Another fun way is to use `reverse' and `numeric/string conversion' as
below.
perl -le 'print 0+reverse int 0+reverse "1.2.3.45"'
45
Best regards,
Todd
--
To unsubscribe, e-mail: beginners-unsubscr...@perl.org
For additional commands, e-mail: beginners-h...@perl.org
http://learn.perl.org/
longest common sub
sequence of give 2 sequences'. Many algorithm books covers it.
-Todd
--
To unsubscribe, e-mail: [EMAIL PROTECTED]
For additional commands, e-mail: [EMAIL PROTECTED]
http://learn.perl.org/
Seems it's related to a more general question stated as `Given 2
sequences, find longest common sub sequence'. Many algorithm books
have materials about this one.
-Todd
--
To unsubscribe, e-mail: [EMAIL PROTECTED]
For additional commands, e-mail: [EMAIL PROTECTED]
http://learn.perl.org/
=~ /\.type=(.+?)(&|$)/;
print "\$&=$&\n";
($r2) = $url =~ /\.type=(.+?)[$&]/;
print "\$r1=$r1\n\$r2=$r2\n"
__DATA__
$&=.type=xmlrpc&
$r1=xmlrpc
$r2=x
-Todd
--
To unsubscribe, e-mail: [EMAIL PROTECTED]
For additional commands, e-mail: [EMAIL PROTECTED]
http://learn.perl.org/
<[EMAIL PROTECTED]> wrote in message
news:[EMAIL PROTECTED]
Just a simple survey. As a perl fan, I'd like know what's make you are so
enthusiastic with perl. As for me, I vote the smart data structure design:)
the CPAN, regular expressions, and autovivification
Todd W.
--
T
> replacement?
Sure. Just run your server in a mod_perl enabled apache:
http://search.cpan.org/~rjray/RPC-XML-0.59/lib/Apache/RPC/Server.pm
Todd W.
--
To unsubscribe, e-mail: [EMAIL PROTECTED]
For additional commands, e-mail: [EMAIL PROTECTED]
<http://learn.perl.org/> <http://learn.perl.org/first-response>
er, using two different pdf libraries
from CPAN.
I was very skeptical. Thought for sure there was no way it would work. I was
wrong. Worked flawlessly on WinXP Home and Win2k Server without a perl
interpreter installled.
Todd W.
--
To unsubscribe, e-mail: [EMAIL PROTECTED]
F
"Mathew Snyder" <[EMAIL PROTECTED]> wrote in message
news:[EMAIL PROTECTED]
>
>
> Todd W wrote:
>> "Mathew Snyder" <[EMAIL PROTECTED]> wrote in message
>> news:[EMAIL PROTECTED]
>>>
>>>
>>>> The most popular web
hx's :)
Geo::Distance
(http://search.cpan.org/~bluefeet/Geo-Distance-0.11/Distance.pm)
It supports MySQL out of the box. Great module.
Todd W.
--
To unsubscribe, e-mail: [EMAIL PROTECTED]
For additional commands, e-mail: [EMAIL PROTECTED]
<http://learn.perl.org/> <http://learn.perl.org/first-response>
;t have an openwave browser, it is not worth supporting). They have
>> an extensive developer resource found at http://developer.openwave.com/.
>> They have free SDKs (if you choose to use them... remember, these are
>> plain ol' web apps), and free simulators (very, very
), and free simulators (very, very useful).
An alternative solution to WAP is MDIP, a java based technology
(http://java.sun.com/products/midp/). This is the technology used in tools
like google maps mobile (http://www.google.com/gmm/index.html). For the sake
of simplification, one could call
is how to return a value from that batch script and
>>>> how to grab it in the perl file?
>>>
>>> What kind of value?
>>
>> It's the value of a variable generated in the batch script.
>
> That still doesn't say much...
Sure it does... t
t;use warnings" can't find warnings.pm)?
That means it is an old perl. Old perls didn't come with the warnings
pragma. You could only turn them off and on globally ($^W, I think).
If this is the case, I would not be suprised by any problem description you
may have.
Todd W.
--
uses an
> escape character ('Henry\'s').
>
> I'd like to be able to parse the following example ...
>
> 'George',123,'Harry\'s',,'Tuesday, Thursday'
> ...
You gave up too quick :-)
Theres also Text::CSV_XS which is configurab
) = $line =~ m|(.+?)\t(.+?)\t(\d+)(.+)$|;
print( join(';', $part, $qty + 0, $descr), "\n" );
}
$ perl tab2csv.pl tab2csv.dat
45600062888;8;FLAT WASHER
228765329;1;GASKET
Enjoy,
Todd W.
--
To unsubscribe, e-mail: [EMAIL PROTECTED]
For additional commands, e-mail: [EMAIL PROTECTED]
<http://learn.perl.org/> <http://learn.perl.org/first-response>
rogram files/Internet Explorer/iexplore.exe';
my $tmp = 'C:/temp/iexml.xml';
getstore( $url . $pms, $tmp );
exec( qq|"$ie" $tmp| );
>
> Plese help me solving this issue, it's very urgent.
>
LOL
Todd W.
--
To unsubscribe, e-mail: [EMAIL PROTECTED]
For additional commands, e-mail: [EMAIL PROTECTED]
<http://learn.perl.org/> <http://learn.perl.org/first-response>
85 Jun 23 12:26 driver.pl
drwxrwxr-x2 trwwwtrwww4096 Jun 23 12:12 shop
$ ls -l shop
total 4
-rw-rw-r-- 1 trwwwtrwww 741 Jun 23 12:04 machines
driver.pl is the program above. The file shop/machines is your csv file.
Todd W.
--
To unsubscribe, e-mail: [EMAIL PROTECTED]
For additional commands, e-mail: [EMAIL PROTECTED]
<http://learn.perl.org/> <http://learn.perl.org/first-response>
says "When very many records are found..." What is the purpose
of your client program loading large recordsets? You should probably be
paging the data somehow.
It definitely works great with 5 million+ records on just okay hardware.
Todd W.
--
To unsubscribe, e-mail: [EM
"Karjala" <[EMAIL PROTECTED]> wrote in message
news:[EMAIL PROTECTED]
> Has anyone used the "Java" module successfully in Perl?
State University of New York at Buffalo has:
http://www.perl.com/pub/a/2004/12/09/epayment.html
Todd W.
--
To unsubscribe,
"Brian" <[EMAIL PROTECTED]> wrote in message
news:[EMAIL PROTECTED]
> Hi all. Can someone suggest a good book for learning mod_perl with
> apache2. After a little reading I get the impression the two
> implementations of mod_perl are very different. In searching amazon
> it seems just about every
"The Ghost" <[EMAIL PROTECTED]> wrote in message
news:[EMAIL PROTECTED]
> I have keys with periods in them:
>
> my %hash;
> $hash{something.withaperiod}="some text";
> my $something='something';
> my $withaperiod='withaperiod';
> print qq{$hash{"$something.$withaperiod"}\n};
>
>
> what will it pri
ell", [qw(Money preserver sunscreen)] );
a generic construct looks like this:
my $array_ref = [ 'foo', 'bar', 'bazz' ];
perldoc perlref
Todd W.
--
To unsubscribe, e-mail: [EMAIL PROTECTED]
For additional commands, e-mail: [EMAIL PROTECTED]
<http://learn.perl.org/> <http://learn.perl.org/first-response>
gt; Is there a cleaner way to find out, if the sub was called as an object
method
> or as a static sub?
>
> thanks,
> Lars
sub get_defaults {
my $self = shift;
if ( ref $self ) {
# object method
} else {
# class method
}
}
Enjoy,
Todd W.
--
To unsubscribe, e-mail: [EMAI
""Robert"" <[EMAIL PROTECTED]> wrote in message
news:[EMAIL PROTECTED]
> I have a log that I am parsing and I can get the login and logout time
> string parsed out. It looks like this:
>
> 13:50:01# this is the when the user logged in
> 14:14:35# this is when the user logged out
>
> I need
.tiff);
foreach my $str (@str) {
my($num) = $str =~ /(\d+)/;
print "$str : $num\n";
}
output:
$ perl extrt.pm
Gambia001.tiff : 001
Gambia0021.tiff : 0021
Gambia031.tiff : 031
Gambia035.tiff : 035
> Thanks!
You bet!
Todd W.
--
To unsubscribe, e-mail: [EMAIL PROTECTED]
For additional commands, e-mail: [EMAIL PROTECTED]
<http://learn.perl.org/> <http://learn.perl.org/first-response>
e?
> >
>
> You can ask this on http://perlmonks.org , which by the way is a great
> place to get coding ideas and ask questions.
>
> Monks there are always looking for testers and/or people to take over
> maintenance of modules.
>
http://apprentice.perl.org/
This is th
[1] <=> $a->[1] }
map [ $_, -M ],
grep -f, # get only plain files
glob("/mnt/qdls/MSDSIN/*");
And you are all done.
Todd W.
--
To unsubscribe, e-mail: [EMAIL PROTECTED]
For additional commands, e-mail: [EMAIL PROTECTED]
<http://learn.perl.org/> <http://learn.perl.org/first-response>
"Wiggins d'Anconia" <[EMAIL PROTECTED]> wrote in message
news:[EMAIL PROTECTED]
> Todd W wrote:
>
> [snip]
>
> > you could do something like this:
> >
> > $ cat TestMod.pm
> > use warnings;
> > use strict;
> >
> > package
) and a package named LWP::Simple can get(). It
should be pretty safe too, because require() will die if it cant find the
module.
I just made this up and I've never done anything like this before ( I
program in mod_perl so I just use() everything I will ever need ), so there
may be some c
s{$a} } keys %ips;
>
For small hashes, I might use:
print RESULT map { "$_:$ips{$_}\n" }
sort { $ips{$b} <=> $ips{$a} } keys %ips;
This only calls print() once.
For big hashes I would probably use Bob S's solution.
Todd W.
--
To unsubscribe, e-mail: [EMAIL PROTECTED]
For additional commands, e-mail: [EMAIL PROTECTED]
<http://learn.perl.org/> <http://learn.perl.org/first-response>
var]\nusage: $0 f|g\n\n");
}
$ perl dispatch.pl
usage: dispatch.pl f|g
$ perl dispatch.pl f
arg1
$ perl dispatch.pl g
arg1
$ perl dispatch.pl b
invalid dispatch code: [b]
usage: dispatch.pl f|g
$ perl dispatch.pl z
invalid dispatch code: [z]
usage: dispatch.pl f|g
Todd W.
--
To unsubscribe, e-mail: [EMAIL PROTECTED]
For additional commands, e-mail: [EMAIL PROTECTED]
<http://learn.perl.org/> <http://learn.perl.org/first-response>
ing wxWindows -- maybe one tabbed pane per server
> process. Each tabbed pain would allow me to view the progress of each
> process.
>
If I had to do this and I had the time I would use Log::Log4perl and format
the log entries in a format that webalizer could parse, possibly modifying
webaliz
"Frank Geueke" <[EMAIL PROTECTED]> wrote in message
news:[EMAIL PROTECTED]
> Hi. I need to grab regex matches from a string in
> perl. The string is an enum data type in Mysql. i.e.
> enum('Berks','Carbon','Lehigh','Montgomery')
> So basically I need a match on alphabetic chars
> between single
rent directory
is set in @INC by default when perl is compiled:
$ perl -e 'print map "dir: [$_]\n", @INC;'
dir: [/usr/local/lib/perl5/5.8.7/i686-linux]
dir: [/usr/local/lib/perl5/5.8.7]
dir: [/usr/local/lib/perl5/site_perl/5.8.7/i686-linux]
dir: [/usr/local/lib/perl5/site_perl
OT OK
> > Running make test
> > Can't test without successful make
> > Running make install
> > make had returned bad status, install seems impossible
> >
>
> Looks like cpan does not support this particular deployment scheme.
> Installed it succesfully
If you know what you are looking for on a particular site. Some helpful
tools can be found cpan.
http://www.cpan.org/
I've found the HTML::TableExtract to be very valuable for retrieving
info. A lot of info on a web page are stored in table format.
Mads N. Vestergaard wrote:
-BEGIN PGP
t;
> Or:
>
> my ( $day ) = localtime =~ /(\S+)/;
> print "Today is $day.\n";
>
Or if you like code that is easier to extend:
use Time::Piece;
my $date = Time::Piece->new;
print( $date->day, "\n" ); # prints "Fri" today
Now pretend the boss
Thanks, for all the replys. Didn't know that you could simply reference
the last element of an array by using [-1]. This seemed like it could
be a one line task maybe two, just don't have command of the language.
Peter Scott wrote:
On Tue, 23 Aug 2005 06:17:11 -0700, I wrote:
$last_wor
I'm trying to retrieve the last word from an HTML table cell stored in
an array value.
All of the words are space delimited.
I've tried using split /\s/, $$row[1] but this doesn't always return the
last
word for me since there could be 2,3, or 4 words.
Could someone point me in the right direc
file? That s/old/newcommand will not put my
quotes in the file??
Thanks,
Todd
"John Doe" <[EMAIL PROTECTED]> wrote in message
news:[EMAIL PROTECTED]
> Todd am Mittwoch, 17. August 2005 16.16:
> > Hi,
> >
> > I am having a problem. I have a
except when newval gets put in the file the quotes are
missing!! I see this:
hba0-SCSI-target-id-7-name=0011884455667733;
When I want to see this in the file:
hba0-SCSI-target-id-7-name="0011884455667733";
Can you help me?
Thanks,
Todd
--
To unsubscribe, e-mail: [EMAIL PR
. ' \\' . "\n";
$usage .= ' --directory=/path/to/zip/files \\' . "\n";
$usage .= ' --loglevel=[DEBUG|INFO|WARN|ERROR|FATAL]' . "\n\n";
die( $usage );
}
Enjoy,
Todd W.
--
To unsubscribe, e-mail: [EMAIL PROTECTED]
For additional commands, e-mail: [EMAIL PROTECTED]
<http://learn.perl.org/> <http://learn.perl.org/first-response>
I've been trying to undersand what mixins are and at the same time figuring
out how to make them easy to use. I just belched out this piece of code, but
I dont know if its doing anything special:
use warnings;
use strict;
package MyMixins;
sub SomeMethod {
my $obj = shift;
print( 'a ', ref
Joining OTN (Oracle Technology Network) is free. It costs an e-mail
address and some contact information. It might generate a salesrep
call.Oracle Does contain a lot documentation.
http://www.oracle.com/technology/index.html
[EMAIL PROTECTED] wrote:
oracle.com
-Original Message-
F
r) which is a
>
> I see no reason why you can't just use a hash lookup, which should be just
> as fast. I cannot tell from your code what property you are storing,
> which is also a red flag. Let's say that it is some interconnection cost:
>
> my %cost;
> [...]
leine you refer to the package name of your
filter or handler, which usually should be a subclass of XML::SAX::Base.
You have to do your own state maintanance in the callbacks, but it is a very
lightweight solution. Ive handled 10's of gigabytes of XML with this method;
splitting files,
"Ramprasad A Padmanabhan" <[EMAIL PROTECTED]> wrote in message
news:[EMAIL PROTECTED]
> Hi all,
>Can anybody send me some examples on pagination with Templates
>
I have also had great sucess with DBIx::Pager. There arent any examples, but
the source is short and v
"Gavin Henry" <[EMAIL PROTECTED]> wrote in message
news:[EMAIL PROTECTED]
> On Saturday 02 Apr 2005 04:29, Johnstone, Colin wrote:
> > Gidday All,
> >
> > I would like to use xml Parser to parse this chunk of xml (below) and
> > return the business unit name and id attributes for each of the eleme
uot;
If you actually want to die, try moving the die outside of the eval:
eval { require "file";} or die "unable to find file $@";
--
Todd de Gruyl
--
To unsubscribe, e-mail: [EMAIL PROTECTED]
For additional commands, e-mail: [EMAIL PROTECTED]
<http://learn.perl.org/> <http://learn.perl.org/first-response>
ogramming Web Services with Perl_ excellently
written and easy to read.
Todd W.
--
To unsubscribe, e-mail: [EMAIL PROTECTED]
For additional commands, e-mail: [EMAIL PROTECTED]
<http://learn.perl.org/> <http://learn.perl.org/first-response>
"Todd W" <[EMAIL PROTECTED]> wrote in message
news:[EMAIL PROTECTED]
>
> "Peter Rabbitson" <[EMAIL PROTECTED]> wrote in message
> news:[EMAIL PROTECTED]
> > On Fri, Mar 11, 2005 at 12:45:10PM -0800, Wagner, David --- Senior
> Programmer
"Peter Rabbitson" <[EMAIL PROTECTED]> wrote in message
news:[EMAIL PROTECTED]
> On Fri, Mar 11, 2005 at 12:45:10PM -0800, Wagner, David --- Senior
Programmer Analyst --- WGO wrote:
> > Peter Rabbitson wrote:
> > > Is there a quick way to initialize a number of variables at once?
> > > Something li
> );
>
or even just:
> my %mails = (
> From=> "$from",
> Subject => "$subject",
Message => join('', ),
> );
Todd W.
--
To unsubscribe, e-mail: [EMAIL PROTECTED]
For additional commands, e-mail: [EMAIL PROTECTED]
<http://learn.perl.org/> <http://learn.perl.org/first-response>
the right get_file_tag for every file, so
> MyProg::AudioFormats::Ogg::get_file_tag is called when an ogg file is
> used. And that is what i don't know how to do =)
>
What you describe is called a "Class Factory" and you may be able to use a
module or two from CPAN, the o
> Todd W <mailto:[EMAIL PROTECTED]> wrote:
> > Its a lot easier than that. If the WSDL file is good. SOAP::Lite
> > comes with a program called stubmaker.pl that takes a wsdl file as an
> > argument and creates a module that you can use(). Then all you do is
> >
"Jason Balicki" <[EMAIL PROTECTED]> wrote in message
news:[EMAIL PROTECTED]
> Todd W <mailto:[EMAIL PROTECTED]> wrote:
> > Its a lot easier than that. If the WSDL file is good. SOAP::Lite
> > comes with a program called stubmaker.pl that takes a wsdl file as
ations .
>
> Is there a way to develop in perl this kind of applications?
>
Well, yes. But if you are going to do this, you are going to have get past
"concept" and roll up your sleeves and dig in to some code. I used
_Programming Web Services with Perl_
Todd W.
--
To unsu
ses NWS web services.
use ndfdXML;
my $xml = ndfdXML::NDFDgenByDay( ...args... );
You wont be able to tell from your source that you are calling network
enabled functions.
It also comes with programs called SOAPsh.pl and XMLRPCsh.pl You give them a
wsdl file or an endpoint and you can ma
keep it in memory?
use DBI;
use Text::CSV;
use LWP::Simple;
$dbh = DBI->connect( ... );
$sth = $dbh->prepare( 'INSERT INTO table VALUES (?, ?, ...)' )
foreach my $line ( split(/\n/, get( $url )) ) {
# split record in to fields... see Text::CSV
$sth->execute( @splitted_stuff );
he
WWW::Mechanize API to set the action with perl code before ->submit()ting
the form.
Either that or write some glue to get WWW::Mechanize to support javascript
;0).
Todd W.
--
To unsubscribe, e-mail: [EMAIL PROTECTED]
For additional commands, e-mail: [EMAIL PROTECTED]
<http://learn.perl.org/> <http://learn.perl.org/first-response>
"Ron Wingfield" <[EMAIL PROTECTED]> wrote in message
news:[EMAIL PROTECTED]
> Always contract for 1099 payment -- Never, never W2!
Can I ask why? I landed some telecommuting work I've been doing for about a
month now and the proprietor wants to move me to a W2...
buffers
my $gotit = "";
for (;;) {
return unless (defined ($gotit = $port->lookfor));
if ($gotit ne "") {
my ($found, $end) = $port->lastlook;
return $gotit.$found;
}
return if ($port->reset_error);
return if (Win32::GetTickCount() > $timeout);
}
}
Todd W.
--
To unsubscribe, e-mail: [EMAIL PROTECTED]
For additional commands, e-mail: [EMAIL PROTECTED]
<http://learn.perl.org/> <http://learn.perl.org/first-response>
st.)
That way you get a conditional check on if there are any rows to return at
all, and if there is, the do { } while ( ... ); will process the first row
fetched in the conditional before processing any more.
Todd W.
--
To unsubscribe, e-mail: [EMAIL PROTECTED]
For additional commands, e-mail: [EMAIL PROTECTED]
<http://learn.perl.org/> <http://learn.perl.org/first-response>
"Scott R. Godin" <[EMAIL PROTECTED]> wrote in message
news:[EMAIL PROTECTED]
> Todd W wrote:
> > "Jason Balicki" <[EMAIL PROTECTED]> wrote in message
> > news:[EMAIL PROTECTED]
> >
> >>Hi,
> >>
> >>
cally prevent its being installed via cpan, and that the author
> would create a custom data set, but leave the link to the census data
> in at leasty two places in the docs.
>
Youre right, it was confusing because of the variance from the standard
install method. Whenever I have trouble in
passed to the db_dir parameter of the
new constructor.
I found the above at:
http://search.cpan.org/src/TJMATHER/Geo-PostalCode-0.06/INSTALL
There is most definitely supposed to be three db files, and ./load.pl
creates them.
Todd W.
--
To unsubscribe, e-mail: [EMAIL PROTECTED]
For a
my $time = Time::Piece->strptime('0501201500','%y%m%d%H%M');
print $time->datetime, "\n";
Ctrl-D
2005-01-20T15:00:00
Install and read the docs for Time::Piece.
Todd W.
--
To unsubscribe, e-mail: [EMAIL PROTECTED]
For additional commands, e-mail: [EMAIL PROTECTED]
<http://learn.perl.org/> <http://learn.perl.org/first-response>
20Return%20of%20th
e%20Jedi?imdbid=tt0086190">
Star Wars: Episode VI - Return of the Jedi
Science Fiction
134
Heres the output:
C:\waveright\home\trwww\misc>perl movies.pl
Name: Star Wars: Episode IV - A New Hope
Info: http://...
Genre: Science Fiction
Retrieving http://ibihost1.com/nycdoh/web/html/rii.pl(200)
http://www.nyc.gov/html/doh/html/rii/index.html>forms
No forms on current page.
http://www.nyc.gov/html/doh/html/rii/index.html>
But you will probably have better luck using WWW::Mechanize.
Todd W.
--
To unsubscribe, e-mai
y $xp = XML::XPath->new( xml => $xml );
my $nodeset = $xp->find( '/rss/channel/item' );
foreach my $node ( $nodeset->get_nodelist ) {
print $xp->findvalue( './title', $node ), "\n";
}
[EMAIL PROTECTED] misc]$ perl parserss.pl
1 ZAR = AED (0.649063)
1
> Ha Ha even better, nice one Bob!
>
> Perl is just way to awesome :)
You can even get rid of the for:
print map "\t$_\n", @ARGV;
print map "$_\n", grep length() <= 3, @ARGV;
Todd W.
--
To unsubscribe, e-mail: [EMAIL PROTECTED]
For additional commands, e-mail: [EMAIL PROTECTED]
<http://learn.perl.org/> <http://learn.perl.org/first-response>
s that someone may veiw
> their empty cart and therefore no cookie will have been created.
>
> Anyway, my question is: how do I test to see if a coockie exists b 4 i try
> to read it ???
>
If ( UNIVERSAL::can( $newcook{'usrID'} => 'value' ) ) {
# ...
}
Todd
ile\n");
$req = HTTP::Request->new( GET => $file );
$cj->add_cookie_header( $req );
$res = $ua->request($req);
$cj->extract_cookies( $res );
#print("cookie headers:\n", $cj->as_string, "\n");
print("response headers:\n", $res->{_headers}->a
ern/Class-Virtual-0.04/
Hopefully this will avoid a few bugs you were potentially about to write.
Todd W.
>
> On Wed, 2004-11-24 at 17:35, Michael Kraus wrote:
> > G'day...
> >
> > If a sublass has overrides a method in a superclass, and the subclasses
> > m
q,r,e): r
zzzr args: data1, data2
[EMAIL PROTECTED] temp]$ perl method.pl
Enter Qualifier: (q,r,e): x
error: "x" cannot be qualified
[EMAIL PROTECTED] temp]$ perl method.pl
Enter Qualifier: (q,r,e): e
zzze args: data1, data2
please read
perldoc perlreftut
and
perldoc perltoot
Enjoy!
Todd W.
http://waveright.homeip.net/
--
To unsubscribe, e-mail: [EMAIL PROTECTED]
For additional commands, e-mail: [EMAIL PROTECTED]
<http://learn.perl.org/> <http://learn.perl.org/first-response>
If your writing something. I think you can output your die statement
into a "log file" using print [logfile] "Whatever message you want\n"
. You can also at certain points in your program output information
on the status of your program. It helps in debugging your program.
If it is a longrunnin
I have no real working knowledge of perl. Teaching myself as I go.
I know what I want to do and I think perl can do most of it, it's
just finding the way.
These scripts are really not module worthy. They are simple scripts,
or run query, output file, read file, retrieve data based on file,
outp
I have serveral perl scripts that I've written seperately. Now I want
to run them sequentially. I don't want to cut and paste them into the
same file to be run. Makes reusablity a pain. Is there a method to do
this? I've tried searching but it appears I'm not using the correct
search words.
I'
I know redhat 9, and I think redhat 8, has its locale set by default to
en_US.UTF-8. I dont know much about locale settings, but somehow this
results is tests obsurely failing. Try setting your LANG variable to en_US:
$ export LANG=en_US
and try again. Another suggestion is to upgrade to Fedora.
Greetings
I am looking for the easiest way to take the Longitude and Latitude of a
location and place a marker on a map.
Can anybody point me in the right direction.
Thank you
Todd Birkenholtz
IM,$$row[0],FIELD_DELIM;
> print outfile $$row[1],FIELD_DELIM,$$row[2],FIELD_DELIM;
> print outfile $$row[5],FIELD_DELIM,$$row[6],FIELD_DELIM;
> print outfile $$row[7],FIELD_DELIM,$$row[8],FIELD_DELIM;
> print outfile "\n";
>
row[1],FIELD_DELIM,$$row[2],FIELD_DELIM;
print outfile $$row[5],FIELD_DELIM,$$row[6],FIELD_DELIM;
print outfile $$row[7],FIELD_DELIM,$$row[8],FIELD_DELIM;
print outfile "\n";
}
if ($$row[0] eq "No sorties
I'm using HTML::TableExtract to pull data from a web page.
the Table depth is always 6,1. It just sometimes is not there when
the page is brought up. How can I tell that the table is missing
using
this procedure. I'm trying to error trap this situation. It causes my
code to hang d
obj cant $method");
}
}
}
output:
1: Hello from ClassA->foo
2: Hello from ClassA->bar
3: ClassA=HASH(0x15d5218) cant baz
4: Hello from ClassB->foo
5: Hello from ClassB->bar
6: ClassB=HASH(0x1a8941c) cant baz
Todd W.
--
To unsubscribe, e-mail: [EMAIL PROTECTED]
For additional commands, e-mail: [EMAIL PROTECTED]
<http://learn.perl.org/> <http://learn.perl.org/first-response>
On 2004-02-26 00:43:21 +, [EMAIL PROTECTED] (Wolf Blaum) said:
As I understand Biology, there is 4 nucleotid acids which gives 4**2
combinaions for dupplets. So you need 8 vars to count the occourence of
all douplets. Worse for triplets. (24)
As I understand genetics, triplets are what matte
Hi all -
Many thanks to those who shared their knowledge. I had a feeling that
there would be an elegant solution to my problem, but I was having no
luck figuring it out.
For reference, where before my code was:
$Pcc++ while $sequence =~ /cc/gi;
..it is now:
$Pcc++ while $sequence =~ /c(?=c)
On 2004-02-25 17:42:46 +, [EMAIL PROTECTED] (Kenton Brede) said:
If you don't get an answer to your question this is probably why -
http://learn.perl.org/beginners-faq#2.2%20%20what%20is%20this%20list%20_not_%20for
Kent
Kent
Kent
Kent -
Thanks for the pointer. I should have read the list
I'm having trouble counting the number of specific substrings within a
string. I'm working on a bioinformatics coursework at the moment, so my
string looks like this:
$sequence = "caggaactttcggaagaccatgta";
I want to count the number of occurrences of each pair of letters, for example:
Num
loathe to make what I've done look reasonable and
> even worse, starting to create forms etc for data edit and data entry
> would make my hair even more grey than it is now..
>
I use MySQLMan, a free web based mysql client:
http://www.gossamer-threads.com/scripts/mysqlman/index.htm
wor
"Rob Dixon" <[EMAIL PROTECTED]> wrote in message
news:[EMAIL PROTECTED]
> Todd W. wrote:
> >
> > "Rob Dixon" <[EMAIL PROTECTED]> wrote in message
> > news:[EMAIL PROTECTED]
> > > Todd wrote:
> > > >
> > > >
"Jason Dusek" <[EMAIL PROTECTED]> wrote in message
news:[EMAIL PROTECTED]
On Monday, November 24, 2003, at 10:56 PM, Andrew Gaffney wrote:
> There is atleast 1 Perl program for downloading Yahoo mail out there.
Okay, but let's say I want to learn how to do it anyway. It seems like
a good prac
"Rob Dixon" <[EMAIL PROTECTED]> wrote in message
news:[EMAIL PROTECTED]
> Todd wrote:
> >
> > Perl is so slick:
> >
> > if ( $self->{code} ) {
> > $string = $self->{code};
> > } else {
> > $self->{class}{fi
"R. Joseph Newton" <[EMAIL PROTECTED]> wrote in message
news:[EMAIL PROTECTED]
> "Todd W." wrote:
>
> > Perl is so slick:
> >
> > if ( $self->{code} ) {
> > $string = $self->{code};
> > } else {
> > $self-&
y another method call placed in a
Template::Toolkit template.
Vive OO.
Todd W.
--
To unsubscribe, e-mail: [EMAIL PROTECTED]
For additional commands, e-mail: [EMAIL PROTECTED]
rmation you need to know. You can then make your
debugging subs generic.
For higher level stuff, check out Carp::Clan from CPAN. It does stack
traces.
Todd W.
--
To unsubscribe, e-mail: [EMAIL PROTECTED]
For additional commands, e-mail: [EMAIL PROTECTED]
"Casey West" <[EMAIL PROTECTED]> wrote in message
news:[EMAIL PROTECTED]
>
> Casey West
>
> --
> f u cn rd ths, u cn gt a gd jb n cmptr prgmmng.
>
Where? =0)
Todd W.
--
To unsubscribe, e-mail: [EMAIL PROTECTED]
For additional commands, e-mail: [EMAIL PROTECTED]
():
with an array slice and map():
[EMAIL PROTECTED] trwww]$ perl
@array = ( 1 .. 5 );
@array = @array[ map abs(), -$#array .. 0 ];
print( join("\n", @array), "\n" );
Ctrl-D
5
4
3
2
1
see
http://groups.google.com/groups?threadm=20030827112457.74911.qmail%40onion.perl.org
Tod
"R. Joseph Newton" <[EMAIL PROTECTED]> wrote in message
news:[EMAIL PROTECTED]
> Todd Wade wrote:
>
> > I'm willing to pester the site owners to let you do the site. But it
will
> > probably take more than just you and I. The lack of responses to your OP
&g
hat you
can
> do it with less typing:
>
> $file = "/location/of/header.incl";
> open (FH, "$file") or die "Cannot open file $file $!";
> print while();
> close(FH);
> --
or simply:
print ;
print takes a list of arguments:
[EMAIL PROTECTED] trwww]$ perl
use warnings;
use strict;
print ;
__DATA__
one
two
three
Ctrl-D
one
two
three
Todd W.
--
To unsubscribe, e-mail: [EMAIL PROTECTED]
For additional commands, e-mail: [EMAIL PROTECTED]
onth for articles. Ive been thinking
about it lately anyway. Since you have a beautiful site put together, they
would go well together. Perhaps your site can become the perl.beginners.*
home page?
Casey, any thoughts?
Todd W.
--
To unsubscribe, e-mail: [EMAIL PROTECTED]
For additional commands, e-mail: [EMAIL PROTECTED]
1 - 100 of 271 matches
Mail list logo
