=post action='confirmation.php'. (1) Will $_POST['order'] submitted by user A replaced by $_POST['order'] submitted by user B, and the both user A B getting the same order, which is made by user B? Why? (2)Since $_POST['xxx'] is superglobal array, will $_POST['order'] read by users other than A B? In shared hosting server environment, are all domains hosted within that server using the same $_POST array? Can $_POST array accessible by all domains even if not from the originating domain? Thx for clarification! Keith Other posters have explained, but I'm not sure their explanations are clear. Think of it like this: User A posts to confirmation.php. When the server receives the request, it starts up a Process and fills the $_POST array with whatever came in, then runs confirmation.php with that information. User B posts to confirmation.php. When the server receives the request, it starts up a Process and fills the $_POST array with whatever came in, then runs confirmation.php with that information. The KEY thing is that the process in each case is entirely separate. Each makes it's own copy of the script in its own bit of memory, and each has its own version of $_POST in its own bit of memory. The two posts can happen at the same time and they will still be completely independent. The fact that $_POST is called superglobal does not mean that it is shared by separate requests - it is not even shared by requests in the same session. It just means that it is already declared and you don't need to use the global keyword to access it in your PHP pages. -- Peter Ford phone: 01580 89 Developer fax: 01580 893399 Justcroft International Ltd., Staplehurst, Kent -- PHP General Mailing List (http://www.php.net/) To unsubscribe, visit: http://www.php.net/unsub.php
Re: [PHP] Anyone know whats the best way to learn PHP
On Mon, 1 Jun 2009 15:43:21 +0500 Muhammad Hassan Samee hassansa...@gmail.com wrote: Hi Anyone know whats the best way to learn PHP? Every time I open an php book or look the codes online, my mind goes oh man, So many stuffs to learn and gets frustrated before i even start but on the other hand, I don't know why some how the brain keep on nagging me to learn PHP. I guess what's the fun way to learn php? Any good books? Do you already code? If so, just download something you are interested in, maybe WordPress if you blog, with some plugins as those are most likely easier to read, and look at the programs and try figuring out why things are working they way they work. I can't really remember how I started but I believe it was with Postnuke a long time ago. I looked at the code, try to help fix bugs. The best way to learn any language, computer or natural, is not by sitting down and reading books, it's by actually programming/speaking the language. -- Peter van der Does GPG key: E77E8E98 IRC: Ganseki on irc.freenode.net Blog: http://blog.avirtualhome.com Forums: http://forums.avirtualhome.com Jabber ID: pvanderd...@gmail.com GetDeb Package Builder http://www.getdeb.net - Software you want for Ubuntu -- PHP General Mailing List (http://www.php.net/) To unsubscribe, visit: http://www.php.net/unsub.php
[PHP] PHP class question
I have the following situation.
I wrote some software and split it up into functionality:
class core {
function go{
}
}
class A extends core {
// PHP4 constructor
function A {
$this-go();
}
}
class B extends core {
}
In core I define functions and variables that are to be used
through out my program and to address those functions/variables I just
use $this- .
Now I ran into a situation where class A needs to be extended with
another class. This is not my choice, it's part of a framework I have
to use.
Currently I solved this by doing this:
class A extends framework_class {
$var core;
// PHP4 constructor
function A {
$this-core = new core();
$this-core-go();
}
}
The question I have, is this a good solution, is it the only solution
or are there different ways to tackle this?
As you might see it needs to run in PHP4.
--
Peter van der Does
GPG key: E77E8E98
IRC: Ganseki on irc.freenode.net
Blog: http://blog.avirtualhome.com
Forums: http://forums.avirtualhome.com
Jabber ID: pvanderd...@gmail.com
--
PHP General Mailing List (http://www.php.net/)
To unsubscribe, visit: http://www.php.net/unsub.php
Re: [PHP] Re: PHP class question
On Thu, 21 May 2009 14:08:11 -0500 Shawn McKenzie nos...@mckenzies.net wrote: This doesn't make sense. You say class A needs to be extended with another class, however what you show below is class A extending framework_class. I worded it wrong, I apologize. Class A needs to be an extension of the framework class. -- Peter van der Does GPG key: E77E8E98 IRC: Ganseki on irc.freenode.net Blog: http://blog.avirtualhome.com Forums: http://forums.avirtualhome.com Jabber ID: pvanderd...@gmail.com GetDeb Package Builder http://www.getdeb.net - Software you want for Ubuntu -- PHP General Mailing List (http://www.php.net/) To unsubscribe, visit: http://www.php.net/unsub.php
[PHP] Re: Parsing of forms
Daniele Grillenzoni wrote: I noticed that php's way to fill $_GET and $_POST is particularly inefficient when it comes to handling multiple inputs with the same name. This basically mean that every select multiple in order to function properly needs to have a name ending in '[]'. Wouldn't it be easier to also make it so that any element that has more than one value gets added to the GET/POST array as an array of strings instead of a string with the last value? I can see the comfort of having the brackets system to create groups of inputs easily recognizable as such, while I can overlook the impossibility of having an input literally named 'foobar[]', having to add [] everytime there is a slight chance of two inputs with the same name. This sounds flawed to me, as I could easily append '[]' to every input name and have a huge range of possibilities unlocked by that. This can't be right. Or can it? Isn't it ironic that a post about multiple form inputs is posted four times? That's not a good way to make friends here, Daniele... I really don't understand your complaint - in general if your form has multiple inputs with the same name, then you either meant to do that, (like a multiple select, in which case there's not really a big deal to add the []), or it's wrong and wouldn't work as expected anyway. You could append [] to every input - that would be lovely, but it would hide the possibility that you mistakenly gave two inputs the same name. It's true that every so often I can't work out why something is not posting an array to PHP when I expected it to, and a look back to the form to find I'd missed a [] on the name is the answer. As I like to say in other areas of life (especially to my children), stop whining and get on with it! ( sorry :) ) -- Peter Ford phone: 01580 89 Developer fax: 01580 893399 Justcroft International Ltd., Staplehurst, Kent -- PHP General Mailing List (http://www.php.net/) To unsubscribe, visit: http://www.php.net/unsub.php
Re: [PHP] Software to read/write Excel to CD?
Matt Graham wrote: Ashley Sheridan wrote: Paul M Foster wrote: On Thu, May 14, 2009 at 03:22:12PM -0500, Skip Evans wrote: One of the things the other company said was possible, and I'm not familiar with... if I understand correctly, is to create a CD with not just an Excel spreadsheet, but software on that CD that when placed in another computer will open the spreadsheet, allow it to be modified and rewritten back to the CD. It has to be a CD-RW, the CD-RW has to be in UDF format, and the host machine has to be able to read and rewrite CD-RWs in UDF. This is actually not that tough to arrange--it just has nothing to do with PHP. 'DozeXP should be able to do this, and Linux will do this if the right kernel options are on. Don't know about OS X. Second, include some other program which would do the same thing. Good luck with that. OOO Calc, which should be just fine for basic tasks and is Free. And now the kicker-- write the spreadsheet back to CD. Okay, maybe, if it's a CD-RW. But who's going to pay attention to that little detail? And as far as I know, writing to a CD is far more complicated than writing to a hard drive. You can't overwrite data on a CD-RW. UDF, which has been a standard for quite some time, allows this. The main thing you lose is some space on the CD-RW. I've never heard of anything like that, there are so many unknown variables that I would really feel for the poor team who had to take that project on! It sounds like whoever defined the requirements was trying to solve a problem in the wrong way. Why drag physical media into this when you have the Net available? And if the clients don't have the Net available, *why not*? It *is* possible to be offline, and so far from anywhere that the only com links are to satellites... (expensive). I suspect that a USB key is a better option (and more physically portable) than a UFB CD. But why write an Excel spreadsheet - why not save the data in something more portable like CSV that ExCel and read and write to once you are back at base? -- Peter Ford phone: 01580 89 Developer fax: 01580 893399 Justcroft International Ltd., Staplehurst, Kent -- PHP General Mailing List (http://www.php.net/) To unsubscribe, visit: http://www.php.net/unsub.php
Re: [PHP]Cannot output the same data from text file in PHP
Moses wrote:
Hi Folks,
I have a written a script in PHP which outputs the result from a text file.
The PHP script is as follows:
?php
$alldata = file(result.txt);
echo tabletrtd;
foreach($alldata as $line_num = $line) {
echo $line.br;
}
echo/td/tr/table;
?
I have attached the result.txt file. However the output of the script is as
follows:
Query: 1 atggcaatcgtttcagcagattcgtaattcgagctcgcccatcgatcctcta 60
Sbjct: 1 atggcaatcgtttcagcagattcgtaattcgagctcgcccatcgatcctcta 60
which is not exactly as in the result.txt file in that the pipelines
are displaced.
Any pointer to this problem shall be appreciated. Thanking you in advance.
Moses
Not a PHP problem, but a HTML problem:
First, HTML compresses white space into just one space, so all of those leading
spaces on line 2 are lost.
Second, you are (probably) displaying using a proportionally-spaced font, so the
narrow pipeline characters take up less width than the letters.
So you need something like:
?php
$alldata = file(result.txt);
echo tabletrtd style='white-space: pre; font-family: monospace;';
foreach($alldata as $line_num = $line)
{
echo $line.\n;
}
echo/td/tr/table;
?
--
Peter Ford phone: 01580 89
Developer fax: 01580 893399
Justcroft International Ltd., Staplehurst, Kent
--
PHP General Mailing List (http://www.php.net/)
To unsubscribe, visit: http://www.php.net/unsub.php
[PHP] When is __destruct called on an object in $_SESSION ?
I'm sure I've seen something about this before, but I can't find it:
I'm creating a file which needs to live for the duration of a session, and ONLY
the duration of the session.
I made a little call which holds the name of the file like this:
?php
class __TFR
{
private $file;
public function __construct()
{
$this-file = '/tmp/'.session_id().'.xml';
}
public function __get($name)
{
if ($name=='file') return $this-file;
}
public function __destruct()
{
@unlink($this-file);
}
}
?
So I create an instance of this object and I put a reference to the object in
the session:
?php
$_SESSION['TFR'] = new __TFR();
?
I was then expecting TFR::__destruct() to only be called when the session was
closed, with either a timeout, or a session_destroy() call.
But it looks like the object destructor is called at the end of every page.
Any ideas about working around that?
--
Peter Ford phone: 01580 89
Developer fax: 01580 893399
Justcroft International Ltd., Staplehurst, Kent
--
PHP General Mailing List (http://www.php.net/)
To unsubscribe, visit: http://www.php.net/unsub.php
Re: [PHP] When is __destruct called on an object in $_SESSION ?
Stuart wrote:
2009/5/14 Peter Ford p...@justcroft.com:
I'm sure I've seen something about this before, but I can't find it:
I'm creating a file which needs to live for the duration of a session, and
ONLY
the duration of the session.
I made a little call which holds the name of the file like this:
?php
class __TFR
{
private $file;
public function __construct()
{
$this-file = '/tmp/'.session_id().'.xml';
}
public function __get($name)
{
if ($name=='file') return $this-file;
}
public function __destruct()
{
@unlink($this-file);
}
}
?
So I create an instance of this object and I put a reference to the object in
the session:
?php
$_SESSION['TFR'] = new __TFR();
?
I was then expecting TFR::__destruct() to only be called when the session was
closed, with either a timeout, or a session_destroy() call.
But it looks like the object destructor is called at the end of every page.
Any ideas about working around that?
The destructor will be called at the end of each page request because
the object in memory is destroyed.
When the object is serialized you will get __sleep being called, and
when it's unserialized you'll get __wakeup.
There is no way to detect when a session is destroyed unless you
implement your own session handler.
-Stuart
Oh bother. I guess it's a consequence of the statelessness of the PHP engine.
I thought I might be able to set a flag in __sleep() to indicate that the
session had been serialised rather than destroyed, but __destruct() is called
before __sleep().
I will have to see whether it is worth coding a custom session handler or to
just let the disk fill up... :)
--
Peter Ford phone: 01580 89
Developer fax: 01580 893399
Justcroft International Ltd., Staplehurst, Kent
--
PHP General Mailing List (http://www.php.net/)
To unsubscribe, visit: http://www.php.net/unsub.php
Re: [PHP] Re: Trying to create a colortable - what am I missing here?
Thodoris wrote:
דניאל דנון wrote:
I've tried to make a color table, but I am missing something. not in the
color-table-code itself, but in somewhere else... I just can't find...
untested but try..
// 4096*4096 = 16777216 = FF+1
$im = imagecreate(4096, 4096);
$white = imagecolorallocate($im, 0, 0, 0);
$r = $g = $b = $x = $y = 0;
$max = 255;
while ($r = $max) {
while ($g = $max) {
while ($b = $max) {
$n = imagecolorallocate($im, $r, $g, $b);
imagesetpixel($im, $x, $y, $n);
$x = $x == 4096 ? 0 : $x+1;
$y = $y == 4096 ? 0 : $y+1;
$b++;
}
$b = 0;
$g++;
}
$g = 0;
$r++;
}
header(Content-Type: image/png);
imagepng($im);
imagedestroy($im);
Never used image manipulation with PHP but this is giving me a black image.
You probably need
$im = imagecreatetruecolor(4096,4096);
Also be aware that creating a truecolor image 4096 pixels square is going to
take a LOT of memory, and it will take a while to download to the client, AND it
is 4096 pixels square! That's a fair bit bigger than most screens...
I suspect the OP is going to have to rethink this...
--
Peter Ford phone: 01580 89
Developer fax: 01580 893399
Justcroft International Ltd., Staplehurst, Kent
--
PHP General Mailing List (http://www.php.net/)
To unsubscribe, visit: http://www.php.net/unsub.php
Re: [PHP] Can not read write file from Desktop
Thodoris wrote: hi I was trying to read a file from Desktop (Centos), Simply saying (php code file is in /var/www/html/ ) if (file_exists(/root/Desktop/conf_files_linux)) echo yes file is there; else echo no none; It gives me none. If i place conf_files_linux file in /var/www/html. i get yes... After checking log file i got [notice] suEXEC mechanism enabled (wrapper: /usr/sbin/suexec) What i need to do, so tht i can access files from outside? help pls thanx I assume that this running by the web server (/var/www/html) so a wild guess is that the user that your web server uses to run (usually apache or www) cannot access the Desktop directory. In order to use the suexec feature you need to configure it or else the web server user needs to have read/write rights to the directory you need to access like the Desktop. Though this not recommended. You could always run this script from command line being root or whatever user is the owner of the Desktop directory. Read this if you are not aware of how this can be done: http://www.php.net/features.commandline If the OP's system is set up properly, then nobody but root should be able to read ANY of root's home directory, so the files will not be found. For a start, one doesn't want config files in anyone's home directory if they are for a system-wide server. And one doesn't EVER want to have anything in /root that anyone but root needs to access. And one shouldn't be logged in as root unless one is doing a short-lived system maintenance task: certainly one should not doing development work there... I know it sounds dictatorial, but it's (part-way to) best practice... Those config files should be in something like /etc/apache/extra, perhaps, if they are not safe in the web root (which they probably are not, unless the web server is configured to keep them safe) -- Peter Ford phone: 01580 89 Developer fax: 01580 893399 Justcroft International Ltd., Staplehurst, Kent -- PHP General Mailing List (http://www.php.net/) To unsubscribe, visit: http://www.php.net/unsub.php
Re: [PHP] How to deal with identical fields in db
tedd wrote: (and I added in some extra bits...) You need to normalize. Authors should have an unique id in an authors table. The authors table has all the specific information about authors, but not the books they have written. Books should have an unique id in a books table. The books table has all the specific information about books, but not the contributing authors. Like the ISBN, for example - that should be unique enough for anyone... I suppose if you deal in antique books, there might not be an ISBN. Then you connect the two tables with a Book-Author table that has only the id's of both -- no real need for any other information. This also has the advantage that when you come to add new books by authors already in the database, you only have to look the name up, and you can avoid duplicating authors with misspelt names, etc. You will have to allow for the case of a book with multiple authors, but that should work out fine - you just have two (or more) records in the Book-Author table to link the same book to several authors, and logic that watches out for that when you extract the data. That way when you want to see all the books an author has written, then you pull out all the records that has the author's id and look up each book via the book id. Likewise, when you want to see all the authors who have contributed to a book, then you pull out all records that has the book's id and look up each author via their author id. Do you see how it works? Cheers, tedd It always surprises me how many people need to have database normalisation explained to them - it seems obvious to me... (and tedd, clearly!) -- Peter Ford phone: 01580 89 Developer fax: 01580 893399 Justcroft International Ltd., Staplehurst, Kent -- PHP General Mailing List (http://www.php.net/) To unsubscribe, visit: http://www.php.net/unsub.php
Re: [PHP] How to deal with identical fields in db
tedd wrote: At 3:14 AM -0700 5/6/09, Michael A. Peters wrote: Peter Ford wrote: tedd wrote: (and I added in some extra bits...) You need to normalize. Authors should have an unique id in an authors table. The authors table has all the specific information about authors, but not the books they have written. Books should have an unique id in a books table. The books table has all the specific information about books, but not the contributing authors. Like the ISBN, for example - that should be unique enough for anyone... I suppose if you deal in antique books, there might not be an ISBN. Unfortunately sometimes an otherwise identical but different printing of the same book has different ISBN numbers. Sometimes the difference is hardback vs softcover, special edition, or just a reprint. The L.O.C. catalog number may be better, AFAIK there is typically only one LOC number per edition of a book. It is a good idea to record both (if both exist) and use an internally assigned substitute number when one, the other, or both don't exist (small run self published works often don't have a LOC number for example, if the author didn't want to pay for it). But for a database, a book identifier would probably be best (differing opinions on this) if it was simply an auto_increment unsigned integer primary key. A key that is generated upon entry of a book record. Certainly one can argue that using a different unique key might provide more information and make the table require one less field, but if one uses a primary key, then the field can be searched faster than using a ISBN or L.O.C., which may be duplicated, amended, or not even present. My thinking on this is a unique identifier for the book should not be tied to any attribute of the book, which may change, but rather something completely detached and artificial. Cheers, tedd tedd, That is, in fairness, probably what I'd do too: I might have the ISBN or LOC number as a detail field in the book record, and have it available for look-ups, but the primary key would just be a sequence number generated automatically. Same with authors, just a sequence number for the key. (I am not a number, I am a free man...) These things do not need to be visible to the user. Just an implementation detail, nothing to see here... :) Cheers Pete -- Peter Ford phone: 01580 89 Developer fax: 01580 893399 Justcroft International Ltd., Staplehurst, Kent -- PHP General Mailing List (http://www.php.net/) To unsubscribe, visit: http://www.php.net/unsub.php
[PHP] Re: graphical integrated development environment recommendations?
Adam Williams wrote: With the wide range of users on the list, I'm sure there are plenty of opinions on what are good graphical IDE's and which ones to avoid. I'd like to get away from using notepad.exe to code with due to its limitations. Something that supports syntax/code highlighting and has browser previews would be nice features. I'm looking at Aptana (www.aptana.com) but it seems like it is more complicated to use then it should be. Either Linux or Windows IDE (i run both OSes) recommendations would be fine. Netbeans: works on Windows or Linux (or OSX, if you're that way inclined), and it's free. -- Peter Ford phone: 01580 89 Developer fax: 01580 893399 Justcroft International Ltd., Staplehurst, Kent -- PHP General Mailing List (http://www.php.net/) To unsubscribe, visit: http://www.php.net/unsub.php
Re: [PHP] object literals
Richard Heyes wrote:
Hi,
$x = (object) array('a'=1, 'b'=3, ...);
which works but isn't very lovely. it's neater in, for example, javascript.
Well, you could wrap it up in a function to make it a bit lovelier. Eg:
$foo = createObject(array('key' = 'value'));
It's not great, but PHP doesn't have a object literal syntax AFAIK.
You could use JSON,
$foo = json_decode('{a:1,b:3}');
but I guess that's not much better than Richard's suggestion.
--
Peter Ford phone: 01580 89
Developer fax: 01580 893399
Justcroft International Ltd., Staplehurst, Kent
--
PHP General Mailing List (http://www.php.net/)
To unsubscribe, visit: http://www.php.net/unsub.php
[PHP] Re: error in printer_open function
AYAN PAL wrote: hi, i am using local server to print a simple text i config the php.ini file as ;extension=php_printer.dll added in the extension list and add [printer] printer.default_printer = Send To OneNote 2007 in this file and write a sim ple page as- Prabal Cable Network The ; at the start of the configuration line in php.ini is a comment character... Remove that, restart the web server, and you might see things working better. -- Peter Ford phone: 01580 89 Developer fax: 01580 893399 Justcroft International Ltd., Staplehurst, Kent -- PHP General Mailing List (http://www.php.net/) To unsubscribe, visit: http://www.php.net/unsub.php
[PHP] Multiple return statements in a function.
I tend to put my return value in a variable and at the end of the
function I have 1 return statement.
I have seen others doing returns in the middle of the function.
Example how I do it:
function check($a) {
$return='';
if ( is_array( $a ) ) {
$return='Array';
} else {
$return='Not Array';
}
return $return;
}
Example of the other method:
function check($a) {
if ( is_array( $a ) ) {
return ('Array');
} else {
return ('Not Array');
}
}
What is your take? And is there any benefit to either method?
--
Peter van der Does
GPG key: E77E8E98
Blog: http://blog.avirtualhome.com
Forums: http://forums.avirtualhome.com
Jabber ID: pvanderd...@gmail.com
GetDeb Package Builder
http://www.getdeb.net - Software you want for Ubuntu
--
PHP General Mailing List (http://www.php.net/)
To unsubscribe, visit: http://www.php.net/unsub.php
Re: [PHP] Generate XHTML (HTML compatible) Code using DOMDocument
Michael Shadle wrote:
On Mon, Apr 13, 2009 at 2:19 AM, Michael A. Peters mpet...@mac.com wrote:
The problem is that validating xhtml does not necessarily render properly in
some browsers *cough*IE*cough*
I've never had problems and my work is primarily around IE6 / our
corporate standards. Hell, even without a script type it still works
:)
Would this function work for sending html and solve the utf8 problem?
function makeHTML($document) {
$buffer = $document-saveHTML();
$output = html_entity_decode($buffer,ENT_QUOTES,UTF-8);
return $output;
}
I'll try it and see what it does.
this was the only workaround I received for the moment, and I was a
bit afraid it would not process the full range of utf-8; it appeared
on a quick check to work but I wanted to run it on our entire database
and then ask the native geo folks to examine it for correctness.
I find that IE7 (at least) is pretty reliable as long as I use strict XHTML and
send a DOCTYPE header to that effect at the top - that seems to trigger a
standard-compliant mode in IE7.
At least then I only have to worry about the JavaScript incompatibilities, and
the table model, and the event model, and
--
Peter Ford phone: 01580 89
Developer fax: 01580 893399
Justcroft International Ltd., Staplehurst, Kent
--
PHP General Mailing List (http://www.php.net/)
To unsubscribe, visit: http://www.php.net/unsub.php
[PHP] Larger fonts...
Patrick, The reason you think the fonts are too small is that you have (un)zoomed the screen at some point. The proportions of the centre white panel to the side bars is wrong. Measuring your screenshots, and assuming you had a full-screen browser window at 1680x1050 resolution (what your monitor does), I work out that the white section of the screen is only around 800 pixels wide - it is defined to be 1000 pixels wide at normal magnification. Measuring the icons suggests that your screen is showing them at 42 pixels, while they are supposed to be 56 pixels. Overall, your seeing the whole thing at 80% full size - no wonder the fonts look small! The fonts and icon sizes haven't changed for about a year, and you haven't really complained before. In addition, you are using a pretty large screen - the pages are designed to work on a 1024x768 screen as a minimum. Making the fonts larger would drastically reduce the amount of information displayed vertically - it's already pretty tight on some of the design screens. So, I'll ignore the calls for bigger fonts and icons. The button icons may also look better at full size, but the main problem is that they need to be properly designed. Replacing them with just words is not very good - it makes them all different sizes, which messes up the layout. I could remove the shaded background and see if that helps. Other points I will work on. Cheers -- Peter Ford phone: 01580 89 Developer fax: 01580 893399 Justcroft International Ltd., Staplehurst, Kent -- PHP General Mailing List (http://www.php.net/) To unsubscribe, visit: http://www.php.net/unsub.php
Re: [PHP] Larger fonts...
Tom, You're right - I tried to catch it before it went, but just too late! To the list - please ignore the message Tom refers to - it's not too commercially sensitive, at least. I probably need more coffee before fielding bug reports in the morning. Cheers Pete Tom Chubb wrote: Pete, Before you get slated by the list, I'm guessing you meant to send this to someone else? (It came to me via the PHP-General Mailing List. Tom 2009/4/8 Peter Ford p...@justcroft.com mailto:p...@justcroft.com Patrick, The reason you think the fonts are too small is that you have (un)zoomed the screen at some point. The proportions of the centre white panel to the side bars is wrong. Measuring your screenshots, and assuming you had a full-screen browser window at 1680x1050 resolution (what your monitor does), I work out that the white section of the screen is only around 800 pixels wide - it is defined to be 1000 pixels wide at normal magnification. Measuring the icons suggests that your screen is showing them at 42 pixels, while they are supposed to be 56 pixels. Overall, your seeing the whole thing at 80% full size - no wonder the fonts look small! The fonts and icon sizes haven't changed for about a year, and you haven't really complained before. In addition, you are using a pretty large screen - the pages are designed to work on a 1024x768 screen as a minimum. Making the fonts larger would drastically reduce the amount of information displayed vertically - it's already pretty tight on some of the design screens. So, I'll ignore the calls for bigger fonts and icons. The button icons may also look better at full size, but the main problem is that they need to be properly designed. Replacing them with just words is not very good - it makes them all different sizes, which messes up the layout. I could remove the shaded background and see if that helps. Other points I will work on. Cheers -- Peter Ford phone: 01580 89 Developer fax: 01580 893399 Justcroft International Ltd., Staplehurst, Kent -- PHP General Mailing List (http://www.php.net/) To unsubscribe, visit: http://www.php.net/unsub.php -- Tom Chubb t...@tomchubb.com mailto:t...@tomchubb.com | tomch...@gmail.com mailto:tomch...@gmail.com 07912 202846 -- Peter Ford, Developer phone: 01580 89 fax: 01580 893399 Justcroft International Ltd. www.justcroft.com Justcroft House, High Street, Staplehurst, Kent TN12 0AH United Kingdom Registered in England and Wales: 2297906 Registered office: Stag Gates House, 63/64 The Avenue, Southampton SO17 1XS -- PHP General Mailing List (http://www.php.net/) To unsubscribe, visit: http://www.php.net/unsub.php
[PHP] Re: PHP class or functions to manipulate PDF metadata?
O. Lavell wrote: Peter Ford wrote: O. Lavell wrote: [..] Any and all suggestions are welcome. Thank you in advance. So many people ask about manipulating, editing and generally processing PDF files. In my experience, PDF is a write-once format - any manipulation should have been done in whatever source generated the PDF. I think of a PDF as being a piece of paper: if you want to change the content of a piece of paper it is usually best to chuck it away and start again... Even more so, this would apply to the PDF metadata: metadata is supposed to describe the nature of the document: it's author, creation time etc. That sort of data should be maintained with the document and ideally not changed throughout the document's lifetime (like the footer, or end-papers in a physical book) Thank you very much for your reply. And it's not that I don't agree with you. Because I do, completely. However... PDFs often come from sources that can't be bothered to fill in the relevant fields correctly, completely, or at all. For those cases I would like the users of my application to be able to correct the values found in the metadata. Upload the PDF, get a nice little HTML form with 4 or 5 values to review or edit. That sort of thing. I do accept that the metadata should be machine-readable: that part of your project is reasonable and I'm fairly sure that ought to be possible with something simple. The best bet I found so far is PDFTK (http://www.pdfhacks.com/pdftk/) which is a command-line tool that you could presumably call with exec or whatever... Like I said, this is what I am already doing with the pdfinfo utility from xpdf. Sorry - I guess I didn't read that bit carefully enough... But now that you mentioned pdftk... I just tried it and it does seem to come close to what I want. It is capable of writing a new PDF with the contents of an existing one, with new metadata fed as a text file. So it shouldn't be very hard to write a little PHP around that process. Now I need to think a bit more about this approach. Perhaps it can be implemented using only pure PHP, after all. But for the time being, pdftk will do. So thank you again for pushing me in that direction, even if unintentionally and despite the fact that what I am doing goes against your judgement ;) As I know only too well, you can't always choose your customers (especially if they choose you...) and you certainly can't control all of the sources of data you have to deal with! I have spent many hours/days/possibly longer hacking through files that are in one form to get data into another, and PDF is the one that always makes me nervous :( My judgement is certainly not final, or even particularly important: if I had time I would also look into at least getting the metadata with pure PHP. Good luck... -- Peter Ford phone: 01580 89 Developer fax: 01580 893399 Justcroft International Ltd., Staplehurst, Kent -- PHP General Mailing List (http://www.php.net/) To unsubscribe, visit: http://www.php.net/unsub.php
