Please help... struggling beginner.
Hello, I am very much a novice at perl and probably bitten off more than I can chew here. I have a file, which is a dump of a database - so it is a fixed file format. The problem is that I am struggling to manipulate it correctly. I have been trying for two days now to get a program to work. The idea is to remove the duplicate records, ie a record begins with Name and ends with Values End. The program that I have thus far, is pathetic in the sense I have opened three files, the file below, a data file for cleaned data, and a file for capturing the usernames already processed. But I have got stuck on how to compare and work through the file line for line and then only to capture the lines that are not duplicated. Please help - I am running out of time. Here is the file format File Begins #DB dumped #DB version 8.0 #SW version 2.6(1.10) #--- -- Name : system Some stuff here... many lines Of different format... such as line below... User Count: 0 ##--- User End Lots of text here... Until... We get line below... ##--- Values End #--- -- Name : ###profile0 Some stuff here... many lines Of different format... such as line below... User Count: 188 ##--- User End Lots of text here... Until... We get line below... ##--- Values End #--- -- Name : vermaakm Some stuff here... many lines Of different format... such as line below... User Count: 0 ##--- User End Lots of text here... Until... We get line below... ##--- Values End #--- -- Name : TFMC\vanzylm Some stuff here... many lines Of different format... such as line below... CounterRst_01 : 2acac9101c335c8 ##--- User End Lots of text here... Until... We get line below... ##--- Values End #--- -- #End Of Dump File Ends Denham Eva Oracle DBA Linux like TeePee... No Windows, No Gates and Apache inside! _ This e-mail message has been scanned for Viruses and Content and cleared by MailMarshal For more information please visit www.marshalsoftware.com _ # Note: This message is for the named person's use only. It may contain confidential, proprietary or legally privileged information. No confidentiality or privilege is waived or lost by any mistransmission. If you receive this message in error, please immediately delete it and all copies of it from your system, destroy any hard copies of it and notify the sender. You must not, directly or indirectly, use, disclose, distribute, print, or copy any part of this message if you are not the intended recipient. TFMC and any of its subsidiaries each reserve the right to monitor all e-mail communications through its networks. Any views expressed in this message are those of the individual sender, except where the message states otherwise and the sender is authorized to state them to be the views of any such entity. Thank You. -- To unsubscribe, e-mail: [EMAIL PROTECTED] For additional commands, e-mail: [EMAIL PROTECTED]
Log into a site and do stuff
Hi I am working on a module that occasionally needs to raise alarms by sending sms to concerned ppl. For this, I would like to login to the site : www.sms.ac The login page is http://www.sms.sc/login.asp Then I have to go to the main page , fill the To: and Message: textboxes and send sms. I have no prior experience with LWP and couldn't make much use of perldoc lwpcook Could someone please tell me how I can accomplish this feat. A pointer towards a newbie resource on this perl feature or some sample code will surely help. Thanks aman -- To unsubscribe, e-mail: [EMAIL PROTECTED] For additional commands, e-mail: [EMAIL PROTECTED]
Re: Please help... struggling beginner.
On Mon, Jun 23, 2003 at 10:43:07AM +0200 Denham Eva wrote:
I am very much a novice at perl and probably bitten off more than I can chew
here.
I have a file, which is a dump of a database - so it is a fixed file format.
The problem is that I am struggling to manipulate it correctly. I have been
trying for two days now to get a program to work. The idea is to remove the
duplicate records, ie a record begins with Name and ends with Values End.
The program that I have thus far, is pathetic in the sense I have opened
three files, the file below, a data file for cleaned data, and a file for
capturing the usernames already processed. But I have got stuck on how to
compare and work through the file line for line and then only to capture the
lines that are not duplicated.
Keeping a couple of files around is not necessarily pathetic. I think
you don't need a file for the processed usernames. But the original file
and one for the processed data is a totally common pattern.
Here is the file format
File Begins
#DB dumped
#DB version 8.0
#SW version 2.6(1.10)
#---
--
Name : system
Some stuff here...
many lines
Of different format...
such as line below...
User Count: 0
##--- User End
Lots of text here...
Until...
We get line below...
##--- Values End
#---
--
So, #-... is essentially the record separator? A fixed separator
is good because it makes processing rather easy. It might be handy to
both set the input record separator to this value:
#! /usr/bin/perl -w
use strict;
local $/ =
#-\n;
open IN, old_database or die $!;
open OUT, new_database or die $!;
# keep track of what records have already been seen
my %records_seen;
# this is the 'header', that is: what is before the first record
print OUT scalar IN;
while (IN) {
if (/Name\s+:\s+(\S+)/) {
#^^^
# $1 is record name
next if $records_seen{ $1 }++;
print OUT $_;
}
}
print OUT #End Of Dump\n;
close IN;
close OUT;
Tassilo
--
$_=q#,}])!JAPH!qq(tsuJ[{@tnirp}3..0}_$;//::niam/s~=)]3[))_$-3(rellac(=_$({
pam{rekcahbus})(rekcah{lrePbus})(lreP{rehtonabus})!JAPH!qq(rehtona{tsuJbus#;
$_=reverse,s+(?=sub).+q#q!'qq.\t$.'!#+sexisexiixesixeseg;y~\n~~;eval
--
To unsubscribe, e-mail: [EMAIL PROTECTED]
For additional commands, e-mail: [EMAIL PROTECTED]
Re: Please help... struggling beginner.
Denham Eva said:
Hello,
I am very much a novice at perl and probably bitten off more than I can
chew
here.
I have a file, which is a dump of a database - so it is a fixed file
format.
The problem is that I am struggling to manipulate it correctly. I have
been
trying for two days now to get a program to work. The idea is to remove
the
duplicate records, ie a record begins with Name and ends with Values End.
The program that I have thus far, is pathetic in the sense I have opened
three files, the file below, a data file for cleaned data, and a file for
capturing the usernames already processed. But I have got stuck on how to
compare and work through the file line for line and then only to capture
the
lines that are not duplicated.
Please help - I am running out of time.
You forgot to attach your code. If you let us see what you've done it
is usually easier to provide relevant help.
I'm not sure I completely understand your problem, but here is a script
which will remove records with duplicate names.
#!/bin/perl -w
use strict;
$/ = #. - x 77 . \n;
my %seen;
while ()
{
if (my ($name) = /^Name : +(\S+)/)
{
next if $seen{$name};
$seen{$name}++;
}
print;
}
__END__
The trick is to set $/ to the line which is separating your records so
that each record is read in as a whole. Then I simply extract the name
from the record and don't print it if it has been seen already. I
suspect that your actual requirements will differ here.
--
Paul Johnson - [EMAIL PROTECTED]
http://www.pjcj.net
--
To unsubscribe, e-mail: [EMAIL PROTECTED]
For additional commands, e-mail: [EMAIL PROTECTED]
Why
Hello. I am new to Perl. I used to program in C years ago (not C++ # etc) I have the simplest question. I am running active state perl 5 on Win XP. I'm using OpenPERL Ide 1.0 #!k:/perl/bin/perl.exe # # Camel-Learning Perl # Exercise 2-4 # Input a b from Console STDIN # Then multiply print them # print Enter an integer: ,$a=STDIN;# This don't work # print Enter an integer: \n;# Neither does this $a=STDIN;# ... This program excerpt above is driving me crazy! I can NOT get the PROMPT to appear BEFORE the program waits for input. I have tried several different ways to do this. No matter what I do, the screen stays blank, until I enter a value, THEN the prompt is printed! This works for me, but when I get into a larger program, the USER is going to have to read the PROMPT BEFORE they know what to type in! Can you help me out here? Thank you, Scott Graham ### # # # SGM Systems - Scott Graham # # # # Professional Web Development Hosting Services # # Professional E-Mail List Hosting Services # # # #Contact: [EMAIL PROTECTED] # #Visit: http://www.sgmsys.com # # # ###
context, printing, and concatenation
I'm on the first few chapters of Learning Perl and came up with a question. Given: - #!/usr/bin/perl @array = qw ( one two three ); print @array . \n; print @array; - Can you explain why the first print statement prints 3 (and a carriage return) while the second prints onetwothree? My understanding is that the first print sees the array in scalar context while the second sees it in list context, but if so I don't understand why. Can someone break it down what the concatenation operator is doing here? Thanks. -- You can't waste a life hating people, because all they do is live their life, laughing, doing more evil. -- Alpha Robertson, whose daughter was killed in a Birmingham church bombing in 1963. -- To unsubscribe, e-mail: [EMAIL PROTECTED] For additional commands, e-mail: [EMAIL PROTECTED]
installing modules
How can I install the MD5 module on the server where I'm hosting my website? _ MSN 8 helps eliminate e-mail viruses. Get 2 months FREE*. http://join.msn.com/?page=features/virus -- To unsubscribe, e-mail: [EMAIL PROTECTED] For additional commands, e-mail: [EMAIL PROTECTED]
installing modules
Could anyone give me step by tep instructions on how to install a perl module (MD5) on my host server. How come they don't have it installed? Isn't popular enough? Sorry if I sent the same message for the second time, but the prvious one doesn't came through on my list. Mariusz _ Add photos to your messages with MSN 8. Get 2 months FREE*. http://join.msn.com/?page=features/featuredemail -- To unsubscribe, e-mail: [EMAIL PROTECTED] For additional commands, e-mail: [EMAIL PROTECTED]
Re: context, printing, and concatenation
Peter said: I'm on the first few chapters of Learning Perl and came up with a question. Given: - #!/usr/bin/perl @array = qw ( one two three ); print @array . \n; print @array; - Can you explain why the first print statement prints 3 (and a carriage return) while the second prints onetwothree? My understanding is that the first print sees the array in scalar context while the second sees it in list context, but if so I don't understand why. Can someone break it down what the concatenation operator is doing here? Your understanding is correct. Concatenation works on scalars, so the array is evaluated in scalar context, returning 3, which is concatenated with \n and then printed. In the second line, print takes a list, so the array is evaluated in list context. -- Paul Johnson - [EMAIL PROTECTED] http://www.pjcj.net -- To unsubscribe, e-mail: [EMAIL PROTECTED] For additional commands, e-mail: [EMAIL PROTECTED]
perl reg exp problem
Hi all, I have a string that is a random sequence like the following:- ACGTCGTCGTCACACACACGCGTCTCTATACGCG I want to be able to parse the string, picking out any TATA sequences, colour them in red and make a not of where ther lie in the sequence. Is this possible with perl? cheers Rob. === Netnorth Limited 7-8 Queensbrook Bolton Technology Exchange Bolton BL1 4AY d/l: 01204 900714 tel: 01204 900700 Fax: 01204 900777 email: [EMAIL PROTECTED] === ~~ Why not try our dial-up ? Modem Tel: 0845 055 0006 Username: netnorthdial Password: netnorthdial All formats supported, including V90, ISDN, ISDN dual channel, Mobile Phones ~~ -- To unsubscribe, e-mail: [EMAIL PROTECTED] For additional commands, e-mail: [EMAIL PROTECTED]
Re: perl reg exp problem
Robin Garbutt wrote at Mon, 23 Jun 2003 11:40:47 +0100: I have a string that is a random sequence like the following:- ACGTCGTCGTCACACACACGCGTCTCTATACGCG I want to be able to parse the string, picking out any TATA sequences, colour them in red and make a not of where ther lie in the sequence. Is this possible with perl? Yes, but you have to explain in what matter you want to colorize. As output in a terminal window, as html/xml, as a picture, as a word document ... . If you would have in a pseudo-xml with the tag red.../red, you would perhaps do it as: $string =~ s/(TATA)/red$1/red/g; Greetings, Janek -- To unsubscribe, e-mail: [EMAIL PROTECTED] For additional commands, e-mail: [EMAIL PROTECTED]
Re: installing modules
Mario Kulka wrote at Mon, 23 Jun 2003 03:40:03 +: Could anyone give me step by tep instructions on how to install a perl module (MD5) on my host server. How come they don't have it installed? Isn't popular enough? BTW, the MD5 module is deprecated. It is recommended to install Digest::MD5 instead. The simplest way to install it is to type perl -MCPAN -e 'install Digest::MD5' The other, more classical way to install is to get the package from cpan (http://search.cpan.org/CPAN/authors/id/G/GA/GAAS/Digest-MD5-2.24.tar.gz) to unpack it and then to follow the normal way perl Makefile.PL make make test make install (last as root) Please read also perldoc perlmodinstall to get a more detailed explication. Greetings, Janek -- To unsubscribe, e-mail: [EMAIL PROTECTED] For additional commands, e-mail: [EMAIL PROTECTED]
RE: perl reg exp problem
what does shift do in perl? cheers Rob. -Original Message- From: Janek Schleicher [mailto:[EMAIL PROTECTED] Sent: 23 June 2003 08:52 To: [EMAIL PROTECTED] Subject: Re: perl reg exp problem Robin Garbutt wrote at Mon, 23 Jun 2003 11:40:47 +0100: I have a string that is a random sequence like the following:- ACGTCGTCGTCACACACACGCGTCTCTATACGCG I want to be able to parse the string, picking out any TATA sequences, colour them in red and make a not of where ther lie in the sequence. Is this possible with perl? Yes, but you have to explain in what matter you want to colorize. As output in a terminal window, as html/xml, as a picture, as a word document ... . If you would have in a pseudo-xml with the tag red.../red, you would perhaps do it as: $string =~ s/(TATA)/red$1/red/g; Greetings, Janek -- To unsubscribe, e-mail: [EMAIL PROTECTED] For additional commands, e-mail: [EMAIL PROTECTED] -- To unsubscribe, e-mail: [EMAIL PROTECTED] For additional commands, e-mail: [EMAIL PROTECTED]
Re: Why
Scott_g wrote at Sun, 22 Jun 2003 15:21:24 -0500: Hello. I am new to Perl. I used to program in C years ago (not C++ # etc) I have the simplest question. I am running active state perl 5 on Win XP. I'm using OpenPERL Ide 1.0 #!k:/perl/bin/perl.exe # # Camel-Learning Perl # Exercise 2-4 # Input a b from Console STDIN # Then multiply print them # print Enter an integer: ,$a=STDIN;# This don't work Perl interpretes this as print( Enter an integer: , $a=STDIN ); So it can executes print only when both arguments are evaluated first, forcing you to enter $a before you see the prompt. # print Enter an integer: \n;# Neither does this $a=STDIN;# ... This program excerpt above is driving me crazy! I can NOT get the PROMPT to appear BEFORE the program waits for input. I have tried several different ways to do this. No matter what I do, the screen stays blank, until I enter a value, THEN the prompt is printed! This works for me, but when I get into a larger program, the USER is going to have to read the PROMPT BEFORE they know what to type in! Try instead the explicit print(Enter an integer: ),$a=STDIN; allthough I still would prefer in most cases to write the semicolon instead of the comma (but of course in some cases it's very useful like print(...),$x=STDIN unless defined($x); ) Greetings, Janek PS: $a is a bad name for a variable as it is a global variable used for sortings. (Read perldoc perlvar for details). -- To unsubscribe, e-mail: [EMAIL PROTECTED] For additional commands, e-mail: [EMAIL PROTECTED]
Re: There has to be a way to do this
I don't have code to do what I want, but here's the pieces I'm trying to string together: Abbreviation dictionary consists of a file like this: SRED. SREDNE SEV. SEVERN etc. Each abbreviation is turned into four regexes, like this (doubtless they could be made more efficient, but they work well enough at present): # Sred. = SREDNE $cgname =~ s/^SRED\.(?=[\W\s\-\d]+)/SREDNE:/g ; # Match it at beginning of line $cgname =~ s/[\W\s\-]+SRED\.(?=[\W\s\-\d]+)/:SREDNE:/g ; # Match it within the line $cgname =~ s/[\W\s\-]+SRED\.$/:SREDNE:/g ; # Match it at end of line $cgname =~ s/^SRED\.$/:SREDNE:/g ; # Match if it begins ends line # Sev. = SEVERN $cgname =~ s/^SEV\.(?=[\W\s\-\d]+)/SEVERN:/g ;# Match it at beginning of line $cgname =~ s/[\W\s\-]+SEV\.(?=[\W\s\-\d]+)/:SEVERN:/g ; # Match it within the line $cgname =~ s/[\W\s\-]+SEV\.$/:SEVERN:/g ; # Match it at end of line $cgname =~ s/^SEV\.$/:SEVERN:/g ; # Match if it begins ends line etc. Right now I'm generating the regexes in a standalone script, then inserting the output code into the subroutine that processes names into a matchable form. What I'd like to be able to do is take a *set* of abbreviation dictionaries, concatenate them together and dynamically generate the regex code in the routine that is going to execute it. Thanks, Scott Scott E. Robinson SWAT Team UTC Onsite User Support RR-690 -- 281-654-5169 EMB-2813N -- 713-656-3629 David Kirol [EMAIL PROTECTED]To: [EMAIL PROTECTED] cc: Subject: Re: There has to be a way to do this 06/20/03 08:38 PM Scott, Sounds like a fun problem. Can you post some code and an (abbreviated) set of example data? David Scott E Robinson [EMAIL PROTECTED] wrote in message news:[EMAIL PROTECTED]... I'm still working on the well-name matching program that I've brought up here before. I've received invaluable help to solve the toughest questions in its development, for which I'm very grateful. Now I'm trying to automate some steps which were previously manual in the process, to make it more end-user-friendly. There has to be a way to do this with Perl. The script uses a dictionary of abbreviations to aid its matching. The abbreviations are implemented as a series of substitutions with the s operator. I have a Perl script which builds the substitution statements from a tab-delimited list of abbreviations and their equivalent long forms. I then manually insert these statements into the subroutine that uses them. I kept the abbreviation translation hardcoded into the subroutine for performance reasons (this thing compares 14,000 unknown well names against 680,000 match candidates). Is there a way in Perl to read the abbreviation dicitionary (the tab-delimited list), generate the code, insert it into the right subroutine, and start executing the program, all in one script? (Maybe you can tell me that the performance hit from using variables in the substitution statements is negligible, and if so, I'd be happy to go that route.) Thanks in advance, Scott Scott E. Robinson Data SWAT Team UTC Onsite User Support RR-690 -- 281-654-5169 EMB-2813N -- 713-656-3629 -- To unsubscribe, e-mail: [EMAIL PROTECTED] For additional commands, e-mail: [EMAIL PROTECTED]
RE: Why
Scott_G [EMAIL PROTECTED] wrote: : : Hello. I am new to Perl. I used to program in C : years ago (not C++ # etc) : : I have the simplest question. I am running active : state perl 5 on Win XP. : : I'm using OpenPERL Ide 1.0 : It's probably your IDE. This works from a console: print Enter an integer: \n; my $answer = STDIN; print Enter another integer: \n; $answer = STDIN; It fails in my editor because the editor is using a method that captures i/o from a console under windows XP. Open a console (DOS prompt) and type the following (change where appropriate). perl path/to/script/script.pl : This works for me, but when I get into a larger : program, the USER is going to have to read the : PROMPT BEFORE they know what to type in! If you force your window users to use a console, this is most likely how they will access it. Not through your IDE. Using a command line interface on a windows platform would really lower the usage of your program though. Windows users want GUIs. HTH, Charles K. Clarkson -- Head Bottle Washer, Clarkson Energy Homes, Inc. Mobile Home Specialists 254 968-8328 -- To unsubscribe, e-mail: [EMAIL PROTECTED] For additional commands, e-mail: [EMAIL PROTECTED]
Re: perl reg exp problem
Robin Garbutt [EMAIL PROTECTED] wrote in message news:[EMAIL PROTECTED] what does shift do in perl? cheers Rob. -Original Message- From: Janek Schleicher [mailto:[EMAIL PROTECTED] Sent: 23 June 2003 08:52 To: [EMAIL PROTECTED] Subject: Re: perl reg exp problem Robin Garbutt wrote at Mon, 23 Jun 2003 11:40:47 +0100: I have a string that is a random sequence like the following:- ACGTCGTCGTCACACACACGCGTCTCTATACGCG I want to be able to parse the string, picking out any TATA sequences, colour them in red and make a not of where ther lie in the sequence. Is this possible with perl? Yes, but you have to explain in what matter you want to colorize. As output in a terminal window, as html/xml, as a picture, as a word document ... . If you would have in a pseudo-xml with the tag red.../red, you would perhaps do it as: $string =~ s/(TATA)/red$1/red/g; Greetings, Janek -- To unsubscribe, e-mail: [EMAIL PROTECTED] For additional commands, e-mail: [EMAIL PROTECTED] -- To unsubscribe, e-mail: [EMAIL PROTECTED] For additional commands, e-mail: [EMAIL PROTECTED]
Re: perl reg exp problem
Opps double clicked first time round, I blame my mouse :-) Robin, perl has online documentation for all it's functions and much more. try the following perldoc -f shift and perldoc perldoc for more general advice HTH Rob Anderson [EMAIL PROTECTED] wrote in message news:[EMAIL PROTECTED] Robin Garbutt [EMAIL PROTECTED] wrote in message news:[EMAIL PROTECTED] what does shift do in perl? cheers Rob. -Original Message- From: Janek Schleicher [mailto:[EMAIL PROTECTED] Sent: 23 June 2003 08:52 To: [EMAIL PROTECTED] Subject: Re: perl reg exp problem Robin Garbutt wrote at Mon, 23 Jun 2003 11:40:47 +0100: I have a string that is a random sequence like the following:- ACGTCGTCGTCACACACACGCGTCTCTATACGCG I want to be able to parse the string, picking out any TATA sequences, colour them in red and make a not of where ther lie in the sequence. Is this possible with perl? Yes, but you have to explain in what matter you want to colorize. As output in a terminal window, as html/xml, as a picture, as a word document ... . If you would have in a pseudo-xml with the tag red.../red, you would perhaps do it as: $string =~ s/(TATA)/red$1/red/g; Greetings, Janek -- To unsubscribe, e-mail: [EMAIL PROTECTED] For additional commands, e-mail: [EMAIL PROTECTED] -- To unsubscribe, e-mail: [EMAIL PROTECTED] For additional commands, e-mail: [EMAIL PROTECTED]
RE: Can LWP::Simple tranfer image urls?
Finally, some usefull stuff in Perl ;-)) Finally? This is the Perl list not the PHP list ;p -- To unsubscribe, e-mail: [EMAIL PROTECTED] For additional commands, e-mail: [EMAIL PROTECTED]
Process question
Since I didn't get any responses on my last question about process creation and the killing of child processes I thought that maybe I'd switch gears a bit and ask: On Unix does one know how I can get the process id of a process kicked off from within a perl script via the back-tic (`) syntax? Or a module which allows the running of sub programs which also will return the process id of the sub program? Thanks, Steve -- To unsubscribe, e-mail: [EMAIL PROTECTED] For additional commands, e-mail: [EMAIL PROTECTED]
SSH Problem
Hi all,
i have the following problem with the following script:
#!/usr/bin/perl -w
# $Id: cmd.pl,v 1.4 2001/02/22 00:14:48 btrott Exp $
use strict;
use Net::SSH::Perl;
use Net::SSH::Perl::Cipher;
chomp(my $this_host = `hostname`);
print Enter a host name to connect to: [$this_host] ;
chomp(my $host = STDIN);
print \n;
print Enter the port number of the remote sshd: [ssh] ;
chomp(my $port = STDIN);
print \n;
print Choose a cipher from the list:\n;
my $supp = Net::SSH::Perl::Cipher::supported();
for my $ciph (sort @$supp) {
printf [%d] %s\n, $ciph, Net::SSH::Perl::Cipher::name($ciph);
}
printf Enter a number: [%d] , Net::SSH::Perl::Cipher::id('IDEA');
chomp(my $c = STDIN);
print \n;
my $ssh = Net::SSH::Perl-new($host || $this_host,
port = $port || 'ssh',
cipher = Net::SSH::Perl::Cipher::name($c),
debug = 1);
my $this_user = scalar getpwuid($);
print Enter your username on that host: [$this_user] ;
chomp(my $user = STDIN);
use Term::ReadKey;
print And your password: ;
ReadMode('noecho');
chomp(my $pass = ReadLine(0));
ReadMode('restore');
print \n;
$ssh-login($user || $this_user, $pass);
print Enter a command to execute: [ls -l] ;
chomp(my $cmd = STDIN);
my($out, $err) = $ssh-cmd($cmd || ls -l);
print $out;each time i run the script it gets me the error that the input into the
crypt-module must be 8 byte long.when i replace the $cmd with a plain command e.g.:
ls -l it works.Pls help me out.ThxRudi
RE: Quick CGI query_string() question
So if $q above is : hi=byelove=hateone=twoetc=etc
Hmmm. Do you work for the State Department or something? Or
the White House Press office?
That was a good one
I want to remove, say 'love', so it'd be: hi=byeone=twoetc=etc
I know I could do a regex but I'd like a CGI way to do
Why mess with it? If you need a string without the
particular parameters, you could easily regex them out:in the
variable itself, but the query string of the CGI object is
basically meant as a read-only attribute. Why not just work
with the variable $q? Since the CGI module is basically
object-oriented, the CGI way to do it would be to just let
the internals of the CGI object be, use what you need, and
leave the rest.
It would probably help to know what actual effect you are
trying to achieve that you see as requiring manipulation of
the query string.
Well what I wanted to do was this:
Take the value of a param, remove it and replace it with something else based on what
the original param was:
Joe=mamado=this
If($do = 'this') { $work = 'hard'; } else { $work = 'lazy'; }
Joe=mamawork=$work
Then I use this string to as an argument to a backtick execution.
It's to verify input and an extra layer to keep evil things out.
The CGI delete() function did the trick for this.
Thanks
Dan
Joseph
--
To unsubscribe, e-mail: [EMAIL PROTECTED]
For additional commands, e-mail: [EMAIL PROTECTED]
RE: Can LWP::Simple tranfer image urls?
Do I need to change the http header for transfering image urls? I get errors Yes. And what do you mean by 'transfer'? You may want Net::FTP when I transfer a jpg: picture cannot be displayed because it contains errors. Try this: #!/usr/bin/perl -w use strict; use LWP::Simple; print Content-type: image/gif\n\n; print get(http://www.google.com/images/logo.gif;); Use warnings and strict to track down errors. HTH DMuey -- To unsubscribe, e-mail: [EMAIL PROTECTED] For additional commands, e-mail: [EMAIL PROTECTED]
Re: context, printing, and concatenation
On Jun 22, Peter said: print @array . \n; print @array; Can you explain why the first print statement prints 3 (and a carriage return) while the second prints onetwothree? My understanding is that the first print sees the array in scalar context while the second sees it in list context, but if so I don't understand why. Can someone break it down what the concatenation operator is doing here? The concatenation operator joins two SCALARS together. That means that its two arguments will be evaluated in scalar context, so it's like saying print( (scalar(@array) . \n) ); -- Jeff japhy Pinyan [EMAIL PROTECTED] http://www.pobox.com/~japhy/ RPI Acacia brother #734 http://www.perlmonks.org/ http://www.cpan.org/ stu what does y/// stand for? tenderpuss why, yansliterate of course. [ I'm looking for programming work. If you like my work, let me know. ] -- To unsubscribe, e-mail: [EMAIL PROTECTED] For additional commands, e-mail: [EMAIL PROTECTED]
CHOMP and {$query-param( question...
I have a Publication Order Form, with checkboxes beside each title. The list needs to
be emailed to ONLY the department that carries the publication ordered (not all
departments).
I think I should I grab the form data, use CHOMP to get only fire from fire-01 but
then how do I get it into {$query-param( (see snip3) so I can associate it with
the email address?
Many thanks,
Gregg
snip1
##
# Assigned variables (left of =) from FORM INPUT (right of =)
##
my $ri_001 = $query-param('oreports001'); # not required
my $ri_002 = $query-param('oreports002'); # not required
##
# Variables - Forest Management section
##
my $mgt_01 = $query-param('mgt-01');# not required
my $mgt_02 = $query-param('mgt-02');# not required
##
# Variables - Forest Protection section
##
my $fire_01 = $query-param('fire-01');# not required
my $fire_02 = $query-param('fire-02');# not required
/snip1
snip2
my %divisions = (
Fire = {
contact = '[EMAIL PROTECTED]',
Abbrev = 'Fire',
},
'Resource Info' = {
contact = '[EMAIL PROTECTED]',
Abbrev = 'RI',
},
Management = {
contact = '[EMAIL PROTECTED]',
Abbrev = 'MGT',
}
/snip2
snip3
# return EMAIL ADDRESS for VDOF DIVISIONS
my $contact = $divisions{$query-param('??')}-{contact} || '';
/snip3
-
Do you Yahoo!?
SBC Yahoo! DSL - Now only $29.95 per month!
Re: perl reg exp problem
In article [EMAIL PROTECTED], Janek Schleicher wrote: Robin Garbutt wrote at Mon, 23 Jun 2003 11:40:47 +0100: I have a string that is a random sequence like the following:- ACGTCGTCGTCACACACACGCGTCTCTATACGCG I want to be able to parse the string, picking out any TATA sequences, colour them in red and make a not of where ther lie in the sequence. Is this possible with perl? Yes, but you have to explain in what matter you want to colorize. As output in a terminal window, as html/xml, as a picture, as a word document ... . And for those of us who want to do this as an exercise, what does make a note mean - something like: Line : Char Line 01: 27 or a multi-line char count (27,38,42,157...)? And will there ever be a CGCGTCTCTATATACG... (overlapping) and if so, should one list both starting points (or just non-overlapping matches)? As far as the color, I'm just going to use ANSI terminal codes. -- Kevin Pfeiffer International University Bremen -- To unsubscribe, e-mail: [EMAIL PROTECTED] For additional commands, e-mail: [EMAIL PROTECTED]
Re: There has to be a way to do this
On Jun 23, [EMAIL PROTECTED] said: SRED. SREDNE SEV. SEVERN # Match it at beginning of line $cgname =~ s/^SRED\.(?=[\W\s\-\d]+)/SREDNE:/g ; Three things -- the + modifier on the [...] isn't needed, you don't need to put \s and - in a character class you've already put \W in, and the /g modifier is totally worthless here... there's only ONE beginning of the line! $cgname =~ s/^SRED\.(?=[\W\d])/SREDNE:/; # Match it within the line $cgname =~ s/[\W\s\-]+SRED\.(?=[\W\s\-\d]+)/:SREDNE:/g ; I have a feeling you want to use \b instead of [\W\s-]. It's cleaner and doesn't actually absorb a character. $cgname =~ s/\bSRED\.(?=[\W\d])/:SREDNE:/g; # Match it at end of line $cgname =~ s/[\W\s\-]+SRED\.$/:SREDNE:/g ; Again, use \b, but there's no need for /g here. $cgname =~ s/\bSRED\.$/:SREDNE:/; # Match if it begins ends line $cgname =~ s/^SRED\.$/:SREDNE:/g ; Ah, here's an interesting case. This is actually already handled by my modifications. The problem is that you were using /[\W\s\-]+SRED\.$/ but if the string is SRED., then [\W\s\-] can't match anything. So that's why using a word boundary (\b) is smarter. Also, we can change the look-aheads to go from positive to negative. Instead of saying and I am followed by a non-letter, why not say and I am NOT followed by a letter? $cgname =~ s/^SRED\.(?![A-Za-z])/SREDNE:/; # front $cgname =~ s/\bSRED\.(?![A-Za-z])/:SREDNE:/g; # middle $cgname =~ s/\bSRED\.$/:SREDNE:/; # end If you're worried about hardcoding the letter set (A-Za-z), then you can use this character class instead: [^\W\d_]. It means match anything that's not: a non-word character, a digit, or an underscore. It's a sneaky way of matching anything that would be matched by \w WITHOUT matching \d or _. $cgname =~ s/^SRED\.(?![^\W\d_])/SREDNE:/; # front $cgname =~ s/\bSRED\.(?![^\W\d_])/:SREDNE:/g; # middle $cgname =~ s/\bSRED\.$/:SREDNE:/; # end Right now I'm generating the regexes in a standalone script, then inserting the output code into the subroutine that processes names into a matchable form. What I'd like to be able to do is take a *set* of abbreviation dictionaries, concatenate them together and dynamically generate the regex code in the routine that is going to execute it. So you want to take the dictionary files, and use them to create a function that does all the regexes on its input? -- Jeff japhy Pinyan [EMAIL PROTECTED] http://www.pobox.com/~japhy/ RPI Acacia brother #734 http://www.perlmonks.org/ http://www.cpan.org/ stu what does y/// stand for? tenderpuss why, yansliterate of course. [ I'm looking for programming work. If you like my work, let me know. ] -- To unsubscribe, e-mail: [EMAIL PROTECTED] For additional commands, e-mail: [EMAIL PROTECTED]
Logging to a file or FH?
I've got a script which opens a filehandle to write print statments to a file. But, I'm also running some system commands, and I would also like to send stdout and stderr to that filehandle. I could just echo text to a file, or I could use a filehandle. Which would be better? my $log = /tmp/log.$$; open(LOG, $log); print LOG Commencing maintenance\n; But, here's how I've handled stdout and stderr in a system statement: my $log = /tmp/log.$$; system(path-to-command $log 21); Is there a way to use a filehandle instead? Seems I'd have to take care of block and non-blocking I/O. Methinks it may be simpler just to stick with printing directly to $log and not the FH, LOG. Any advise is welcome! deb -- To unsubscribe, e-mail: [EMAIL PROTECTED] For additional commands, e-mail: [EMAIL PROTECTED]
simple script
Hi, I really green to perl and would like suggestions on creating a script that would allow users to modify a certain file from a web page. This file is a list of customers a particular sales person will cover. So, the web page will allow this sales person to add, delete and update this customer list at his or her discretion. Of course, it would also be nice to assign a password for each sales person. Any suggestions welcome. CONFIDENTIAL: This e-mail, including its contents and attachments, if any, are confidential. If you are not the named recipient please notify the sender and immediately delete it. You may not disseminate, distribute, or forward this e-mail message or disclose its contents to anybody else. Copyright and any other intellectual property rights in its contents are the sole property of eSpeed, Inc. E-mail transmission cannot be guaranteed to be secure or error-free. The sender therefore does not accept liability for any errors or omissions in the contents of this message which arise as a result of e-mail transmission. If verification is required please request a hard-copy version. Although we routinely screen for viruses, addressees should check this e-mail and any attachments for viruses. We make no representation or warranty as to the absence of viruses in this e-mail or any attachments. Please note that to ensure regulatory compliance and for the protection of our customers and business, we may monitor and read e-mails sent to and from our server(s). For further important information, please see http://www.espeed.com/full-disclaimer.html -- To unsubscribe, e-mail: [EMAIL PROTECTED] For additional commands, e-mail: [EMAIL PROTECTED]
RE: simple script
Hi, I really green to perl and would like suggestions on
creating a script that would allow users to modify a certain
file from a web page. This file is a list of customers a
particular sales person will cover. So, the web page will
allow this sales person to add, delete and update this
customer list at his or her discretion. Of course, it would
also be nice to assign a password for each sales person. Any
suggestions welcome.
Well you can use open(), or if the file size isn't extremely huge
The File::Slurp Module is nice,
But you may also want to look into using the DBI Module and storiing your data
In a mysql database (or other db for that matter).
As far as the password goes it depends on how you implememt it,
You could store it along with the data somehow and check it in the script or
Use your webserver's auth methods like htaccess to verify them and then
Only let $ENV{'REMOTE_USER'} manage their own data.
HTH
DMuey
--
To unsubscribe, e-mail: [EMAIL PROTECTED]
For additional commands, e-mail: [EMAIL PROTECTED]
Re: installing modules
On Mon, 23 Jun 2003 03:40:03 +, [EMAIL PROTECTED] (Mario Kulka) wrote: Could anyone give me step by tep instructions on how to install a perl module (MD5) on my host server. How come they don't have it installed? Isn't popular enough? Sorry if I sent the same message for the second time, but the prvious one doesn't came through on my list. There are 2 different MD5 modules available: one has a compiled component, and one is pure perl. You probably want the pure perl version, Digest-Perl-MD5-1.5. On most servers, users don't get access to a c compiler, so you won't be able to compile the preferred and faster MD5 module. So this is what you do. 1. Get the pure perl MD5 module Digest-Perl-MD5-1.5 from http://cpan.org 2. Since it is pure perl, all you should need to do is install it on your local machine, then upload the MD5.pm to your homedir on the server, and put it somewhere like /home/yourname/perl5lib/MD5.pm 3. Then in your .bashrc put a line export PERL5LIB='/home/yourname/perl5lib' Now you can say use MD5.pm at the top of your scripts. There are other ways to do it, but that is the simplest. You can upload the whole tgz package to your homedir, and actually install it in your homedir, you just specify your install path to be /home/yourname as explained in the install docs. -- To unsubscribe, e-mail: [EMAIL PROTECTED] For additional commands, e-mail: [EMAIL PROTECTED]
Logging to a file or FH?
(Apologies if this gets out to you more than once...) I've got a script which opens a filehandle to write print statments to a file. But, I'm also running some system commands, and I would also like to send stdout and stderr to that filehandle. I could just echo text to a file, or I could use a filehandle. Which would be better? my $log = /tmp/log.$$; open(LOG, $log); print LOG Commencing maintenance\n; But, here's how I've handled stdout and stderr in a system statement: my $log = /tmp/log.$$; system(path-to-command $log 21); Is there a way to use a filehandle instead? Seems I'd have to take care of block and non-blocking I/O. Methinks it may be simpler just to stick with printing directly to $log and not the FH, LOG. Any advise is welcome! deb -- o _ _ _ _o /\_ _ \\o (_)\__/o (_) _ \_ _(_) (_)/_\_| \ _|/' \/ (_)(_) (_)(_) (_)(_)' _\o_ http://zapatopi.net/afdb.html -- To unsubscribe, e-mail: [EMAIL PROTECTED] For additional commands, e-mail: [EMAIL PROTECTED]
Re: Process question
Steve Blumenkrantz wrote: Since I didn't get any responses on my last question about process creation and the killing of child processes I thought that maybe I'd switch gears a bit and ask: On Unix does one know how I can get the process id of a process kicked off from within a perl script via the back-tic (`) syntax? Or a module which allows the running of sub programs which also will return the process id of the sub program? perldoc -f open perldoc perlopentut perldoc perlipc perldoc IPC::Open2 perldoc IPC::Open3 John -- use Perl; program fulfillment -- To unsubscribe, e-mail: [EMAIL PROTECTED] For additional commands, e-mail: [EMAIL PROTECTED]
CGI header() and print question
I think this is ok but I want to make sure I'm not missing some obvious thing.
If I do some headers with print and then do a CGI header(), that will work ok right?
IE:
use CGI qw(:standard);
print Set-Cookie: $c\n;
print header();
...
OR
use CGI qw(:standard);
print Set-Cookie: $c\n;
print header('image/gif');
...
Assuming $c is valid cookie dough...
Both ways will set a cookie if the browser allows it and then display the
image or html the rest of the script does, right?
Thanks
Dan
--
To unsubscribe, e-mail: [EMAIL PROTECTED]
For additional commands, e-mail: [EMAIL PROTECTED]
using FIle::Find::name if regex to filter
hi, how can i use a real regex with this: File::Find::name if -x? the filetestops are working fine, but how can i filter things like .gz$? i tried many ways, but all failed. any idea? thanks!! bye andreas -- .::Please visit my homepage::. http://www.math55.de.vu .::A very good JAVA site (worth a visit)::. http://www.javaCore.de .::Please visit the ANTI - TCPA homepage::. http://www.antitcpa.com -- To unsubscribe, e-mail: [EMAIL PROTECTED] For additional commands, e-mail: [EMAIL PROTECTED]
reading file into hash?
I'm still very green to perl, so please forgive this possibly stupid question. I want to setup a configuration file to have a list of alpha codes delimiter and a unique number that will match the code e.g. PACT | 23 PART | 24 etc How is the best way to read such a file into my program (hash ?) so that I can: a.) use the alpha codes to sort out data from another file b.) organize that data to later include that unique number. The end result will be 2 files: 1.) list # (chronological # from the list) | unique code # 2.) list # | data Tim -- Tim McGeary [EMAIL PROTECTED] -- To unsubscribe, e-mail: [EMAIL PROTECTED] For additional commands, e-mail: [EMAIL PROTECTED]
Parsing a file
Hi,
I am new to using Perl to parse a file. What I am trying to do is parse a file that
is made of online orders. I have written some code using for and if statements that
will go through the file line by line and using regex I try to match the information
with the variables so that I can write it to a MySQL database. This works fine as
long as each order has their information where it is supposed to be? Is there an
easier way of doing this? I get half way through processing the file and the arrays
turn to jibberish! I have included my script if it helps any. TIA
Trevor
open(Order, c:\\maverick\\test2.TXT) || die (Cannot find the file test2.TXT);
flock(Order,2);
@miva_orders=Order;
@order_number = ();
@date = ();
@time = ();
@bill_first_name = ();
@bill_last_name = ();
@ship_first_name = ();
@ship_last_name = ();
@emai_address = ();
@phone_number = ();
@phone_number2 = ();
@business_name = ();
@sold_to_street = ();
@bill_to_street = ();
@bill_to_city = ();
@bill_to_state = ();
@bill_to_zip = ();
@ship_to_city = ();
@ship_to_state = ();
@ship_to_zip = ();
@contry = ();
@code = ();
@name = ();
@quantity = ();
@price_each = ();
@shipping_method = ();
@shipping_amount = ();
#shift @miva_orders;
#shift @miva_orders;
print Arrya[0] is: $miva_orders[0]\n;
[EMAIL PROTECTED];
print $length\n;
for ($n=1; $n$length; $n=$n+26) {
print N : $n and value of $miva_orders[$n]\n;
if ($order_number[$n] eq ){
if ($miva_orders[$n+3] =~ /^Order Number\s?:\s?(\d+)/) {
#$order_number = $1;
$order_number[$n] = $1;
#push(@order_number,$order_number);
print Order number is $order_number[$n]\n;
}
}
if ($date[$n] eq $time[$n] eq ) {
if ($miva_orders[$n+4] =~ m/Placed\s+: (\d+\/\d+\/\d+)\s(\d+:\d+:\d+)/) {
$date[$n] = $1;
$time[$n] = $2;
print Date and Time is $1 $2\n;
}
}
if ($bill_first_name[$n] eq $bill_last_name[$n] eq $ship_first_name[$n]
eq $ship_last_name[$n] eq ) {
if($miva_orders[$n+7] =~ /^(\w+)\s(\w+)\s+(\w+)?\s?(\w+)?/) {
$ship_first_name[$n] = $1;
$ship_last_name[$n] = $2;
$bill_first_name[$n] = $3;
$bill_last_name[$n] = $4;
print Ship First name : $ship_first_name[$n]\n;
print Ship Last name : $ship_last_name[$n]\n;
print Bill Last name : $bill_first_name[$n] \n;
print Bill Last name : $bill_last_name[$n] \n;
}
}
if ($email_address[$n] eq ) {
if($miva_orders[$n+8]=~ /([EMAIL PROTECTED])/) {
$email_address[$n] = $1;
print Email address : $email_address[$n]\n;
}
}
if( $phone_number[$n] eq ) {
if($miva_orders[$n+9] =~ /(\d{3}\s?-?\d{3}\s?-?\d{4})/) {
$phone_number[$n]=$1;
print Phone Number $phone_number[$n]\n;
}
}
if( $phone_number2[$n] eq ) {
if($miva_orders[$n+10] =~ / \s+(\d{3}\s?-?\d{3}\s?-?\d{4})? / ) {
$phone_number2[$n]=$1;
print Phone Number2 $phone_number2[$n]\n;
}
}
if($business_name[$n] eq ) {
if ($miva_orders[$n+11] =~ /^\s+(\w+.*)/) {
$business_name[$n] = $1;
$business_name[$n] =~ s/^\s+//;
print Business Name $business_name[$n]\n;
}
}
if ($sold_to_street[$n] eq ) {
if($miva_orders[$n+12] =~ /(.*)\s{2,}/) {
$sold_to_street[$n] = $1;
print Sold To Street :$sold_to_street[$n] \n;
}
}
if ($bill_to_street[$n] eq ) {
if($miva_orders[$n+12] =~ /\s{2,}(.*)/) {
$bill_to_street[$n] = $1;
print Bill To Street :$bill_to_street[$n] \n;
}
}
if ($bill_to_city[$n] eq $bill_to_state[$n] eq $bill_to_zip[$n] eq ) {
if ($miva_orders[$n+13] =~ /(\w+\s?\w+)\s?(.{2})\s?(\d{5}(\W)?(\d{4})?)/) {
$bill_to_city[$n] = $1;
$bill_to_state[$n] = $2;
$bill_to_zip[$n] = $3;
print Bill to City, State and Zip : $bill_to_city[$n]
$bill_to_state[$n] $bill_to_zip[$n] \n;
}
}
if ($ship_to_city[$n] eq $ship_to_state[$n] eq $ship_to_zip[$n] eq ) {
if($miva_orders[$n+13] =~ /\s{2,}(\w+\s?\w+)\s?(\w{2})\s?(\d{5}(\W)?(\d{4})?)/) {
$ship_to_city[$n] = $1;
$ship_to_state[$n] = $2;
$ship_to_zip[$n] = $3;
print Ship TO City, State and Zip : $ship_to_city[$n]
$ship_to_state[$n] $ship_to_zip[$n] \n;
}
}
if ($bill_to_country[$n] eq ) {
if ($miva_orders[$n+14] =~ /(\w+)/) {
$bill_to_country[$n] = $1;
print Country $bill_to_country[$n] \n;
}
}
if ($code[$n] eq ) {
if ($miva_orders[$n+18] =~ /(.{1,15})/) {
$code[$n] = $1;
print Code : $code[$n]\n;
}
}
if ($name[$n] eq ) {
if ($miva_orders[$n+18] =~ /(\s{2,}.{2,40})/) {
$name[$n] = $1;
$name[$n] =~ s/^\s+//;
Passing control to another perl program....
Hi all, I have this scenario: I have a 'main' program that needs to call on progA under condtions A, progB under conditions B, etc. Now, I would like the progA, progB, progC to remain independent of the 'main' program at all times. The only thing I would like to connect them is the paramteres Yes, I know this sounds like the place to use Modules and Packages, however, I don't think a module can have a 'main' program of it's own. The reasons for keeping this independence is to keep the whole system portable and modular. At runtime, the users may choose to leave out progC and hence the program will not even load this 'program' or set of programs Can this be done? I am not sure I am explaining this correctly, so if not, I will try again. Thanks in advance. Hamish -- To unsubscribe, e-mail: [EMAIL PROTECTED] For additional commands, e-mail: [EMAIL PROTECTED]
Re: perl reg exp problem
In article [EMAIL PROTECTED],
Robin Garbutt wrote:
Hi all,
I have a string that is a random sequence like the following:-
ACGTCGTCGTCACACACACGCGTCTCTATACGCG
I want to be able to parse the string, picking out any TATA sequences,
colour them in red and make a not of where ther lie in the sequence.
Is this possible with perl?
And much more (though not necessarily from me ;-))
Here is my version using a terminal window and with output something like
this (hits in red):
Line# : Char# : Matches
1 :11 : AGTGTAGAGTTCTTCATTACGGACGGTCCGACCGCTGGATCTAGAG
1 :44 : AGTGTAGAGTTCTTCATTACGGACGGTCCGACCGCTGGATCTAGAG
5 : 7 : CTGTATTCTTGAAAGTCAGCATCCAGGCCATTATCGAATATCGACT
6 : 3 : TTTCTTGCAAGTTAATGGTAGACCTACAGTTAACTGAGTATCCCAG
Notice I print same-line multiple hits on separate lines. I suppose the
fancier format would be something like:
Line# : Char# : Matches
1 : 11,44 : AGTGTAGAGTTCTTCATTACGGACGGTCCGACCGCTGGATCTAGAG
5 : 7 : CTGTATTCTTGAAAGTCAGCATCCAGGCCATTATCGAATATCGACT
6 : 3 : TTTCTTGCAAGTTAATGGTAGACCTACAGTTAACTGAGTATCCCAG
I used the substr function (then afterwards remembered that index might be
better/easier for this); I also imagine that the slicker way to do this is
probably with regexes (cue, John Krahn one-liner enters from stage
left...). ;-)
-K (as always, advice, criticism welcome)
#!/usr/bin/perl
use warnings;
use strict;
# find_substring
# I have a string that is a random sequence like the following:-
#
# ACGTCGTCGTCACACACACGCGTCTCTATACGCG
#
# I want to be able to parse the string, picking out any TATA sequences,
# colour them in red and make a not of where ther lie in the sequence.
while (@ARGV) {
my $sequence = 'TATA'; #what we are looking for
my $data = shift;
open FH, , $data
or die Couldn't open datafile $data for reading: $!\n;
printf \nLine# : Char# : Matches\n;# print heading
while (FH) {
chomp;
print matches($., $_, $sequence);
}
}
# end main #
# begin sub #
sub matches{
my @matches;
my ($line_nbr, $line, $seq) = @_;
for (0 .. (length($line) - length($seq)) ) {
my $char_position = $_;
my $substring = substr $line, $char_position, length $seq;
if ($substring eq $seq) {
my $hilite_line = hilite($line, $char_position, $seq);
$_++; # add 1 to char position
push @matches, sprintf %5d : %5d : %s\n, $line_nbr, $_,
$hilite_line;
}
}
return @matches;
}
sub hilite {
my $color_on = \e[31;1m;
my $color_off = \e[0m;
my ($line, $char_pos, $seq) = @_;
substr($line, $char_pos, length($seq), $color_on$seq$color_off);
return $line;
}
## end ##
--
Kevin Pfeiffer
International University Bremen
--
To unsubscribe, e-mail: [EMAIL PROTECTED]
For additional commands, e-mail: [EMAIL PROTECTED]
RE: Passing control to another perl program....
Hi all,
Howdy
I have this scenario:
I have a 'main' program that needs to call on progA under
condtions A, progB under conditions B, etc.
Now, I would like the progA, progB, progC to remain
independent of the 'main' program at all times. The only
thing I would like to connect them is the paramteres Yes,
I know this sounds like the place to use Modules and
Packages, however, I don't think a module can have a 'main'
program of it's own. The reasons for keeping this
independence is to keep the whole system portable and
modular. At runtime, the users may choose to leave out progC
and hence the program will not even load this 'program' or
set of programs
Can this be done?
Sure, I think this is what you mean:
In Main prog:
if(...) { print qx(./progA.pl 'joe=mama'); }
elsif(...) { print qx(./progB.pl 'ben=doevr'); }
elsif(...) { print qx(./progC.pl 'foo=bar'); }
HTH
DMuey
I am not sure I am explaining this correctly, so if not, I
will try again.
Thanks in advance.
Hamish
--
To unsubscribe, e-mail: [EMAIL PROTECTED]
For additional commands, e-mail: [EMAIL PROTECTED]
--
To unsubscribe, e-mail: [EMAIL PROTECTED]
For additional commands, e-mail: [EMAIL PROTECTED]
Re: reading file into hash?
This will do ...
alpha_hash is u r hash...
-
my %alpha_hash = ();
open(FH_D,$d_list) || die File opening $d_list\n;
@file_list = FH_D;
foreach $record (@file_list) {
@t_array = split(/\|/, $record);
$alpha_hash{$t_array[0]} = $t_array[1];
}
close(FH_D);
--- Tim McGeary [EMAIL PROTECTED] wrote:
I'm still very green to perl, so please forgive this
possibly stupid
question.
I want to setup a configuration file to have a list
of alpha codes
delimiter and a unique number that will match the
code e.g.
PACT | 23
PART | 24
etc
How is the best way to read such a file into my
program (hash ?) so that
I can:
a.) use the alpha codes to sort out data from
another file
b.) organize that data to later include that unique
number.
The end result will be 2 files:
1.) list # (chronological # from the list) | unique
code #
2.) list # | data
Tim
--
Tim McGeary
[EMAIL PROTECTED]
--
To unsubscribe, e-mail:
[EMAIL PROTECTED]
For additional commands, e-mail:
[EMAIL PROTECTED]
__
Do you Yahoo!?
SBC Yahoo! DSL - Now only $29.95 per month!
http://sbc.yahoo.com
--
To unsubscribe, e-mail: [EMAIL PROTECTED]
For additional commands, e-mail: [EMAIL PROTECTED]
Re: reading file into hash?
This will do ...
alpha_hash is u r hash...
-
my %alpha_hash = ();
open(FH_D,$d_list) || die File opening $d_list\n;
@file_list = FH_D;
foreach $record (@file_list) {
@t_array = split(/\|/, $record);
$alpha_hash{$t_array[0]} = $t_array[1];
}
close(FH_D);
--- Tim McGeary [EMAIL PROTECTED] wrote:
I'm still very green to perl, so please forgive this
possibly stupid
question.
I want to setup a configuration file to have a list
of alpha codes
delimiter and a unique number that will match the
code e.g.
PACT | 23
PART | 24
etc
How is the best way to read such a file into my
program (hash ?) so that
I can:
a.) use the alpha codes to sort out data from
another file
b.) organize that data to later include that unique
number.
The end result will be 2 files:
1.) list # (chronological # from the list) | unique
code #
2.) list # | data
Tim
--
Tim McGeary
[EMAIL PROTECTED]
--
To unsubscribe, e-mail:
[EMAIL PROTECTED]
For additional commands, e-mail:
[EMAIL PROTECTED]
__
Do you Yahoo!?
SBC Yahoo! DSL - Now only $29.95 per month!
http://sbc.yahoo.com
--
To unsubscribe, e-mail: [EMAIL PROTECTED]
For additional commands, e-mail: [EMAIL PROTECTED]
Re: Logging to a file or FH?
Deb wrote: I've got a script which opens a filehandle to write print statments to a file. But, I'm also running some system commands, and I would also like to send stdout and stderr to that filehandle. I could just echo text to a file, or I could use a filehandle. Which would be better? my $log = /tmp/log.$$; open(LOG, $log); print LOG Commencing maintenance\n; But, here's how I've handled stdout and stderr in a system statement: my $log = /tmp/log.$$; system(path-to-command $log 21); Is there a way to use a filehandle instead? Seems I'd have to take care of block and non-blocking I/O. Methinks it may be simpler just to stick with printing directly to $log and not the FH, LOG. You could do something like this: use IPC::Open3; my $log = /tmp/log.$$; open LOG, '', $log or die Cannot open $log: $!; print LOG Commencing maintenance\n; my $pid = open3( 0, 'LOG', 0, 'path-to-command' ); John -- use Perl; program fulfillment -- To unsubscribe, e-mail: [EMAIL PROTECTED] For additional commands, e-mail: [EMAIL PROTECTED]
basic question: handling input to TCP/IP server
Hello all... I've implemented the TCP/IP server at the top of p.441 of The Camel (3rd edition) Chapter 16, and it's working fine. That is, it opens the port I tell it to, and other processes connect to it and happily send it stuff. (This is using IO::Socket::INET). But now I'm a little confused about how to handle I/O over the TCP/IP connection. The first thing I'd like to do is to print incoming data to STDOUT. It seems that I have to manipulate the accept() statement, and I probably have to use the angle operators, but I'm struggling to truly understand what's going on here in order to get the syntax correct. (I figure if I can get a handle on manipulating the input, output will be easy.) I'm continuing to hack at this, but any pointers to (simple!) TCP/IP server behavior to speed me on my way would be welcome. Thanks, -Chris _ This message and any attachments are intended only for the use of the addressee and may contain information that is privileged and confidential. If the reader of the message is not the intended recipient or an authorized representative of the intended recipient, you are hereby notified that any dissemination of this communication is strictly prohibited. If you have received this communication in error, please notify us immediately by e-mail and delete the message and any attachments from your system.
Re: using FIle::Find::name if regex to filter
[EMAIL PROTECTED] wrote: hi, how can i use a real regex with this: File::Find::name if -x? the filetestops are working fine, but how can i filter things like .gz$? i tried many ways, but all failed. any idea? thanks!! File::Find puts the current file name into $_ in the callback sub so if want to see if a file name ends with '.gz' you don't have to use File::Find::name. John -- use Perl; program fulfillment -- To unsubscribe, e-mail: [EMAIL PROTECTED] For additional commands, e-mail: [EMAIL PROTECTED]
Re: reading file into hash?
Tim McGeary wrote: I'm still very green to perl, so please forgive this possibly stupid question. I want to setup a configuration file to have a list of alpha codes delimiter and a unique number that will match the code e.g. PACT | 23 PART | 24 etc How is the best way to read such a file into my program (hash ?) so that I can: a.) use the alpha codes to sort out data from another file b.) organize that data to later include that unique number. The end result will be 2 files: 1.) list # (chronological # from the list) | unique code # 2.) list # | data Perhaps you need one of the config modules from CPAN: http://search.cpan.org/search?query=configmode=module John -- use Perl; program fulfillment -- To unsubscribe, e-mail: [EMAIL PROTECTED] For additional commands, e-mail: [EMAIL PROTECTED]
RE: basic question: handling input to TCP/IP server
Something like this worked for me in the past:
use strict;
use IO::Socket::INET;
my $sock = IO::Socket::INET();
while(1) {
my $output;
my $n = sysread($sock,$output,1000);
last if(!defined($n));
print STDOUT $output;
}
And using syswrite() for writing.
perldoc -f sysread
perldoc -f syswrite
-Sharad
-Original Message-
From: McMahon, Christopher x66156 [mailto:[EMAIL PROTECTED]
Sent: Monday, June 23, 2003 3:06 PM
To: [EMAIL PROTECTED]
Subject: basic question: handling input to TCP/IP server
Hello all...
I've implemented the TCP/IP server at the top of p.441 of The Camel (3rd
edition) Chapter 16, and it's working fine. That is, it opens the port I
tell it to, and other processes connect to it and happily send it stuff.
(This is using IO::Socket::INET).
But now I'm a little confused about how to handle I/O over the TCP/IP
connection. The first thing I'd like to do is to print incoming data to
STDOUT. It seems that I have to manipulate the accept() statement, and I
probably have to use the angle operators, but I'm struggling to truly
understand what's going on here in order to get the syntax correct. (I
figure if I can get a handle on manipulating the input, output will be
easy.)
I'm continuing to hack at this, but any pointers to (simple!) TCP/IP
server behavior to speed me on my way would be welcome.
Thanks,
-Chris
_
This message and any attachments are intended only for the use of the addressee and
may contain information that is privileged and confidential. If the reader of the
message is not the intended recipient or an authorized representative of the
intended recipient, you are hereby notified that any dissemination of this
communication is strictly prohibited. If you have received this communication in
error, please notify us immediately by e-mail and delete the message and any
attachments from your system.
--
To unsubscribe, e-mail: [EMAIL PROTECTED]
For additional commands, e-mail: [EMAIL PROTECTED]
Re: Logging to a file or FH?
Cool. I didn't know about the IPC::Open3 module. Will look at it. Thanks for the pointer! deb At 15:04:25, on 06.23.03: Cracks in my tinfoil beanie allowed John W. Krahn to seep these bits into my brain:, Deb wrote: I've got a script which opens a filehandle to write print statments to a file. But, I'm also running some system commands, and I would also like to send stdout and stderr to that filehandle. I could just echo text to a file, or I could use a filehandle. Which would be better? my $log = /tmp/log.$$; open(LOG, $log); print LOG Commencing maintenance\n; But, here's how I've handled stdout and stderr in a system statement: my $log = /tmp/log.$$; system(path-to-command $log 21); Is there a way to use a filehandle instead? Seems I'd have to take care of block and non-blocking I/O. Methinks it may be simpler just to stick with printing directly to $log and not the FH, LOG. You could do something like this: use IPC::Open3; my $log = /tmp/log.$$; open LOG, '', $log or die Cannot open $log: $!; print LOG Commencing maintenance\n; my $pid = open3( 0, 'LOG', 0, 'path-to-command' ); John -- use Perl; program fulfillment -- To unsubscribe, e-mail: [EMAIL PROTECTED] For additional commands, e-mail: [EMAIL PROTECTED] -- o _ _ _ _o /\_ _ \\o (_)\__/o (_) _ \_ _(_) (_)/_\_| \ _|/' \/ (_)(_) (_)(_) (_)(_)' _\o_ http://zapatopi.net/afdb.html -- To unsubscribe, e-mail: [EMAIL PROTECTED] For additional commands, e-mail: [EMAIL PROTECTED]
Re: reading file into hash?
On Mon, Jun 23, 2003 at 01:39:49PM -0700, Madhu Reddy wrote:
A little unasked-for code review :-)
my %alpha_hash = ();
open(FH_D,$d_list) || die File opening $d_list\n;
^ ^
You don't need to quote the variable.
@file_list = FH_D;
foreach $record (@file_list) {
And in this case it's not necessary to read the file into
a temporary array:
while (FH_D) {
@t_array = split(/\|/, $record);
$alpha_hash{$t_array[0]} = $t_array[1];
If you only need two fields, it's more efficient to assign
split() to a list.
my ($key, $value) = split /\|/;
$alpha_hash{$key} = $value;
The split() operator is clever/lazy enough to notice that you
only need the first two chunks, and it does the least amount
of work necessary to provide them.
(Roughly speaking, it does split /\|/, $_, 3.)
--
Steve
--
To unsubscribe, e-mail: [EMAIL PROTECTED]
For additional commands, e-mail: [EMAIL PROTECTED]
Help needed on XML Files
List, I would like to write a script that would check the correct syntax of an XML file. Need to check if the file is XML compliant. Is there a module that I can use to do this? Thanks!
Re: perl reg exp problem
In article [EMAIL PROTECTED], Janek Schleicher
wrote:
Robin Garbutt wrote at Mon, 23 Jun 2003 11:40:47 +0100:
I have a string that is a random sequence like the following:-
ACGTCGTCGTCACACACACGCGTCTCTATACGCG
I want to be able to parse the string, picking out any TATA sequences,
colour them in red and make a not of where ther lie in the sequence.
Is this possible with perl?
Yes, but you have to explain in what matter you want to colorize.
As output in a terminal window, as html/xml, as a picture, as a word
document ... .
If you would have in a pseudo-xml with the tag red.../red,
you would perhaps do it as:
$string =~ s/(TATA)/red$1/red/g;
Here is my script using the regex substitution:
(I wonder if there is a way to report the starting char position for regex
matches like this?)
#!/usr/bin/perl
use warnings;
use strict;
# find_substring2
# I have a string that is a random sequence like the following:-
#
# ACGTCGTCGTCACACACACGCGTCTCTATACGCG
#
# I want to be able to parse the string, picking out any TATA sequences,
# colour them in red and make a not of where ther lie in the sequence.
while (@ARGV) {
my $sequence = 'TATA'; #what we are looking for
my $data = shift;
open FH, , $data
or die Couldn't open datafile $data for reading: $!\n;
while (FH) {
chomp;
print matches($., $_, $sequence);
}
}
# end main #
# begin sub #
sub matches{
my @matches;
my ($line_nbr, $line, $seq) = @_;
my $start_tag = \e[31;1m;
my $stop_tag = \e[0m;
$line =~ s/($seq)/$start_tag$1$stop_tag/g;
push @matches, sprintf %5d : %s\n, $line_nbr, $line;
return @matches;
}
--
Kevin Pfeiffer
International University Bremen
--
To unsubscribe, e-mail: [EMAIL PROTECTED]
For additional commands, e-mail: [EMAIL PROTECTED]
Re: Parsing a file
Trevor Morrison wrote:
Hi,
Hello,
I am new to using Perl to parse a file. What I am trying to do is
parse a file that is made of online orders. I have written some code
using for and if statements that will go through the file line by line
and using regex I try to match the information with the variables so
that I can write it to a MySQL database. This works fine as long as
each order has their information where it is supposed to be?
Are the records separated by something or are they all 26 lines long?
Is there an easier way of doing this?
Probably, if we could see an example of what the data looks like.
I get half way through processing
the file and the arrays turn to jibberish! I have included my script if
it helps any. TIA
You should enable warnings and strict to let perl help you find
mistakes.
use warnings;
use strict;
open(Order, c:\\maverick\\test2.TXT) || die (Cannot find the file test2.TXT);
You should include the $! variable in you error message so you know why
it failed.
flock(Order,2);
You should use the flock constants from the Fcntl module.
use Fcntl ':flock';
flock Order, LOCK_EX or die Cannot flock c:\\maverick\\test2.TXT: $!;
@miva_orders=Order;
It is not necessary to read the whole file into memory in order to
process the data.
@order_number = ();
@date = ();
@time = ();
@bill_first_name = ();
@bill_last_name = ();
@ship_first_name = ();
@ship_last_name = ();
@emai_address = ();
@phone_number = ();
@phone_number2 = ();
@business_name = ();
@sold_to_street = ();
@bill_to_street = ();
@bill_to_city = ();
@bill_to_state = ();
@bill_to_zip = ();
@ship_to_city = ();
@ship_to_state = ();
@ship_to_zip = ();
@contry = ();
@code = ();
@name = ();
@quantity = ();
@price_each = ();
@shipping_method = ();
@shipping_amount = ();
It might make more sense to use a single data structure instead of
multiple separate variables.
#shift @miva_orders;
#shift @miva_orders;
print Arrya[0] is: $miva_orders[0]\n;
[EMAIL PROTECTED];
print $length\n;
for ($n=1; $n$length; $n=$n+26) {
You don't really need the $length variable.
for ( my $n = 1; $n @miva_orders; $n += 26 ) {
print N : $n and value of $miva_orders[$n]\n;
if ($order_number[$n] eq ){
[snip]
flock(order,8);
close(order);
You don't need to unlock the file as closing it will automatically
unlock it. Also you are trying to unlock and close a different file
handle then the one you opened.
John
--
use Perl;
program
fulfillment
--
To unsubscribe, e-mail: [EMAIL PROTECTED]
For additional commands, e-mail: [EMAIL PROTECTED]
Re: Passing control to another perl program....
On Mon, Jun 23, 2003 at 10:04:22PM +0200 Hamish Whittal wrote:
I have this scenario:
I have a 'main' program that needs to call on progA under condtions A,
progB under conditions B, etc.
Now, I would like the progA, progB, progC to remain independent of the
'main' program at all times. The only thing I would like to connect them
is the paramteres
Yes, I know this sounds like the place to use Modules and Packages,
however, I don't think a module can have a 'main' program of it's own.
The reasons for keeping this independence is to keep the whole system
portable and modular. At runtime, the users may choose to leave out
progC and hence the program will not even load this 'program' or set of
programs
Can this be done?
I am not sure I am explaining this correctly, so if not, I will try
again.
I think you will have to explain a little more. Why is it important that
each of your parts needs to have a 'main' program? From your description
it still sounds as though a module would be a good idea. Take these two
modules:
# modA.pm
package modA;
use strict;
use base qw(Exporter);
@modA::EXPORT = qw(main);
sub main {
my $parms = @_;
...
}
1;
# modB.pm
package modB;
use strict;
use base qw(Exporter);
@modA::EXPORT = qw(main);
sub main {
my $parm = @_;
...
}
1;
And in your main program you use require() to pull in either of the two:
# main.pl
...
if ($conditionA) {
require modA;
modA-import;
main(foo);
}
if ($conditionB) {
require modB;
modB-import;
main(bar);
}
Using require() instead of use() has two implications: The first being
that it happens at run-time. Had you used use(), both modules would have
been loaded. In the above case this would have been a problem because
both modules have and export a main() function.
Secondly, require() wont automatically trigger the exporting of symbols
from a module so you have to do that manually. This is done with
PACKAGE-import. The import() method is inherited by your modules from
the Exporter module. It exports everything that is in @PACKAGE::EXPORT
to the caller (which is main.pl in this case).
Tassilo
--
$_=q#,}])!JAPH!qq(tsuJ[{@tnirp}3..0}_$;//::niam/s~=)]3[))_$-3(rellac(=_$({
pam{rekcahbus})(rekcah{lrePbus})(lreP{rehtonabus})!JAPH!qq(rehtona{tsuJbus#;
$_=reverse,s+(?=sub).+q#q!'qq.\t$.'!#+sexisexiixesixeseg;y~\n~~;eval
--
To unsubscribe, e-mail: [EMAIL PROTECTED]
For additional commands, e-mail: [EMAIL PROTECTED]
Re: Running Perl programs on a machine that does not have Perl installed
I think there is something called perl2exe . Try googling it. On Mon, 23 Jun 2003, Dave Mamanakis wrote: I have a perl program that I need to be able to run on all kinds of machines. However, I cannot install perl on each of these machines. It has to be run locally, not over a network (too many issues with security) How can this be done? I know with several other languages, you can make an EXE or copy 4-6 files to that machine and have your program run. How does Perl deal with this? I am currently using the latest build of Active Perl... Thanks for the help. --DM -- Asif Iqbal http://pgpkeys.mit.edu:11371/pks/lookup?op=getsearch=0x8B686E08 There's no place like 127.0.0.1 -- To unsubscribe, e-mail: [EMAIL PROTECTED] For additional commands, e-mail: [EMAIL PROTECTED]
