[ccp4bb] PhD studentship (UK): Dynamic Structural Biology – from nanocrystals to time-resolution (CASE project)

[Patrick Shaw Stewart]

The South Coast Biosciences (SoCoBio) Doctoral Training Partnership is
offering a PhD student a unique opportunity to undertake research and
training in structural biology and microfluidics.

https://research.kent.ac.uk/socobio/dynamic-structural-biology-from-nanocrystals-to-time-resolution/



Primary supervisor:
Dr Ivo Tews, Biological Sciences, University of Southampton
Co-supervisors:
Dr S. Mark Roe, School of Life Sciences, University of Sussex
Dr Jonathan West, Medicine, University of Southampton

Project Summary

Significant technical developments are revolutionising structural biology
and change the way in which a crystallographic experiment is approached.
Noise-free detection, advances in synchrotron X-ray sources and
availability of pulsed X-ray free electron laser sources (XFEL) now firmly
establish serial crystallography. Thousands of nanocrystals each contribute
a single x-ray exposure. The method is able to add dynamic information on
structural changes or transitions, observed over time. Enzymes or higher
order molecular complexes are prominent targets.

Micro- or nanocrystalline samples are required to unlock this capability.
We developed a workflow for optimising crystal growth for size and
homogeneity [1] and demonstrated serial data collection with a fixed target
delivery approach using a nano-fabricated chip-based support system,
capable of delivering one structure per hour either at the Diamond Light
Source (I24 microfocus beamline) or at an XFEL source (SACLA, Japan).

The PhD will optimise nano-crystallisation to study two high value targets.
Micro-seeding approaches are developed in collaboration with the highly
innovative CASE partner Douglas Instruments [2]. Novel high-throughput
approaches in nano-crystallisation using microfluidic platforms are
developed at Southampton [3].

*Target 1: Hsp90, a chaperone implicated in maintaining many cancers [4].
Very small crystals of Hsp90 in complex with co-chaperones and client
proteins can be formed (specifically the Hsp90/cdc37/Braf complex). The
size of these crystals is such that they are not suitable for standard data
collection, and serial nano-crystallography will enable structure
determination to understand how Hsp90 aids in protein maturation.*
*Target 2: Pdx1, an enzyme that synthesises vitamin B6 from two
carbohydrates and ammonia. Crystallisation of several key intermediates is
established, and the complex cascade of reactions has been described by us
[5]. Serial data collection to map the highly dynamic changes in the enzyme
is now required, investigating sugar ring opening, ammonia transfer, and
migration of intermediates.*


-- 
 patr...@douglas.co.ukDouglas Instruments Ltd.
 Douglas House, East Garston, Hungerford, Berkshire, RG17 7HD, UK
 Directors: Patrick Shaw Stewart, Peter Baldock, Stefan Kolek

 http://www.douglas.co.uk
 Tel: 44 (0) 148-864-9090US toll-free 1-877-225-2034
 Regd. England 2177994, VAT Reg. GB 480 7371 36



To unsubscribe from the CCP4BB list, click the following link:
https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB&A=1

Re: [ccp4bb] CCP4BB vs COVID19

[Patrick Shaw Stewart]

tly
> linked this mutation is to a silent mutation on the other end of the
> genome: the "L" type has a faster codon for Ser in ORF1.  Such tight
> coupling (r^2=0.945) means there must be significant selective pressure
> preventing both of these mutations occurring in the same virus at the
> same time.  That, I believe, is interesting.  Espeically since they are
> so far apart I expect this selective pressure might work in trans: as in
> a super-infection. That is, the S and L genome types may interfere with
> each other.
>
> The authors fall short of claiming evidence of interference upon
> super-infection, and indeed they have already been criticised for
> calling "L" the "aggressive" type.  But it is still interesting and
> points a finger at ORF8.
>
> ORF8 has only one homolog in the PDB: 5o32 with 25% identity over a
> stretch of 60 residues.  This homologous region contains the S84L site
> (Val I544 in 5o32).  I had a quick look and appears to be a
> cavity-filling mutation to me.  Not very big, but maybe something could
> fit in there.  To be sure we'd need a structure of ORF8.
>
> Good luck to you all, and stay healthy.
>
> -James Holton
> MAD Scientist
>
> 
>
> To unsubscribe from the CCP4BB list, click the following link:
> https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB&A=1
>


-- 
 patr...@douglas.co.ukDouglas Instruments Ltd.
 Douglas House, East Garston, Hungerford, Berkshire, RG17 7HD, UK
 Directors: Patrick Shaw Stewart, Peter Baldock, Stefan Kolek

 http://www.douglas.co.uk
 Tel: 44 (0) 148-864-9090US toll-free 1-877-225-2034
 Regd. England 2177994, VAT Reg. GB 480 7371 36



To unsubscribe from the CCP4BB list, click the following link:
https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB&A=1

Re: [ccp4bb] CCP4BB vs COVID19

[Patrick Shaw Stewart]

James, there are lots of quite simple experiments that would be could be
done, but I can't get anyone to think seriously about the problem - let
alone do the experiments.

The attitude seems to be, "it can't be as simple as you suggest - someone
would have noticed it".

* Has anyone measured virulence vs temperature in cell culture?*


This isn't what you've got in mind, but yes, it was noticed that the
viruses that establish persistent infections of cell cultures (and they
have to be less aggressive to do that) often *spontaneously* become
temperature sensitive.  And, conversely, temperature-sensitive viruses that
are grown at low temp but in conditions where they can multiply fast, often
spontaneously lose their initial temperature-sensitivity.  Refs in my
paper.  Thse are all experiments that were done "by accident".

In influenza a temperature-driven switch has been seen, switching between
translation (high temp) and replication (low temp).  See the link below for
figures - described in words in my paper, below.

Best wishes

Patrick


Figures showing the "switch":
https://www.douglas.co.uk/f_ftp1/Seminar_by_Patrick_Shaw_Stewart_-_a_few_slides_for_Bill.pdf
Paper: http://douglas.co.uk/f_ftp1/ShawStewart_final_1-s2.pdf
Easy read part 1, about seasonality: https://oldwivesandvirologists.blog/
Easy read part 2 about Covid:
https://oldwivesandvirologists.blog/Covid-19-and-the-trade-off-model-of-selection/


_


>From my paper:


*The temperature sensitivity of viral transcription*

Most laboratory respiratory viruses are propagated at 37 C, which may
result in the rapid
loss of ts characters, especially since viruses mutate very rapidly when
they are introduced
to new hosts. If, however, temperature sensitivity is a common feature of
wild respiratory
viruses, we might expect to see remnants of temperature sensitivity in the
biochemistry
of laboratory strains. It turns out that such remnants are quite common.
For several
decades virologists have found that maximum RNA transcription in influenza
viruses occurs
below normal body temperature. In 1977, Plotch and Krug [61] reported that
the greatest
activity of the RNA polymerase of WSN virus was at 30–32 C. This is similar
to the optimum
temperature of the polymerase of influenza C, which is 33 C [62,63].
Ulmanen et al. [64]
found that the rate of transcription by detergent-treated WSN viruses
(influenza A) was about
10 times greater at 33 C than at 39.5 C, and also that the binding of a
cleaved primer cap
(the ‘‘A13 fragment”) to the viral cores was ‘‘unexpectedly” much weaker at
39.5 C than at
33 C. Scholtissek and Rott [65] showed that the optimum for the polymerase
of the
Rostock strain of fowl plague virus was 36 C, five degrees below chickens’
normal body
temperature (41 C). At least two reports show that temperature affects the
balance between
transcription and viral replication. Kashiwagi et al. looked at the effect
of temperature on
RNA production for five varied influenza A strains [66]. For all strains,
vRNA unexpectedly
decreased when the temperature was increased from 37 C to 42 C. The PA
subunit of the
viral polymerase caused this thermal sensitivity. In another interesting
study, Dalton et al.
showed that the production of mRNA by the PR8 influenza strain is favored
at a higher
temperature (41 C), with very little vRNA being produced at that
temperature [67]. A plasmid-
based recombinant system showed that as the incubation temperature
increased from 31 C
to 39 C the amount of replicative RNA products (c- and vRNA) decreased and
a greater
accumulation of mRNA was observed. The cRNA that is used as a template to
make the
vRNA formed a complex with the polymerase that was particularly
heat-labile, showing rapid
dissociation even at 37 C. The authors suggested that the ‘‘switch” that
regulates the
transition from transcription to replication is dependent on temperature,
but made no
comments about how shifts in the host’s body or respiratory tract
temperature may influence
this transition.





On Sun, Mar 22, 2020 at 3:38 PM James Holton  wrote:

> Thank you Patrick,
>
> RNA structure is still structural biology, so I think relevant here.  It
> seems to me that RNA as a thermometer would be an easy hypothesis to test?
> Has anyone measured virulence vs temperature in cell culture?
>
> The 3D structure of the genome is no doublt important.  I wouldn't want to
> try crystallizing the whole thing, but I wonder if this might be an
> excellent target for cryoEM?  A challenge for that "we can classify our way
> out of anything" philosophy?  And the result would most certainly be
> interesting.
>
> -James Holton
> MAD Scientist
>
> On 3/21/2020 8:41 AM, Patrick Shaw Stewart wrote:
>
>
> James, this isn't conventional structural biology, but may be of interest,
> and I haven't been abl

Re: [ccp4bb] SARS-CoV-2 test on a smartphone

[Patrick Shaw Stewart]

ne at scale.  You only need ~2 fmol of each oligo, 10 umol
>> synthesis is about $1k, so I estimate about $1 per test using 1000
>> different oligos. This price point will be important if we want to make
>> billions of tests to be used all over the world.  In some countries $1
>> is a lot.
>>
>> The detection strategy I am focusing on is FRET.  That is, oligos would
>> be made in pairs, recognizing abutting sections of the viral genome.
>> Like this:
>> 5'  atttcgctgatc-ATTO465 ATTO550-cattatcagacaagt  3'
>> which would anneal to one of the current CDC test primer sites:
>> 3' taaagcgactaggtaatagtctgttca 5'
>> The result in this case would be maximum FRET efficiency only when both
>> oligos are bound.  From what I can tell, the ATTO465 dye is one that is
>> most sensitive to the blue peak in the iPhone "flash" LED spectrum, and
>> ATTO550 should give maximum contrast between the green and red channels
>> of the iPhone camera. That way you would discriminate presence/absence
>> by color.  Red=virus, Green=clear. That is just an example. Other tags
>> might work better.  Maybe quantum dots.
>>
>> Additional aparatus would be required, of course, and at least a few
>> reagents to crack open the capsids (DTT and guanidine).  These could be
>> shipped dry in foil packs.  The end user would simply tear it open and
>> spit into it.  If the intersted party is performing the test on
>> themselves, then there is no biohazard.  Heating to 70C (cup of coffee?)
>> should kill the virus, and these reagents will make it even more dead.
>> I'm not sure how much purification would be required.  The assay volume
>> in the Nature paper above was 1 mL.  I expect signal would be improved
>> by concentrating the RNA as close to the camera as possible.  It may
>> even be possible to absorb the nucleic acid directly onto the cover
>> glass of the smartphone camera.  RNA sticks to glass at pH < 7.5, and
>> not much else does.  Quiagen EZ1 nucleic acid purificaiton columns are
>> nothing but silica glass beads after all.
>>
>> There are still details to work out, but I am intruiged by the fact that
>> this seems physically possible and the potential of being very cheap,
>> rugged, portable and scaled up rapidly.  It would be nice to be able to
>> leverage a device that is in already in the hand of half the people on
>> the planet.
>>
>> Comments? Insights?
>>
>> -James Holton
>> MAD Scientist
>>
>> 
>>
>> To unsubscribe from the CCP4BB list, click the following link:
>> https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB&A=1
>>
>>
>> --
>>
>> To unsubscribe from the CCP4BB list, click the following link:
>> https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB&A=1
>>
>
> --
>
> To unsubscribe from the CCP4BB list, click the following link:
> https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB&A=1
>
>
>
> --
>
> To unsubscribe from the CCP4BB list, click the following link:
> https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB&A=1
>
>
>
> --
>
> To unsubscribe from the CCP4BB list, click the following link:
> https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB&A=1
>


-- 
 patr...@douglas.co.ukDouglas Instruments Ltd.
 Douglas House, East Garston, Hungerford, Berkshire, RG17 7HD, UK
 Directors: Patrick Shaw Stewart, Peter Baldock, Stefan Kolek

 http://www.douglas.co.uk
 Tel: 44 (0) 148-864-9090US toll-free 1-877-225-2034
 Regd. England 2177994, VAT Reg. GB 480 7371 36



To unsubscribe from the CCP4BB list, click the following link:
https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB&A=1

Re: [ccp4bb] AW: [ccp4bb] External: Re: [ccp4bb] AlphaFold: more thinking and less pipetting (?)

[Patrick Shaw Stewart]

 I offered my baby to the computing Gods. However we only
> provided the sequence to CASP, no info regarding any ligand or lipid.
> >
> >
> >
> > Less than a month after, the CASP team contacted us and send us the best
> model.  In fact it was 2 half models as the transporter is a pseudo dimer,
> with the N-lobe and C-lobe moving relative to each other during transport
> cycle, thus divided as two domains in CASP.
> >
> >
> >
> > The results were breathtaking. 0.7 And RSMD on one half, 0.6 on the
> other. And yes, group 427 was the superpower (did not know at the time that
> it was AlphaFold).
> >
> >
> >
> > We had long discussions with the CASP team, as -for us- this almost
> exact modelling was dream-like (or science fiction) and -at some point- we
> were even suspecting fraud, as our coordinates had travelled over the
> internet a few times around when interacting with colleagues.  The
> organisers reassured us that we were not the only target that had been
> “nailed” so no reason to suspect any wrongdoing.
> >
> >
> >
> > To this day I am still baffled and I would be happy to hear from the
> community, maybe from some of the CASP participants.
> >
> >
> >
> > The target is T024, the “perfect" models are domain-split version
> (T024-D1 and T024-D2), as AlphaFold2 did not perform so well on the
> complete assembly.
> >
> > Deposited PDB is 6T1Z
> >
> >
> >
> > Cedric
> >
> >
> >
> > PS: I should also note that many other groups performed very well, much
> better than I would have dreamed, including on the full protein but just
> not as crazy-good.
> >
> > —
> >
> > Prof. Cedric Govaerts, Ph.D.
> > Universite Libre de Bruxelles
> > Campus Plaine. Phone :+32 2 650 53 77
> > Building BC, Room 1C4 203
> > Boulevard du Triomphe, Acces 2
> > 1050 Brussels
> > Belgium
> > http://govaertslab.ulb.ac.be/
> >
> >
> >
> >
> >
> > To unsubscribe from the CCP4BB list, click the following link:
> > https://www.jiscmail.ac.uk/cgi-bin/WA-JISC.exe?SUBED1=CCP4BB&A=1
> >
> >
> >
> >
> >
> > To unsubscribe from the CCP4BB list, click the following link:
> > https://www.jiscmail.ac.uk/cgi-bin/WA-JISC.exe?SUBED1=CCP4BB&A=1
> >
> >
> > To unsubscribe from the CCP4BB list, click the following link:
> > https://www.jiscmail.ac.uk/cgi-bin/WA-JISC.exe?SUBED1=CCP4BB&A=1
> >
>
> 
>
> To unsubscribe from the CCP4BB list, click the following link:
> https://www.jiscmail.ac.uk/cgi-bin/WA-JISC.exe?SUBED1=CCP4BB&A=1
>
> This message was issued to members of www.jiscmail.ac.uk/CCP4BB, a
> mailing list hosted by www.jiscmail.ac.uk, terms & conditions are
> available at https://www.jiscmail.ac.uk/policyandsecurity/
>


-- 
 patr...@douglas.co.ukDouglas Instruments Ltd.
 Douglas House, East Garston, Hungerford, Berkshire, RG17 7HD, UK
 Directors: Patrick Shaw Stewart, Peter Baldock, Stefan Kolek

 http://www.douglas.co.uk
 Tel: 44 (0) 148-864-9090US toll-free 1-877-225-2034
 Regd. England 2177994, VAT Reg. GB 480 7371 36



To unsubscribe from the CCP4BB list, click the following link:
https://www.jiscmail.ac.uk/cgi-bin/WA-JISC.exe?SUBED1=CCP4BB&A=1

This message was issued to members of www.jiscmail.ac.uk/CCP4BB, a mailing list 
hosted by www.jiscmail.ac.uk, terms & conditions are available at 
https://www.jiscmail.ac.uk/policyandsecurity/

Re: [ccp4bb] Micro/Macro crystal seeding experience

[Patrick Shaw Stewart]

Hi Rafael

Just to amplify Matthew and David's point about random microseed matrix
screening -


1.  The idea is you add seeds to RANDOM SCREENS - not everyone understands
this!  People find it very hard to "let go" of the first conditions they
see that give them crystals.

2.  I now have the opposite point of view: if I have a choice between
seeding and non-seeding conditions I always try to work with the seeding
ones.  The reason is, you have far more *control*, because you can dilute
the seed stock and "dial up" the number of crystals that you want per drop.

3.  Try cross-seeding with crystals of homologous proteins, mutants etc,
even crystals with 20% sequence identity can work.

4.  Seeds are not all alike - sometimes seeds with a particular unit cell
work but other seeds (different unit cell) don't.  See ref**

5.  Just throw seeds in with a new project - at worst you're running
another screening experiment.


** Acta Cryst. <https://journals.iucr.org/f> (2014). F*70*
<https://journals.iucr.org/f/contents/backissues.html>, 1107-1115, Obmolova
et al.  Crystals of Fab 3-53/L6, grown by self-seeding, diffracted to 2.8Å
(Figure 4b).  However crystals of the same protein grown by cross-seeding
(with crystals of a homologous Fab) looked completely different and
diffracted to 2.3Å  (figure 4c).

https://scripts.iucr.org/cgi-bin/paper?nj5193 (open access).

Your project shouts "seed me".

Hope it works

Patrick



On Thu, Dec 17, 2020 at 10:27 PM Whitley, Matthew J  wrote:

> I want to second the recommendation to try microseed matrix screening.  I
> recently had a case of a protein that did not yield any crystals after
> trying more than 500 conditions.  Of those 500, one single condition gave
> to me what appeared to be crystalline material, but not distinct single
> crystals.  I harvested that well, crushed up the material as best I could
> to make a seed stock, and then used the seed stock with the first 48
> conditions of I think the JCSG+ screen.  Came back the next day, checked
> the trays under the microscope, and was astonished to find at least 10
> wells that had gorgeous crystals in them.  I harvested a few crystals from
> different wells, shot them at the Advanced Photon Source, and nearly
> fainted when diffraction to almost 1 Å popped up on the monitor for
> almost all of them.  So, you could say I’m a believer in random microseed
> matrix screening now …
>
>
>
> Good luck.
>
>
>
> Matthew
>
>
>
> ---
>
> Matthew J. Whitley, Ph.D.
>
> Research Instructor
>
> Department of Pharmacology & Chemical Biology
>
> University of Pittsburgh School of Medicine
>
>
> --
>
> Date:Thu, 17 Dec 2020 21:54:15 +
> From:David Briggs 
> Subject: Re: Micro/Macro crystal seeding experience
>
> Hi Rafael, there are many potential answers to questions such as this.
>
> Here are the first few that spring to mind:
>
>
>   1.  Did you test room temperature diffraction? Is it your
> cryo-protectant that is causing problems.
>   2.  What is your cryo-cooling protocol? Do you just dunk the crystals
> straight in to crystallisation liquor + 30% glycerol, or do you slowly step
> up the cryo-protectant concentration?
>   3.  Additive screens are worth a try.
>   4.  Modify the construct (trim termini, tags, or disordered loop
> regions).
>   5.  Microseed matrix screening to look for alternative conditions. (
> https://nam12.safelinks.protection.outlook.com/?url=https%3A%2F%2Fwww.douglas.co.uk%2Fmms.htm&data=04%7C01%7Cmjw100%40PITT.EDU%7C5f603236dfef49d09b5308d8a2d6b188%7C9ef9f489e0a04eeb87cc3a526112fd0d%7C1%7C0%7C637438390278906705%7CUnknown%7CTWFpbGZsb3d8eyJWIjoiMC4wLjAwMDAiLCJQIjoiV2luMzIiLCJBTiI6Ik1haWwiLCJXVCI6Mn0%3D%7C1000&sdata=JJ1pHkScwTx8%2FJCZPXY9DYlIzosr9j67alrdsXIseCY%3D&reserved=0
> )
>
> Good luck!
>
> Dave
>
> --
> Dr David C. Briggs
> Senior Laboratory Research Scientist
> Signalling and Structural Biology Lab
> The Francis Crick Institute
> London, UK
> ==
> about.me/david_briggs
>
>
> ----------
>
> To unsubscribe from the CCP4BB list, click the following link:
> https://www.jiscmail.ac.uk/cgi-bin/WA-JISC.exe?SUBED1=CCP4BB&A=1
>


-- 
 patr...@douglas.co.ukDouglas Instruments Ltd.
 Douglas House, East Garston, Hungerford, Berkshire, RG17 7HD, UK
 Directors: Patrick Shaw Stewart, Peter Baldock, Stefan Kolek

 http://www.douglas.co.uk
 Tel: 44 (0) 148-864-9090US toll-free 1-877-225-2034
 Regd. England 2177994, VAT Reg. GB 480 7371 36



To unsubscribe from the CCP4BB list, click the following link:
https://www.jiscmail.ac.uk/cgi-bin/WA-JISC.exe?SUBED1=CCP4BB&A=1

This message was issued to members of www.jiscmail.ac.uk/CCP4BB, a mailing list 
hosted by www.jiscmail.ac.uk, terms & conditions are available at 
https://www.jiscmail.ac.uk/policyandsecurity/

Re: [ccp4bb] Crystals with Organic solvents

[Patrick Shaw Stewart]

Hi Eswar

Firstly, I would certainly try crystal seeding into random screens if
you haven't already tried it.  Refs below.

Secondly, it's very convenient to grow the crystals under oil, and to
soak the organic solvents into the drops, through the oil.  This makes
it much easier to harvest the crystals because the oil becomes
saturated with the solvent and stops it from evaporating when you pick
up the crystals. This approach can be used at the screening stage too.

See Mortuza, et al. High-resolution structure of a retroviral capsid
hexameric amino-terminal domain.  Nature 431 (2004), pp 481-485.  Also
see http://www.douglas.co.uk/winner1.htm

Good luck

Patrick



Allan D’Arcy, Frederic Villarda, May Marsh.  'An automated microseed
matrix-screening method for protein crystallization'.  Acta
Crystallographica section D63 (2007) 550–554.  On-line at
http://scripts.iucr.org/cgi-bin/paper?S0907444907007652

A. G. Villaseñor, A. Wong, A. Shao, A. Garg, A. Kuglstatter and S. F.
Harris. 'Acoustic matrix microseeding: improving protein crystal
growth with minimal chemical bias.' Acta Crystallographica Section D66
(2010) 568-576. On-line at
http://scripts.iucr.org/cgi-bin/paper?S0907444910005512

Galina Obmolova,* Thomas J. Malia, Alexey Teplyakov, Raymond Sweet and
Gary L. Gilliland. 'Promoting crystallization of antibody–antigen
complexes via microseed matrix screening.' Acta Crystallographica
Section D66 (2010) 927–933.  Open-access at
http://journals.iucr.org/d/issues/2010/08/00/bw5361/bw5361.pdf

Patrick D. Shaw Stewart, Stefan A. Kolek, Richard A. Briggs, Naomi E.
Chayen and Peter F.M. Baldock. 'Getting the most out of the random
microseed matrix-screening method in protein crystallization'.  Cryst.
Growth Des., 2011, 11 (8), pp 3432–3441. On-line at
http://pubs.acs.org/doi/abs/10.1021/cg2001442

See also http://www.douglas.co.uk/mms.htm


On Fri, Aug 26, 2011 at 11:55 AM, eswar reddy  wrote:
>
> Dear All
>                     I was working on a Human protein and expression and 
> solubility is good in E.coli  and purification is One step (His-Tag), and i 
> need to cleave the Histag before screens, if not 
> the protein will precipitated and Aggregated, but after trying for 1.2 years 
> i have crystals and they are with Organic solvents, (10 conditions), these 
> crystals are inter grown like broccoli  shaped  and i tried seeding, but it 
> is not successful, and even i tried  with additive screen but the result is 
> the same  is there is any idea to increase the size and shape of 
> my protein crystals.
> Any suggestions will be helpful for me
> Thanks in Advance
>
>



--
 patr...@douglas.co.uk    Douglas Instruments Ltd.
 Douglas House, East Garston, Hungerford, Berkshire, RG17 7HD, UK
 Directors: Peter Baldock, Patrick Shaw Stewart

 http://www.douglas.co.uk
 Tel: 44 (0) 148-864-9090    US toll-free 1-877-225-2034
 Regd. England 2177994, VAT Reg. GB 480 7371 36

Re: [ccp4bb] UV imaging of crystals

[Patrick Shaw Stewart]

st you need a very good light source, optics
>> made of quartz and calcium fluoride that let almost all the UV light
>> through, highly discriminating filters and a sensitive detector.
>> >
>> > V. Nagarajan
>> > JANSi
>> > http://janscientific.com
>> >
>> > On Thu, Sep 15, 2011 at 7:07 PM, Edward A. Berry 
>> wrote:
>> > A "real" UV microscope requires quartz optics, right?
>> > Probably conventional microscopes use glass.
>> > And you can't see 280 nm (and its not good for your eyes)
>> > so you need some kind of phosphor screen to view the image?
>> >
>> >
>> > Bosch, Juergen wrote:
>> > I'm replying here to myself :-)
>> >
>> > So in an off-board discussion it turns out that the "microscope" in
>> question was a special
>> > emitted light and not a UV microscope. So real UV microscopes might be
>> better for the
>> > purpose of detecting real crystals.
>> >
>> > Sorry for the confusion - had too much sun today :-)
>> >
>> > Jürgen
>> >
>> > On Sep 15, 2011, at 4:19 PM, Jürgen Bosch wrote:
>> >
>> > I once tested such a commercial system in Seattle about 4 years ago. It
>> did not impress
>> > me. In particular the discrimination between salt and protein did not
>> work for about 10
>> > different proteins from which we already had collected data. sure those
>> were small
>> > between 10 and 100 micrometer. Excuse was to few tryptophans
>> > So in theory it is nice but a cheaper variant might be to add Gfp to
>> your protein and
>> > screen for something green.
>> > Jürgen
>> >
>> > ..
>> > Jürgen Bosch
>> > Johns Hopkins Bloomberg School of Public Health
>> > Department of Biochemistry & Molecular Biology
>> > Johns Hopkins Malaria Research Institute
>> > 615 North Wolfe Street, W8708
>> > Baltimore, MD 21205
>> > Phone: +1-410-614-4742
>> > Lab: +1-410-614-4894
>> > Fax: +1-410-955-3655
>> > http://web.mac.com/bosch_lab/
>> >
>> > On Sep 15, 2011, at 16:03, Frank von Delft 
>> wrote:
>> >
>> > A while ago I was trying to be cheap, so we played around with it quite
>> > a bit in the lab. After rediscovering some of the basics of
>> > signal-to-noise and microscope transmission efficiency and that sort of
>> > rot, I realised that the commercial systems may not be all that
>> > ridiculously overpriced after all. Not if one wants to be able to say
>> > something useful about really really small crystals -- the only ones
>> > that really matter in the grand scheme of things (big ones are quick to
>> > test; little ones must first be optimized = money+time).
>> >
>> > But maybe I was just being incompetent. Happens.
>> > phx.
>> >
>> >
>> >
>> >
>> > On 15/09/2011 20:50, Andrew Purkiss-Trew wrote:
>> > Quoting "Harman, Christine":
>> >
>> > Hi All,
>> > I was curious if any of you have tried or even know if it is
>> > possible to adapt a stereoscope (in my case an Olympus SZX10 model)
>> > so as to view protein crystals with UV illumination. Basically, I
>> > want a cheap manual version of what a Rock UV Imager does. I know
>> > this is probably a crazy dream. However, I would greatly appreciate
>> > any comments, advice or experience any of you may have.
>> >
>> > Molecular Dimension do such an adaptor which fits to existing
>> microscopes.
>> >
>> > See
>> > <
>> http://www.moleculardimensions.com/shopdisplayproducts.asp?id=121&cat=X%2DtaLight%3Csup%3E%99%3C%2Fsup%3E+100+%2D+UV+for+Microscope+
>> >
>> >
>> >
>> > 
>> > This message was sent using IMP, the Internet Messaging Program.
>> >
>> > ..
>> > Jürgen Bosch
>> > Johns Hopkins University
>> > Bloomberg School of Public Health
>> > Department of Biochemistry & Molecular Biology
>> > Johns Hopkins Malaria Research Institute
>> > 615 North Wolfe Street, W8708
>> > Baltimore, MD 21205
>> > Office: +1-410-614-4742
>> > Lab: +1-410-614-4894
>> > Fax: +1-410-955-2926
>> > http://web.mac.com/bosch_lab/
>> >
>> >
>> >
>> >
>> >
>> >
>>
>
>


-- 
 patr...@douglas.co.ukDouglas Instruments Ltd.
 Douglas House, East Garston, Hungerford, Berkshire, RG17 7HD, UK
 Directors: Peter Baldock, Patrick Shaw Stewart

 http://www.douglas.co.uk
 Tel: 44 (0) 148-864-9090US toll-free 1-877-225-2034
 Regd. England 2177994, VAT Reg. GB 480 7371 36

Re: [ccp4bb] Complex seeding

[Patrick Shaw Stewart]

Hi Peter

This idea was discussed at the recent RAMC meeting, and there is at least
one example where it has worked.

Generally, cross-seeding can work as long as you have homology.  See e.g.
 Obmolova et al. Acta Crystallogr. 2010, D66, 927–933.  The same group has
reported seeding a complex with crystals of one of the monomers.

One thing to bear in mind is that there is no point in adding a seed stock
(with e.g. crystals of one of the monomers) if the seed stock destabilizes
your complex.  This is all discussed in great detail and suggestions are
made for finding alternatives in a paper that I mentioned here earlier
(which we published this year) ref below.

Good luck

Patrick

_

“Random Microseeding: A Theoretical and Practical Exploration of Seed
Stability and Seeding Techniques for Successful Protein Crystallization”.
 Shaw Stewart et al, Crystal Growth and Design, 2011, 11 (8), p3432.

On-line at http://pubs.acs.org/doi/abs/10.1021/cg2001442





On Wed, Sep 21, 2011 at 6:04 PM, Peter Hsu  wrote:

> Hi all,
>
> I've been trying to crystallize a 3 protein complex recently with little
> success. However, crystals of each subunit have previously been
> crystallized. I was wondering if any one knows of any literature/experiences
> where people have used seeds from an individual subunit to seed for a
> complex and succeeded? Or is this just a crazy/bad idea?
>
> Thanks in advance for any input.
>
> Peter
>



-- 
 patr...@douglas.co.ukDouglas Instruments Ltd.
 Douglas House, East Garston, Hungerford, Berkshire, RG17 7HD, UK
 Directors: Peter Baldock, Patrick Shaw Stewart

 http://www.douglas.co.uk
 Tel: 44 (0) 148-864-9090US toll-free 1-877-225-2034
 Regd. England 2177994, VAT Reg. GB 480 7371 36

Re: [ccp4bb] neutron data measurement

[Patrick Shaw Stewart]

> Third, the size of crystal needed for successful neutron diffraction is
right at the limit of the size of crystal that can be successfully
flash-cooled without inducing excess mosaicity.

Can't the crystal be flash-cooled at high pressure? The inventors of the
Crystal Harp in Zurich use a machine that does this automatically for cryo
e.m., which many universities already have.



On Fri, Sep 23, 2011 at 4:40 PM, Leif Hanson  wrote:

> This thread caught my attention several days ago and I now have enough time
> to add my two cents worth. These are my own biases and probably do not
> reflect the views of my friends and colleagues at various neutron
> facilities.
>
>
> With respect to the size of crystals for neutron diffraction, a good rule
> of thumb is that there should be at least 10exp24 uniformly ordered unit
> cells in a D2O exchanged crystal to have successful diffraction on par
> with rotating anode data measured on a crystal with a tenth the volume.
> Several data sets have been measured from smaller crystals, and
> perdeuteration lowers the volume needed to extract useful information. Most
> of the neutron data has a resolution cutoff of 1.8 to 2.0Å, which permits
> unambiguous placement of deuterons and solvent molecules, especially when
> completing dual refinement of X-ray and neutron data from the same crystal.
>
>
> There have been a limited number of low temperature neutron diffraction
> experiments for several reasons. First, of the available neutron beamlines
> for macromolecular data measurement there are only one or two with open flow
> cryostats available, limiting the locations for standard macromolecular
> cryocrystallography. Second, there are a tremendous number of important
> structures that can be done at room temperature. It is difficult to justify
> the time needed for low temperature work to experimental review panels when
> crystals are available to resolve a knotty enzyme mechanism problem. Third,
> the size of crystal needed for successful neutron diffraction is right at
> the limit of the size of crystal that can be successfully flash-cooled
> without inducing excess mosaicity. Most neutron beamlines use some form of
> quasi-Laue data collection strategy. Mosaicities in excess of 0.5º render
> most crystals unusable for neutron data measurement. Remember that a lot of
> uniform unit cells are needed to get a usable diffraction signal from
> neutrons. Often a large flash-cooled cooled crystal appears to have low
> mosaicity when exposed to 0.5mm x-ray beam. However, when placed in the 3mm
> neutron beam, limited streaky low-resolution diffraction appears. It is
> difficult to judge the quality of flash-cooled neutron diffraction sized
> crystal without placing it in the neutron beam. Returning to point 2 it is
> difficult justify the time needed on fishing expedition. So far the only
> large crystals I have been able to flash-cool that met the demands of size
> and crystal perfection had very low solvent content or were grown in high
> levels of cryoprotectant. That said, several critical problems cry out for
> low temp neutron studies so there is every reason to persevere. I would be
> pleased to answer any questions off-line for those of you with more interest
> in neutron cryocrystallography.
>
>
> Finally with respect to radiation damage, Benno Schoenborn has had a
> myoglobin crystal in sealed capillary that he has used as a “standard
> candle” for testing neutron beamlines. There has been no discernable
> degradation of the crystal in all the years he has used it. The neutrons
> used for neutron diffraction are ‘cold’ neutrons, usually with energies of 1
> – 10 meV. Damage could come from activated nuclei, but these are usually
> very limited on a molar basis within the crystal. As can be seen with
> Benno’s myoglobin crystal, 30 years of iron activation has yet to produce a
> measurable defect.
>
>
> Leif Hanson
>
> University of Toledo
>



-- 
 patr...@douglas.co.ukDouglas Instruments Ltd.
 Douglas House, East Garston, Hungerford, Berkshire, RG17 7HD, UK
 Directors: Peter Baldock, Patrick Shaw Stewart

 http://www.douglas.co.uk
 Tel: 44 (0) 148-864-9090US toll-free 1-877-225-2034
 Regd. England 2177994, VAT Reg. GB 480 7371 36

Re: [ccp4bb] Protein melting temperatures

[Patrick Shaw Stewart]

I actually think you *can *make comparisons between different proteins.  We
heard a very nice talk by Jose Marquez about exactly this at the RAMC
meeting recently.

Basically, 45C seemed to be the dividing line.  If your protein melts below
this it's a bad sign for crystallization and may point to setting up your
crystallization experiments at lower temperatures.

Patrick



On Thu, Sep 23, 2010 at 6:04 PM, Anastassis Perrakis wrote:

> **
>
> Hello -
>
> The excellent paper of McCrary, uses differential scanning
> calorimetry, which will give an absolute measure of thermostability.
>
> Using Thermofluor I would be afraid you can only assess the relative
> thermostability of one protein in different conditions.
> As your fluorescence reporter would interact differently with exposed
> hydro[hobic patches in different proteins, I would be a bit more careful
> in comparing the Thermofluor results between different proteins ... I
> am not aware of anyone correlating differential scanning calorimetrywith
> Thermofluor data, but I must admit I have not looked up that
> literature recently.
>
> A.
>
>
> On 23 Sep 2010, at 18:40, Philippe DUMAS wrote:
>
> > Le 23/09/2010 17:28, Raji Edayathumangalam a écrit :
> >
> > Raji
> > I suggest having a look to this paper:
> > McCrary et al. J. Mol. Biol. 264(1996) 784
> > where you will find an interesting study on protein stability and an
> > interesting comparison with other proteins.
> > Philippe Dumas
> >
> >> Hi Folks,
> >>
> >> Sorry for the pre-xtallo question; pre-xtallo right now, but hoping
> >> to
> >> take my protein the xtallo way one of these days!
> >>
> >> I am currently performing Thermofluor assays with my protein and the
> >> results show that the Tm is ~45C.  I am looking for some examples of
> >> proteins and their melting temperatures so that I can gauge where my
> >> protein falls in the spectrum of unstable-to-stably folded. For
> >> example, the melting temperature of some forms of lysozyme is 73.8C
> >> (very stable, I suppose).
> >>
> >> Just need a sense for whether my protein is considered unstable or
> >> somewhat stable. Please could you share some examples.
> >>
> >> Many thanks.
> >> Raji
> >>
> >> ---
> >> Raji Edayathumangalam
> >> Joint Research Fellow
> >> Harvard Medical School/
> >> Brigham and Women's Hospital
> >> Brandeis University
> >>
> >
> > 
>



-- 
 patr...@douglas.co.ukDouglas Instruments Ltd.
 Douglas House, East Garston, Hungerford, Berkshire, RG17 7HD, UK
 Directors: Peter Baldock, Patrick Shaw Stewart

 http://www.douglas.co.uk
 Tel: 44 (0) 148-864-9090US toll-free 1-877-225-2034
 Regd. England 2177994, VAT Reg. GB 480 7371 36

Re: [ccp4bb] Protein melting temperatures

[Patrick Shaw Stewart]

Susan and everyone,

I should apologise for any confusion that I may have caused.

Rajiv actually asked his question a year ago, and I accidentally replied to
it a year too late!

It's an interesting question though

Patrick

On Wed, Sep 28, 2011 at 5:03 PM, Linda Schuldt  wrote:

> **
>
> Dear Raji,
>
> what exactly do you mean when you say the melting temperature is 45deg.
> Did you only test one buffer, or did you test many buffers and 45deg is
> the most stable one? If you have only tested one buffer you should run a
> screen testing different buffer systems (pH) and e.g. NaCl concentration
> and glycerol concentrations (or ligands, if your proteins binds any). Then
> you identify the buffer which is stabilizing your protein the most. I have
> seen big impacts on protein stability and crystallization when optimizing
> my buffers like this.
>
> I think you should not only consider the melting temperature alone, but
> also how the curve looks like. Do you get a high initial flourescence
> (which often indicates partially unfolded protein or hydrophobic patches)
> or do you have very low initial flourescence (which is a good sign for
> compact protein). Another thing to look at is if your transition is sharp
> (the steeper the better). Taking all this together you can judge if your
> protein is happy or not.
>
> Hope this helps you!
>
> Linda
>
> Patrick Shaw Stewart wrote:
> > I actually think you *can *make comparisons between different proteins.
> > We
> > heard a very nice talk by Jose Marquez about exactly this at the RAMC
> > meeting recently.
> >
> > Basically, 45C seemed to be the dividing line.  If your protein melts
> > below
> > this it's a bad sign for crystallization and may point to setting up your
> > crystallization experiments at lower temperatures.
> >
> > Patrick
> >
> >
> >
> > On Thu, Sep 23, 2010 at 6:04 PM, Anastassis Perrakis
> > wrote:
> >
> >> **
> >>
> >> Hello -
> >>
> >> The excellent paper of McCrary, uses differential scanning
> >> calorimetry, which will give an absolute measure of thermostability.
> >>
> >> Using Thermofluor I would be afraid you can only assess the relative
> >> thermostability of one protein in different conditions.
> >> As your fluorescence reporter would interact differently with exposed
> >> hydro[hobic patches in different proteins, I would be a bit more careful
> >> in comparing the Thermofluor results between different proteins ... I
> >> am not aware of anyone correlating differential scanning calorimetrywith
> >> Thermofluor data, but I must admit I have not looked up that
> >> literature recently.
> >>
> >> A.
> >>
> >>
> >> On 23 Sep 2010, at 18:40, Philippe DUMAS wrote:
> >>
> >> > Le 23/09/2010 17:28, Raji Edayathumangalam a écrit :
> >> >
> >> > Raji
> >> > I suggest having a look to this paper:
> >> > McCrary et al. J. Mol. Biol. 264(1996) 784
> >> > where you will find an interesting study on protein stability and an
> >> > interesting comparison with other proteins.
> >> > Philippe Dumas
> >> >
> >> >> Hi Folks,
> >> >>
> >> >> Sorry for the pre-xtallo question; pre-xtallo right now, but hoping
> >> >> to
> >> >> take my protein the xtallo way one of these days!
> >> >>
> >> >> I am currently performing Thermofluor assays with my protein and the
> >> >> results show that the Tm is ~45C.  I am looking for some examples of
> >> >> proteins and their melting temperatures so that I can gauge where my
> >> >> protein falls in the spectrum of unstable-to-stably folded. For
> >> >> example, the melting temperature of some forms of lysozyme is 73.8C
> >> >> (very stable, I suppose).
> >> >>
> >> >> Just need a sense for whether my protein is considered unstable or
> >> >> somewhat stable. Please could you share some examples.
> >> >>
> >> >> Many thanks.
> >> >> Raji
> >> >>
> >> >> ---
> >> >> Raji Edayathumangalam
> >> >> Joint Research Fellow
> >> >> Harvard Medical School/
> >> >> Brigham and Women's Hospital
> >> >> Brandeis University
> >> >>
> >> >
> >> > 
> >>
> >
> >
> >
> > --
> >  patr...@douglas.co.ukDouglas Instruments Ltd.
> >  Douglas House, East Garston, Hungerford, Berkshire, RG17 7HD, UK
> >  Directors: Peter Baldock, Patrick Shaw Stewart
> >
> >  http://www.douglas.co.uk
> >  Tel: 44 (0) 148-864-9090US toll-free 1-877-225-2034
> >  Regd. England 2177994, VAT Reg. GB 480 7371 36
> >
>
>
>
>
>
>
> ***
> Dr. Linda Schuldt
> Department of Molecular Biology
> University of Aarhus
> Science Park
> Gustav Wieds Vej 10c
> DK-8000 Århus C
> Denmark
>
>


-- 
 patr...@douglas.co.ukDouglas Instruments Ltd.
 Douglas House, East Garston, Hungerford, Berkshire, RG17 7HD, UK
 Directors: Peter Baldock, Patrick Shaw Stewart

 http://www.douglas.co.uk
 Tel: 44 (0) 148-864-9090US toll-free 1-877-225-2034
 Regd. England 2177994, VAT Reg. GB 480 7371 36

Re: [ccp4bb] IUCr committees, depositing images

[Patrick Shaw Stewart]

Could you perhaps use the principle of "capture storage" that is used by
wild-life photographers with high-speed cameras?

The principle is that the movie is written to the same area of memory,
jumping back to the beginning when it is full (this part is not essential,
but it makes the principle clear).  Then, when the photographer takes his
finger off the trigger, the last x seconds is permanently stored.  So you
keep your wits about you, and press the metaphorical "store" button just *after
*you have got the movie in the can so to speak

Just a thought

Patrick


On Wed, Oct 26, 2011 at 2:18 PM, John R Helliwell wrote:

> Dear Frank,
> re 'who will write the grant?'.
>
> This is not as easy as it sounds, would that it were!
>
> There are two possible business plans:-
> Option 1. Specifically for MX is the PDB as the first and foremost
> candidate to seek such additional funds for full diffraction data
> deposition for each future PDB deposiition entry. This business plan
> possibility is best answered by PDB/EBI (eg Gerard Kleywegt has
> answered this in the negative thus far at the CCP4 January 2010).
>
> Option 2 The Journals that host the publications could add the cost to
> the subscriber and/or the author according to their funding model. As
> an example and as a start a draft business plan has been written by
> one of us [JRH] for IUCr Acta Cryst E; this seemed attractive because
> of its simpler 'author pays' financing. This proposed business plan is
> now with IUCr Journals to digest and hopefully refine. Initial
> indications are that Acta Cryst C would be perceived by IUCr Journals
> as a better place to start considering this in detail, as it involves
> fewer crystal structures than Acta E and would thus be more
> manageable. The overall advantage of the responsibility being with
> Journals as we see it is that it encourages such 'archiving of data
> with literature' across all crystallography related techniques (single
> crystal, SAXS, SANS, Electron crystallography etc) and fields
> (Biology, Chemistry, Materials, Condensed Matter Physics etc) ie not
> just one technique and field, although obviously biology is dear to
> our hearts here in the CCP4bb.
>
> Yours sincerely,
> John and Tom
> John Helliwell  and Tom Terwilliger
>
> On Wed, Oct 26, 2011 at 9:21 AM, Frank von Delft
>  wrote:
> > Since when has the cost of any project been limited by the cost of
> > hardware?  Someone has to implement this -- and make a career out of it;
> > thunderingly absent from this thread has been the chorus of volunteers
> who
> > will write the grant.
> > phx
> >
> >
> > On 25/10/2011 21:10, Herbert J. Bernstein wrote:
> >
> > To be fair to those concerned about cost, a more conservative estimate
> > from the NSF RDLM workshop last summer in Princeton is $1,000 to $3,000
> > per terabyte per year for long term storage allowing for overhead in
> > moderate-sized institutions such as the PDB.  Larger entities, such
> > as Google are able to do it for much lower annual costs in the range of
> > $100 to $300 per terabyte per year.  Indeed, if this becomes a serious
> > effort, one might wish to consider involving the large storage farm
> > businesses such as Google and Amazon.  They might be willing to help
> > support science partially in exchange for eyeballs going to their sites.
> >
> > Regards,
> >H. J. Bernstein
> >
> > At 1:56 PM -0600 10/25/11, James Stroud wrote:
> >
> > On Oct 24, 2011, at 3:56 PM, James Holton wrote:
> >
> > The PDB only gets about 8000 depositions per year
> >
> > Just to put this into dollars. If each dataset is about 17 GB in
> > size, then that's about 14 TB of storage that needs to come online
> > every year to store the raw data for every structure. A two second
> > search reveals that Newegg has a 3GB hitachi for $200. So that's
> > about $1000 / year of storage for the raw data behind PDB deposits.
> >
> > James
> >
> >
>
>
>
> --
> Professor John R Helliwell DSc
>



-- 
 patr...@douglas.co.ukDouglas Instruments Ltd.
 Douglas House, East Garston, Hungerford, Berkshire, RG17 7HD, UK
 Directors: Peter Baldock, Patrick Shaw Stewart

 http://www.douglas.co.uk
 Tel: 44 (0) 148-864-9090US toll-free 1-877-225-2034
 Regd. England 2177994, VAT Reg. GB 480 7371 36

Re: [ccp4bb] Disappearing crystals

[Patrick Shaw Stewart]

 5 days later
> > Hi Christine,
> > I had similar experience. In my case, another crystal showed again with
> > different size a few days later. Sometimes, it seems like it is a common
> > event to others as well as I heard although my case only takes about a
> > week to be crystallized.  I'd rather wait or just set up again or in a
> > slightly different way.
> >
> > Wish you well.
> >
> > Young-Jin
> >
>
>
> --
> Enrico A. Stura D.Phil. (Oxon) ,Tel: 33 (0)1 69 08 4302 Office
> Room 19, Bat.152,   Tel: 33 (0)1 69 08 9449Lab
> LTMB, SIMOPRO, IBiTec-S, CE Saclay, 91191 Gif-sur-Yvette,   FRANCE
>
> http://www-dsv.cea.fr/en/institutes/institute-of-biology-and-technology-saclay-ibitec-s/unites-de-recherche/department-of-molecular-engineering-of-proteins-simopro/molecular-toxinology-and-biotechnology-laboratory-ltmb/crystallogenesis-e.-stura
> http://www.chem.gla.ac.uk/protein/mirror/stura/index2.html
> e-mail: est...@cea.fr Fax: 33 (0)1 69 08 90 71
>



-- 
 patr...@douglas.co.ukDouglas Instruments Ltd.
 Douglas House, East Garston, Hungerford, Berkshire, RG17 7HD, UK
 Directors: Peter Baldock, Patrick Shaw Stewart

 http://www.douglas.co.uk
 Tel: 44 (0) 148-864-9090US toll-free 1-877-225-2034
 Regd. England 2177994, VAT Reg. GB 480 7371 36

Re: [ccp4bb] No diffraction

[Patrick Shaw Stewart]

Theresa

You should also try microseeding into *random screens *by making a seed
stock with the crystals that you have, to use with both microbatch and
vapor diffusion experiments.  You will often pick up new and better
conditions and you're more likely to get well-formed crystals right out of
the screens.

I hope it works

Patrick

_

Refs: Allan D’Arcy, Frederic Villarda, May Marsh. An automated microseed
matrix-screening method for protein crystallization.  Acta
Crystallographica section D 63 (2007), 550–554.

Galina Obmolova,* Thomas J. Malia, Alexey Teplyakov, Raymond Sweet and Gary
L. Gilliland. 'Promoting crystallization of antibody–antigen complexes via
microseed matrix screening.' Acta Crystallographica Section D 66 (2010)
927–933.  Open-access at
http://journals.iucr.org/d/issues/2010/08/00/bw5361/bw5361.pdf

A. G. Villaseñor, A. Wong, A. Shao, A. Garg, A. Kuglstatter and S. F.
Harris. 'Acoustic matrix microseeding: improving protein crystal growth
with minimal chemical bias.' Acta Crystallographica Section D 66 (2010)
568-576.

Gregory Ireton and Barry Stoddard.  'Microseed matrix screening to improve
crystals of yeast cytosine deaminase'.  Acta Crystallographica section D60
(2004) 601–605.

Patrick D. Shaw Stewart, Stefan A. Kolek, Richard A. Briggs, Naomi E.
Chayen and Peter F.M. Baldock. 'Random Microseeding: A Theoretical and
Practical Exploration of Seed Stability and Seeding Techniques for
Successful Protein Crystallization'. Cryst. Growth Des., 2011, 11 (8), pp
3432–3441. On-line at http://pubs.acs.org/doi/abs/10.1021/cg2001442.  * If
you don't have a subscription to Crystal Growth and Design, click
**here*<http://www.douglas.co.uk/mms.htm#CGDFreeCopy>
* to obtain a free copy (we're limited to 50 downloads in the first year).*



On 26 January 2012 15:33, Theresa H. Hsu  wrote:

> Dear crystallographers
>
> I have a protein of 90 kDa forming dimers. Crystals formed with microbatch
> and vapor diffusion method in 24 hours but no diffraction at home source.
> Dissolved crystals was confirmed to be the protein with mass spec.
>
> Any suggestions to improve diffraction would be welcome.
>
> Thanking you in advance.
>
> Theresa
>



-- 
 patr...@douglas.co.ukDouglas Instruments Ltd.
 Douglas House, East Garston, Hungerford, Berkshire, RG17 7HD, UK
 Directors: Peter Baldock, Patrick Shaw Stewart

 http://www.douglas.co.uk
 Tel: 44 (0) 148-864-9090US toll-free 1-877-225-2034
 Regd. England 2177994, VAT Reg. GB 480 7371 36

Re: [ccp4bb] Dye for protein affinity measurement

[Patrick Shaw Stewart]

Jiahong

Thermo sells a series of kits called DyLight Fluor for fluorescent
labelling of antibodies or other proteins.  They have everything you need
and they're very convenient and easy to use.  You can pick the excitation
and emission wavelength.  If you label both A and B (or C) with different
"colors" you will be able to see if both are in your crystals (assuming
crystallization is part of your approach).

You need only label a small percentage of your protein or peptide to see
whether the protein is present in a crystal.

Patrick


http://en.wikipedia.org/wiki/DyLight_Fluor

Forsythe, E.L., Achari, A., and Pusey, Marc L. (2006),  Trace Fluorescent
Labeling for High Throughput Crystallography, Acta Cryst. D62, 339-346.

We used DyLight 350 NHS Ester to check we had protein crystals - see
methods section of *Cryst. Growth Des.*, 2011, *11* (8), pp 3432–3441




2012/2/8 Jiang Jiahong 

>  Dear all,
> I am looking for some kind of dye for protein affinity comparison, but do
> not know which to choose.
>
> I know  protein A can contact B to form a complex,now I hope to find
> something simiar with A to act as an inhibitor to block the process of A-B
> complex formation. Maybe a short peptide, a segment of protein A or even
> some organic molecule.
>
> Because here is a poor access to ITC nor Biacore, I can only rely on some
> dye to check the competence between A and inhibitor candidates.
>
> If any one can offer any suggestions. That would be so grateful! Any
> way,thank kind-hearted people in advance!
>
> Regards
>  Jiahong
>
>
>
>
>


-- 
 patr...@douglas.co.ukDouglas Instruments Ltd.
 Douglas House, East Garston, Hungerford, Berkshire, RG17 7HD, UK
 Directors: Peter Baldock, Patrick Shaw Stewart

 http://www.douglas.co.uk
 Tel: 44 (0) 148-864-9090US toll-free 1-877-225-2034
 Regd. England 2177994, VAT Reg. GB 480 7371 36

Re: [ccp4bb] Membrane Protein Crystallization Plates

[Patrick Shaw Stewart]

Yuri

I know this isn't quite what you're asking, but it's helpful to use the COC
("UV permeable") version of plates if you're crystallizing samples that
contain detergent.  It's just that the drops tend to spread very thinly if
you use the normal polystyrene PS plates.  The COC is more hydrophobic.
 (On the other hand we prefer PS plates for normal proteins with no
detergent.)

Patrick


On 25 February 2012 20:35, Yuri Pompeu  wrote:

> Hello Everyone,
> I am considering the purchase of crystallization plates for membrane
> proteins.
> I would love to hear what some of the community thinks or has experienced
> with these.
> Particulalrly the monoolein and monoolein/cholesterol coated plates ( I am
> not sure I can mention the vendor here but it "should" not matter)
> So fire away. Is it worth it? Any succes stories? Bad experiences?
> I appreciate the input
> Best,
> Yuri
>



-- 
 patr...@douglas.co.ukDouglas Instruments Ltd.
 Douglas House, East Garston, Hungerford, Berkshire, RG17 7HD, UK
 Directors: Peter Baldock, Patrick Shaw Stewart

 http://www.douglas.co.uk
 Tel: 44 (0) 148-864-9090US toll-free 1-877-225-2034
 Regd. England 2177994, VAT Reg. GB 480 7371 36

Re: [ccp4bb] Desalting columns

[Patrick Shaw Stewart]

We did some data mining from remark 280 of the PDB in 2004.  Of the 1000
entries that listed [protein], 46 proteins were crystallized below 3.1
mg/ml.  See table 3 at  http://www.douglas.co.uk/PDB_data.htm .

Patrick



On 27 February 2012 16:25, Bernhard Rupp (Hofkristallrat a.D.) <
hofkristall...@gmail.com> wrote:

> Why, in the first place, do you feel an urge  to concentrate your protein
> above 3 mg/ml ?
>
> ** **
>
> For crystallization, the concentration needs to be 
>
> **a)  **high enough to achieve supersaturation, meaning close enough
> to the maximum solubility in a given buffer so that the precipitant can
> drive the system in to supersaturation, preferably of a level where
> homogenous nucleation can occur (or you micro-seed, if necessary)
>
> **b)  **high enough that sufficient material for crystals of
> acceptable size to grow is in the drop, which is generally the case, lest
> micro-crystal showers happen.
>
> ** **
>
> There is ample evidence for proteins crystallizing below 3 mg/ml.
>
> ** **
>
> The often quoted PDB/BMCD average of somewhere around 10 mg/ml is biased
> towards highly soluble, smaller (lower hanging fruit) proteins.
>
> ** **
>
> Sometimes the shape of a distribution matters ;-)
>
> ** **
>
> BR
>
> ** **
>
> *From:* CCP4 bulletin board [mailto:CCP4BB@JISCMAIL.AC.UK] *On Behalf Of 
> *Sangeetha
> Vedula
> *Sent:* Monday, February 27, 2012 8:02 AM
> *To:* CCP4BB@JISCMAIL.AC.UK
> *Subject:* [ccp4bb] Desalting columns
>
> ** **
>
> Dear bb users,
>
> I am trying to crystallize a ~320 kDa protein that crashes out if
> concentrated past about 3 mg/mL.
>
> I would like to try to exchange it into various buffer-salt-additive
> combinations to see which buffer works. For a starting point, I'd like to
> use desalting colums.
>
> Does anyone have suggestions for good buffer exchange and sample recovery?
> I woud like to load about 250 uL onto each column.
>
> Thanks a lot!
>
> Best regards,
>
> Sangeetha.
>



-- 
 patr...@douglas.co.ukDouglas Instruments Ltd.
 Douglas House, East Garston, Hungerford, Berkshire, RG17 7HD, UK
 Directors: Peter Baldock, Patrick Shaw Stewart

 http://www.douglas.co.uk
 Tel: 44 (0) 148-864-9090US toll-free 1-877-225-2034
 Regd. England 2177994, VAT Reg. GB 480 7371 36

Re: [ccp4bb] microseeding

[Patrick Shaw Stewart]

Rajesh

If you set up the volumes you suggest you will probably get precipitation.
This is counterintuitive until you realize that (as Ed says) you will be
losing a lot of protein with those small drops.  When you scale up the
surface area to volume ratio is lower, so a smaller proportion of the
protein is lost.  Therefore you go *up* on the phase diagram and get
precipitant or very small crystals.

Normally halving the amount of protein for the hits from 200 nl drops works
(suggesting that half the protein is lost from such small drops).  Try say
500+1000+500 (don't reduce the volume of seed stock because the solution
that you suspended the crystals in may be important).  Or dilute the
protein and use 1000+1000+500.

For the hits from the 450 nl drops you could reduce or dilute the protein
by say 25.%.

Or make plenty of seed-stock and try seeding into a random screen again
with larger drops, say 1.5+1+0.5 ul

Those tiny crystals should be good for seeding, don't worry about that
(provided they are protein of course).

Streak seeding may work but bear in mind that roughly a third of the
precipitant comes from the seed stock in your 250 nl drops.

You can add the seed stock with a syringe and needle if you don't have
suitable robot ;)

Experience and data-mining suggests that reducing the salt precipitant (in
high-salt drops) or salt additive (in PEG drops) by around 50% may be
helpful too when scaling up - I'm not sure why this works.

Good luck

Patrick






For the hits in the 250 nl drops you are probably losing

On 19 March 2012 20:31, Rajesh kumar  wrote:

>  Dear All,
>
> I have few papers in hand which  explain me about microseeding, matrix
> microseeding, and cross seeding.
> I have also read few earlier threads and some more literature in google.
> Using Phoenix robot, I did a matrix micro-seeding and matrix cross
> seeding. I have few hits with this.
> In 96 well I used 100+100+50 nL and 200+200+50 nl (protein+screen+seed) in
> separate expts.
> I have hard time to plan to translate this 96 sitting drop well plate to
> 24 well plate to refine the conditions to get better crystals. only 1-2
> hits are small crystals and they are tiny.
>
>  I wonder in 24 well plate, if I should do-
> 1)  for Example 500+500+50nl (I am sure I cant add less that 500
> nL precisely)
> 2) to a drop of 500+500 nL do microseeding/streaking with a hair
>
> I appreciate if you could advise and share some practical ways to further
> my experiment.
>
> Thanks in advance
> Regards,
> Rajesh
>



-- 
 patr...@douglas.co.ukDouglas Instruments Ltd.
 Douglas House, East Garston, Hungerford, Berkshire, RG17 7HD, UK
 Directors: Peter Baldock, Patrick Shaw Stewart

 http://www.douglas.co.uk
 Tel: 44 (0) 148-864-9090US toll-free 1-877-225-2034
 Regd. England 2177994, VAT Reg. GB 480 7371 36

Re: [ccp4bb] microseeding

[Patrick Shaw Stewart]

Sorry, I said that last part wrong.  I meant it is sometimes helpful to*increase
* the salt by 50% when scaling up.


On 19 March 2012 22:29, Patrick Shaw Stewart  wrote:

>
> Rajesh
>
> If you set up the volumes you suggest you will probably get
> precipitation.  This is counterintuitive until you realize that (as Ed
> says) you will be losing a lot of protein with those small drops.  When you
> scale up the surface area to volume ratio is lower, so a smaller proportion
> of the protein is lost.  Therefore you go *up* on the phase diagram and
> get precipitant or very small crystals.
>
> Normally halving the amount of protein for the hits from 200 nl drops
> works (suggesting that half the protein is lost from such small drops).
> Try say 500+1000+500 (don't reduce the volume of seed stock because the
> solution that you suspended the crystals in may be important).  Or dilute
> the protein and use 1000+1000+500.
>
> For the hits from the 450 nl drops you could reduce or dilute the protein
> by say 25.%.
>
> Or make plenty of seed-stock and try seeding into a random screen again
> with larger drops, say 1.5+1+0.5 ul
>
> Those tiny crystals should be good for seeding, don't worry about that
> (provided they are protein of course).
>
> Streak seeding may work but bear in mind that roughly a third of the
> precipitant comes from the seed stock in your 250 nl drops.
>
> You can add the seed stock with a syringe and needle if you don't have
> suitable robot ;)
>
> Experience and data-mining suggests that reducing the salt precipitant (in
> high-salt drops) or salt additive (in PEG drops) by around 50% may be
> helpful too when scaling up - I'm not sure why this works.
>
> Good luck
>
> Patrick
>
>
>
>
>
>
> For the hits in the 250 nl drops you are probably losing
>
> On 19 March 2012 20:31, Rajesh kumar  wrote:
>
>>  Dear All,
>>
>> I have few papers in hand which  explain me about microseeding, matrix
>> microseeding, and cross seeding.
>> I have also read few earlier threads and some more literature in google.
>> Using Phoenix robot, I did a matrix micro-seeding and matrix cross
>> seeding. I have few hits with this.
>> In 96 well I used 100+100+50 nL and 200+200+50 nl (protein+screen+seed)
>> in separate expts.
>> I have hard time to plan to translate this 96 sitting drop well plate to
>> 24 well plate to refine the conditions to get better crystals. only 1-2
>> hits are small crystals and they are tiny.
>>
>>  I wonder in 24 well plate, if I should do-
>> 1)  for Example 500+500+50nl (I am sure I cant add less that 500
>> nL precisely)
>> 2) to a drop of 500+500 nL do microseeding/streaking with a hair
>>
>> I appreciate if you could advise and share some practical ways to further
>> my experiment.
>>
>> Thanks in advance
>> Regards,
>> Rajesh
>>
>
>
>
> --
>  patr...@douglas.co.ukDouglas Instruments Ltd.
>  Douglas House, East Garston, Hungerford, Berkshire, RG17 7HD, UK
>  Directors: Peter Baldock, Patrick Shaw Stewart
>
>  http://www.douglas.co.uk
>  Tel: 44 (0) 148-864-9090US toll-free 1-877-225-2034
>  Regd. England 2177994, VAT Reg. GB 480 7371 36
>
>


-- 
 patr...@douglas.co.ukDouglas Instruments Ltd.
 Douglas House, East Garston, Hungerford, Berkshire, RG17 7HD, UK
 Directors: Peter Baldock, Patrick Shaw Stewart

 http://www.douglas.co.uk
 Tel: 44 (0) 148-864-9090US toll-free 1-877-225-2034
 Regd. England 2177994, VAT Reg. GB 480 7371 36

Re: [ccp4bb] Unable to reproduce robot tray hits in hand trays

[Patrick Shaw Stewart]

Hi Matt

Rajesh asked a similar question last week, below

Essentially, you have to *reduce *the protein concentration when you scale
up because you lose proportionally more protein from smaller drops.

This usually works very well and we see no reason to use more than 0.3 +
0.3 for initial screening.

There's a page on our web site which explains this in much more detail, see
http://www.douglas.co.uk/Scaling_Up.htm

Best wishes

Patrick


-- Forwarded message --
From: Patrick Shaw Stewart 
Date: 19 March 2012 22:29
Subject: Re: [ccp4bb] microseeding
To: Rajesh kumar , ccp4bb@jiscmail.ac.uk



Rajesh

If you set up the volumes you suggest you will probably get precipitation.
This is counterintuitive until you realize that (as Ed says) you will be
losing a lot of protein with those small drops.  When you scale up the
surface area to volume ratio is lower, so a smaller proportion of the
protein is lost.  Therefore you go *up* on the phase diagram and get
precipitation or very small crystals.

Normally halving the amount of protein for the hits from 200 nl drops works
(suggesting that half the protein is lost from such small drops).  Try say
500+1000+500 (don't reduce the volume of seed stock because the solution
that you suspended the crystals in may be important).  Or dilute the
protein and use 1000+1000+500.

For the hits from the 450 nl drops you could reduce or dilute the protein
by say 25.%.

Or make plenty of seed-stock and try seeding into a random screen again
with larger drops, say 1.5+1+0.5 ul

Those tiny crystals should be good for seeding, don't worry about that
(provided they are protein of course).

Streak seeding may work but bear in mind that roughly a third of the
precipitant comes from the seed stock in your 250 nl drops.

You can add the seed stock with a syringe and needle if you don't have
suitable robot ;)

Experience and data-mining suggests that increasing the salt precipitant
(in high-salt drops) or salt additive (in PEG drops) by around 50% may be
helpful too when scaling up - I'm not sure why this works.

Good luck

Patrick






For the hits in the 250 nl drops you are probably losing

On 19 March 2012 20:31, Rajesh kumar  wrote:

> Dear All,
>
> I have few papers in hand which  explain me about microseeding, matrix
> microseeding, and cross seeding.
> I have also read few earlier threads and some more literature in google.
> Using Phoenix robot, I did a matrix micro-seeding and matrix cross
> seeding. I have few hits with this.
> In 96 well I used 100+100+50 nL and 200+200+50 nl (protein+screen+seed) in
> separate expts.
> I have hard time to plan to translate this 96 sitting drop well plate to
> 24 well plate to refine the conditions to get better crystals. only 1-2
> hits are small crystals and they are tiny.
>
>  I wonder in 24 well plate, if I should do-
> 1)  for Example 500+500+50nl (I am sure I cant add less that 500
> nL precisely)
> 2) to a drop of 500+500 nL do microseeding/streaking with a hair
>
> I appreciate if you could advise and share some practical ways to further
> my experiment.
>
> Thanks in advance
> Regards,
> Rajesh
>



-- 
 patr...@douglas.co.ukDouglas Instruments Ltd.
 Douglas House, East Garston, Hungerford, Berkshire, RG17 7HD, UK
 Directors: Peter Baldock, Patrick Shaw Stewart

 http://www.douglas.co.uk
 Tel: 44 (0) 148-864-9090US toll-free 1-877-225-2034
 Regd. England 2177994, VAT Reg. GB 480 7371 36


-- 
 patr...@douglas.co.ukDouglas Instruments Ltd.
 Douglas House, East Garston, Hungerford, Berkshire, RG17 7HD, UK
 Directors: Peter Baldock, Patrick Shaw Stewart

 http://www.douglas.co.uk
 Tel: 44 (0) 148-864-9090US toll-free 1-877-225-2034
 Regd. England 2177994, VAT Reg. GB 480 7371 36

Re: [ccp4bb] Off-topic: Supplying PDB file to reviewers

[Patrick Shaw Stewart]

When I hear of a reviewer holding up a publication and then publishing
something similar, my first reaction is fury and I feel the case should be
investigated and this immoral individual should be exposed.  However I can
see that there are many shades of gray here.  We're all biased in that we
tend to ignore information that conflicts with our previous cherished
beliefs and focus on things that confirm them.  So it can take a long time
to change your mind - sometimes months.  This can lead to indecision and
delays, but in retrospect we tend to think that we would have come to those
conclusions in any case so there's no harm in using the info.

People with a strong sense of duty will get the review done quickly and
make sure that they don't take advantage of the data, but I can see that it
can be tempting.

I think the idea of getting reviewers to sign a piece of paper saying that
there is no immediate conflict of interest i.e. they are not about to
publish something similar, is a good one.  The author could prepare simple
statement describing the topics covered (not the abstract which gives, or
should give, the conclusions).  Then it's not a matter of proving that the
reviewer cheated, only that they had the opportunity to cheat.

I always communicate freely with the editors, e.g. telling them why I don't
want such-and-such to review the paper.  Wouldn't it be possible simply to
ask the editor to check that the reviewer asking for co-ordinates etc is
not close to publishing something that could benefit from the data?

I don't think it's a good idea for reviewers' names to be visible because
that would mean that we would all have to do a far more professional job of
the review.  (I'm not a career scientist but I've been asked to review a
few papers.)

I also agree with those who say that this competitive focus on high impact
journals etc. stifles creativity, is inefficient and gives poor value for
money.

Just some thoughts - probably stating the obvious

Patrick



On 20 April 2012 01:18, Edward A. Berry  wrote:

> Bosch, Juergen wrote:
>
>> To pick a bit on George's point with MR & citation.
>>
>> Here's how you can read it in the paper from your favourite competitor:
>>
>> A homology model was generated using [fill in any program for ab initio
>> prediction] and subsequently used for molecular replacement with Molrep.
>> The structure was refined to an Rwork of 21% and Rfree of 24 %.
>>
>>  Or maybe the structure was solved by MIR, using a lot of heavy atom data
> that
> they had been unable to solve until a fortuitous MR result gave phases
> which
> located the heavy atoms -- No, No, it was that new improved version of
> autosol!
> Anyway, who cares how the heavy atoms were located- the structure was
> solved
> entirely using their data and they have the raw data (image files even) to
> prove it. It was just bad luck with the derivatives that kept them from
> solving it 6 months earlier. They really deserve to have the first
> publication!
>
>>
>>
>>


-- 
 patr...@douglas.co.ukDouglas Instruments Ltd.
 Douglas House, East Garston, Hungerford, Berkshire, RG17 7HD, UK
 Directors: Peter Baldock, Patrick Shaw Stewart

 http://www.douglas.co.uk
 Tel: 44 (0) 148-864-9090US toll-free 1-877-225-2034
 Regd. England 2177994, VAT Reg. GB 480 7371 36

Re: [ccp4bb] zinc with HEPES/seeding

[Patrick Shaw Stewart]

It sounds as though microseeding worked very well, but the crystals are
still growing far too quickly.

Try diluting the protein and/or the reservoir solution to half the concs
you are using or lower.

To have enough protein you need larger drops, say 500 + 500 + 200 by hand
if you can't do it with the Phoenix (wrong robot of course ;)  Dispense the
seed with a Hamilton syringe, rinsing the needle in the reservoirs before
adding to the drops.

You could also try using large volumes, say 4 ul total, with dilute
ingredients, and make a small hole in the tape with a pin to let the wells
slowly dry out.



On 11 May 2012 18:35, Rajesh Kumar  wrote:

>
> Dear Patrick,
>
> You along with others had made some suggestions last time. May be its a
> good time to update.
>
> With classical screening, I got a crystal like appearances/shower with
> HEPES 7.5 and LiSo4 1.5M.  Trying to vary the pH of Hepes or using Tris and
> with different conc of Lithium I could only get very very thin needles
> which shower and difficult to pick even with 0.05 loop. changing conc of
> protein, salt, adding oil on well, changing drop ratio, adding 5% PEGs,
> glycerol, ethylene glycol, didnt reduce shower.
>
>  I prepared the seeds from 7.6 ph and 1.25 M Liso4 conditions and MMS
> screened with all the 4 screens (Qiagen procomplex, classic, peg, JCSG)
> 100nl+100nL+50nL seeds using Phoenix.
>
> Got several nice hits which very good size individual crystals in
> conditions with 30% glycerol and 14% Isopropanol, 20% PEG8K, 30 PEG400.
> When I optimized them I got beautiful crystals and tried at ALS 5.0.3 but
> no spots. I tried picking crystals from 30 min to 4 hrs to 4 days after
> plates were set and there was no luck. Crystals started to appear from 20
> min onwards and keep growing in next couple of hours.  I thought of trying
> dehydration but they were already in dehydrating conditions them selves. I
> wanted to ask if anyone ever failed with MMS but thought not
> waste others time on this. Cross seeding to full length protein and Se met
> protein also gave beautiful crystal but again no diffraction. I have not
> checked SeMet as they were bit small.
>
>  I am still open to ideas if you have any thing on seeding. I did try in
> microbatch and hanging drop as well (1.5 ul protein+ 1.4ul reservor+ 0.4 ul
> seeds, same as sitting drop which gave me very good looking crystals) but I
> didn't get any thing.  I tried streaking with reduced LiSO4 to 1.1 M but
> it didn't give me anything.
>
> Currently, I am making entropy mutations,  new constructs
> of different lengths to solve the above problem.
>
> I still want to improve this condition with needles, because I collected a
> 4.5A data on one of the needle (just one). I need phases. I have sent some
> Iodide soaks to synchotron (yet to collect data) but manipulating these
> crystal drops with more than 100 tiny needles with a tough membrane on it
> has been frustrating as I end up loosing several drops  to just to fish out
> 1-2 needles. I am ready to try   if there any trick left.
>
> Thanks for lots and lots of help.
>
> Regards,
> Rajesh
> --
> Date: Fri, 11 May 2012 18:09:54 +0100
> Subject: Re: [ccp4bb] zinc with HEPES
> From: patr...@douglas.co.uk
> To: ccp4...@hotmail.com
>
> Rajesh
>
> How did you do the MMS?  By hand or with a robot, and what screens did you
> use?
>
> and why did you change to HEPES out of interest?
>
> Patrick
>
>
> On 11 May 2012 18:05, Rajesh Kumar  wrote:
>
>  The rationale was to see if Zn could make differences in crystal
> morphology. This is because the protein has CxxC and CxxH similar to a zinc
> finger motif.
> All my efforts, additive screening, MMS, streaking, micro batch, hanging
> drop, changing drop ratio, drop shape, did not help me to either increase
> thickness  or change the shape of very very thin needle crystals.
> Yes, I will try very less, 50uM.
> Thanks for helping me to understand.
> Rajesh
>
> > Date: Fri, 11 May 2012 12:53:53 -0400
> > Subject: Re: [ccp4bb] zinc with HEPES
> > From: liehy...@gmail.com
> > To: ccp4...@hotmail.com
> >
> > Rajesh,
> > 10mM zinc seems a bit too high. I normally used it at <50uM conc.
> > ray
> >
> > On Fri, May 11, 2012 at 12:26 PM, Rajesh Kumar 
> wrote:
> > > Dear All,
> > >
> > > This question sounds simple but I dont know the answer.
> > > I was preparing a 24 well crystal screen. When I try to use 10 mM
>  ZnSO4
> > > with HEPES (pH 7.6) buffer it precipitates. I tried both ZnCl2 and Zn
> > > acetate the effect is same.
> > > I dont know why this Zn in not compatible with HEPES.
> > > Co

Re: [ccp4bb] Your suggestions needed: Difficulties in reproducing HT crystallization conditions. Thanks!

[Patrick Shaw Stewart]

Joe

 

The most common reason why people have difficulty scaling up is that
they put too much protein in the drop.  This may be true in your case
because you report that you are getting heavier precipitation.

 

What people don't realize is that you lose a lot of protein on the
surface of the plastic and on the air/protein interface.  Of course the
amount lost varies from protein to protein, but in my experience and
observation you typically lose half of the protein in 100 + 100 nl
drops.  So you have to decrease the amount of protein when you scale up
(the surface area to volume ratio is lower in larger drops). 

 

I would have expected reducing the ratio of protein to well solution to
have worked, but it's not quite the same thing as diluting the protein,
especially if you're using PEG which doesn't give much equilibration.
Try diluting the protein to say 30 - 60% of the original.

 

On a different tack, I would instantly try MMS microseeding into random
screens in a case like this.  See D'Arcy et al. (2007). Acta Cryst. D63,
550-554 and Obmolova et al. (2010).  Acta Cryst. D66, 927-933

 

Good luck

 

Patrick

 

--

For information and discussion about protein crystallization and
automation, please join 

our bulletin board at
http://groups-beta.google.com/group/oryx_group?hl=en

 

patr...@douglas.co.ukDouglas Instruments Ltd.

DouglasHouse, EastGarston, Hungerford, Berkshire, RG177HD, UK

Directors: Peter Baldock, Patrick Shaw Stewart

http://www.douglas.co.uk/

Tel: 44 (0) 148-864-9090US toll-free 1-877-225-2034

Regd. England 2177994, VAT Reg. GB 480 7371 36

 

From: CCP4 bulletin board [mailto:ccp...@jiscmail.ac.uk] On Behalf Of
Joe
Sent: 23 November 2010 17:24
To: CCP4BB@JISCMAIL.AC.UK
Subject: [ccp4bb] Your suggestions needed: Difficulties in reproducing
HT crystallization conditions. Thanks!

 

Hi all,

 

I recently have problems reproducing some conditions identified from
high throughput screenings.  

 

The initial screening (10 mg/ml protein, 0.5 ul well+ 0.6 ul protein, 23
C) gave rise to at least three hits from different screen kits.  The
follow-up grid optimization (1.5 ul well + 1.5 ul protein) varying
precipitant concentrations and pHs did not produce any crystals for all
three conditions. Instead, the drops have heavier precipitation
background.  The following experiments have been done in order to get
crystals back.

 

1. Seeding, with various precipitant concentrations

2. Varying volume ratios between well solution and protein (from 2: 1 to
1: 2 v/v).

3. Using original solutions from screen kits.

4. Hanging drops and sitting drops,

5. Dispensing protein first or well solutions first.

6. Using robot to set up drops on 96-well plate to see if I can
reproduce the original hits.

 

But none of them has worked so far.  This is the first time I
encountered such a scale-up issue.  I am running out of ideas, so hope
you could give me some suggestions.  Thank you in advance.

 

-- 

Best regards,

Joe

Re: [ccp4bb] crystallizing a complex that's sensitive to ionic strength

[Patrick Shaw Stewart]

Hua

Peter Sun and S. Radaev wrote a paper a few years ago where they showed by
data mining that the crystallization conditions of complexes heavily favor
PEG rather than salt conditions, so you are not alone.

Radaev and Sun, Crystallization of protein-protein complexes J. Appl. Cryst.
(2002). 35, 674-676

You could try microseeding *into random screens* using the crystals that you
have to make a seed stock.  See Acta Cryst. (2007). D63, 550–554 and
http://www.douglas.co.uk/mms.htm.  This approach has sometimes worked before
for complexes, eg seeding crystals of an antigen-Fab complex with crystals
of just the Fab.  You can use this approach by hand or with a robot (spin
the seed stock if you us a non-contact robot).

One problem is that you would normally put quite a lot of Amm Sulf into your
wells because you would suspend the seed crystals in the reservoir solution
where the crystals used to make the seed stock were found.  The conventional
volumes to use are 0.3 protein + 0.2 reservoir solution + 0.1 seed stock, so
typically 1/3 of the precipitant would be Amm Sulf.

My colleagues and I recently submitted a manuscript to Crystal Growth and
Design where we look in great detail at suspending seed crystals in other
precipitants (instead of Amm Sul in this case).  We found that this normally
works, eg you can usually make a seed stock with PEG instead of say salt
conditions.  You can predict whether the PEG (or any other solution) will
work for suspension by incubating the crystals in PEG for 24 hours.  If the
crystals look unchanged after that, you can almost certainly make a seed
stock from the solution in question.  (If the crystals dissolve, shatter or
crack, you MAY be able to make a seed stock with the solution.)

We used 100% PEG600, although in restrospect I think 30% - 50% PEG 3000
might be better.

I can send you a preprint, but the gist of the relevant part is above.

For a review of more radical approaches, see Bing Xiao et al., Optimizing
Protein Complexes for Crystal Growth.  Crystal Growth & Design, Vol. 7, No.
11, 2007 2215

I hope that helps

Patrick



On Sun, Feb 27, 2011 at 2:24 AM, Hua Yuan  wrote:

> Dear CCP4 community members,
>
> I've been trying to crystallize a protein complex that's very sensitive to
> ionic strength, i.e., lower salt (~0.3M) will cause precipitation of the
> complex but higher salt (~0.5 M) breaks the complex apart.  The interaction
> that holds the complex is probably mainly ionic type.
> The crystals I got so far has only one component of the complex from which
> all the crystallization conditions have high salt such as 2M Ammonium
> Sulfate in them.  Besides repeatly screening many crystallization
> conditions, I was wondering whether is any way to work around this problem.
> Your suggestions would be greatly appreciated!
>
> Thanks,
>
> Hua
>
>
>


-- 
 patr...@douglas.co.ukDouglas Instruments Ltd.
 DouglasHouse, EastGarston, Hungerford, Berkshire, RG177HD, UK
 Directors: Peter Baldock, Patrick Shaw Stewart

 http://www.douglas.co.uk
 Tel: 44 (0) 148-864-9090US toll-free 1-877-225-2034
 Regd. England 2177994, VAT Reg. GB 480 7371 36

Re: [ccp4bb] Reproducing crystals.

[Patrick Shaw Stewart]

Jun Yong and Jobichen

(I've mentioned this before, but ) - both of your projects jump out as very
good targets for microseeding with random screens.  This method often gives
extra hits and better crystals because it is more likely that crystals will
grow in the metastable zone.  It often reduces the *need *for optimization.

Read Allan D'Arcy's excellent paper, plus Obmolova et al for a spectacular
example.  Our web site has some recent tips that may help you too.

Good luck

Patrick


D'Arcy, A., Villard, F., Marsh, M. "An automated microseed matrix screening
method for protein crystallization", 2007, Acta Crystallographica, D63,
550-554.


G. Obmolova, T. J. Malia, A. Teplyakov, R. Sweet and G. L. Gilliland.
 Promoting crystallization of antibody-antigen complexes via microseed
matrix screening  Acta Cryst. (2010). D66, 927-933


http://www.douglas.co.uk/mms.htm

*
*

On Tue, Apr 12, 2011 at 1:07 PM, Jun Yong Ha  wrote:

>  Hi all,
>
> Recently, I produced crystals with MBClass1-64 which contains PEG4000,
> HEPES-Na and NaCl. But, I struggled to reproduce crystals. I tried to set up
> tray with different batch of solution. I got the crystals only from 2008
> solution, but not from fresh ones. I asked technical service of Qiagen, but
> they did not have any stock.
>
> pH between fresh and old solution is the same. I could reproduce crystals
> with this old solution 100% when setting up.
>
> Do you have any experience like this? Is PEG4000 degraded or oxidized?
>
> Please help me.
>
> Thanks in advance.
>



-- 
 patr...@douglas.co.ukDouglas Instruments Ltd.
 DouglasHouse, EastGarston, Hungerford, Berkshire, RG177HD, UK
 Directors: Peter Baldock, Patrick Shaw Stewart

 http://www.douglas.co.uk
 Tel: 44 (0) 148-864-9090US toll-free 1-877-225-2034
 Regd. England 2177994, VAT Reg. GB 480 7371 36

Re: [ccp4bb] need proper suggestion

[Patrick Shaw Stewart]

Afshan

Radaev and Sun published a paper a few years ago showing that
crystallization conditions for complexes are strongly biased towards PEG
conditions (rather than e.g. high salt conditions).  The reference is below.

I would use microseeding into random screens [2], using the crystals that
you have as seed crystals.  Ideally you should find conditions where *both
the complex and the seed stock are stable*.  By coincidence we had a paper
accepted this week by Crystal Growth and Design on this exact topic, see
below.

Best wishes

Patrick

__

[1] Radaev, S; Sun, P.D. J. Appl. Crystallogr. 2002, 35, 674-676.

[2] D'Arcy, A.; Villard, F.; Marsh, M. Acta Crystallogr. 2007, D63, 550-554.

[3] Patrick D. Shaw Stewart , Stefan A. Kolek , Richard A. Briggs , Naomi E.
Chayen , and Peter Baldock
Cryst. Growth Des., Just Accepted Manuscript.  "Random microseeding: a
theoretical and practical exploration of seed stability and seeding
techniques for successful protein crystallization".
http://pubs.acs.org/doi/abs/10.1021/cg2001442




On Fri, May 27, 2011 at 1:24 PM, Afshan Begum  wrote:

> Dear All,
>
> I have a severe prob lam to performed my ligand binding study with
> corresponding protein. I have taking the native diffraction data at 1.75 A
> and after that i have performed soaking as well co-crystallization
> experiment with my inhibitors.
> Problem is that at the active site phosphate ion always bind instead of
> inhibitors. I have  used 1.6 M ammonium phosphate conc at the
> crystallization recipe which is a very weak inhibitor of my protein whereas
> the ligand is already clinically applicable but due to the very high conc.
> of phosphate i have not achieved my target. If some one can suggest me what
> else i can replace with ammonium phosphate or any other suggestions would be
> appreciated.
>
> I have tried to grown crystals some other condition but the crystal was not
> diffracted beyond 3.5 A.
>
> Best Regards
>
> AFSHAN
>



-- 
 patr...@douglas.co.ukDouglas Instruments Ltd.
 DouglasHouse, EastGarston, Hungerford, Berkshire, RG177HD, UK
 Directors: Peter Baldock, Patrick Shaw Stewart

 http://www.douglas.co.uk
 Tel: 44 (0) 148-864-9090US toll-free 1-877-225-2034
 Regd. England 2177994, VAT Reg. GB 480 7371 36

Re: [ccp4bb] small lysozyme crystals?

[Patrick Shaw Stewart]

James

One thing you should be aware of is that bugs growing in the lysozyme
stock solution can have a dramatic effect on the number and size of
crystals.

(Way, way) back in 1993 when I was in David Blow's lab we noticed an
"ageing" effect with the lysozyme stock solution; if we dissolved
freeze-dried lysozyme and set up experiments immediately we got a few
large crystals.  If, however, we did exactly the same thing except
that we kept the lysozyme protein stock overnight in an Eppendorf tube
(using a certain batch of tubes), then set up experiments the next
morning, we grew dozens of small crystals.

The effect seemed to be caused by fungi that were growing in the tubes
because fungicides eliminated the effect whereas antibiotics didn't,
see below.

I have often wondered whether people designing e.g. microgravity
experiments that are stored for several days before launching are
aware of this!

Best wishes

Patrick


See http://www.ncbi.nlm.nih.gov/pmc/articles/PMC2142306/

Abstract
This work investigates the influence of storage of lysozyme in
solution on its crystallization. The crystallization of hen egg-white
lysozyme exhibits a storage effect (aging) that depends on the length
of time the lysozyme solution is stored, after dissolving from
freeze-dried powder, before being brought to crystallization
conditions. The number of crystals obtained increases, while their
size decreases, as the solution ages. Observations suggest that this
effect is due to the presence of fungi that multiply in the stored
protein solution. This aging effect was used to control nucleation and
determine the number and size of lysozyme crystals to be formed in a
given sample.

Summary of results
1. Under the particular conditionosf these experiments,
growth of lysozyme crystals depends on thep resence
of a nucleating agent.

2. Aging of lysozyme in solution gives rise to enhanced
nucleation.

3. The aging effect is independent of the source of the
lysozyme powder.

4. Filtration or centrifugation prior to aging does not
eliminate the aging but lessens the number of crystals
grown.

5. The agent responsible for the enhanced nucleation
can be removed by centrifugation or filtration even
after aging has occurred.

6. Desalting increases aging.

7. Aging is prevented by antifungal agents but is not
affected by either class of antibiotics.

8. Aging is eliminated when a filtered solution is stored
in a sterile vial.

9. Nucleation (and consequently the number of crystals
grown) can be controlled by altering the ratio
of freshly filtered and aged protein solution just
prior to crystallization.

On Tue, Jul 26, 2011 at 6:56 PM, James Holton  wrote:
> Does anyone out there have a protocol of growing HEWL crystals that are
> all 50-100 microns wide?  I gave this project to a summer student
> recently, thinking it would be easy, but it is turning out to be more
> difficult than I thought.  Keep getting sphereulites instead of small
> crystals.  Yes, I know you can smash a large lysozyme crystal with a
> hammer, but that is not exactly what I was going for.  What I was hoping
> for was a well-defined protocol for growing "reference" crystals that
> stay evenly illuminated in our x-ray beams as they rotate.  The beam is
> 100 um wide.
>
> I'm sure someone has done this before?
>
> -James Holton
> MAD Scientist
>



-- 
 patr...@douglas.co.uk    Douglas Instruments Ltd.
 DouglasHouse, EastGarston, Hungerford, Berkshire, RG177HD, UK
 Directors: Peter Baldock, Patrick Shaw Stewart

 http://www.douglas.co.uk
 Tel: 44 (0) 148-864-9090    US toll-free 1-877-225-2034
 Regd. England 2177994, VAT Reg. GB 480 7371 36

Re: [ccp4bb] Fab:antigen complex crystallization!!!

[Patrick Shaw Stewart]

Hi Ivan

Did you use microseeding with *random *solutions?

If not see the following paper by Obmolova and Co about exactly this,
microseeding with Fab complexes,
http://journals.iucr.org/d/issues/2010/08/00/bw5361/bw5361.pdf

For more subtle variations in using microseeding with complexes see
http://pubs.acs.org/doi/abs/10.1021/cg2001442

Good luck

Patrick



On Thu, Jul 28, 2011 at 4:41 AM, xaravich ivan 
wrote:
> Hi everyone,
> I have been trying to crystallize Fab:antigen complex( 50kda:90kDa)
complex
> and initially got needle clusters which after microseeding gave me single
> crystals but they are very small and I could not repeat the results. I
have
> been using HEPES buffer at pH 6.8 to do the final SEC purification step of
> the complex before setting trays.
> I was wondering whether there are some other buffers (that one could
suggest
> eg tris-hcl etc) which have given decent positive results when
crystallizing
> Fab complexes.Though I have gone through individual papers (case by case)
to
> get some idea, It would be great if anyone could direct me to a
> comprehensive literature towards studying the crystatllization conditions
of
> Fab complexes.
>  Equally, people who have considerable experience could suggest a list of
> must do steps for such problems which have routinely been practiced in
their
> lab
>
> Also what is a good storage condition for the excess complex that you want
> to use later?
> I would really appreciate any suggestion,help, direction.
> Thanks
> ivan



-- 
 patr...@douglas.co.ukDouglas Instruments Ltd.
 DouglasHouse, EastGarston, Hungerford, Berkshire, RG177HD, UK
 Directors: Peter Baldock, Patrick Shaw Stewart

 http://www.douglas.co.uk
 Tel: 44 (0) 148-864-9090US toll-free 1-877-225-2034
 Regd. England 2177994, VAT Reg. GB 480 7371 36

Re: [ccp4bb] Fab:antigen complex crystallization!!!

[Patrick Shaw Stewart]

Ed (and Ivan)

Peter Sun and colleagues published two papers where they show that
crystallization conditions for protein-protein complexes are strongly
biased towards PEG-based rather than high-salt or
organic-solvent-based conditions. This includes antibody-antigen
complexes.

http://www.ncbi.nlm.nih.gov/pubmed/16699187
http://scripts.iucr.org/cgi-bin/paper?do0016

I have heard anecdotally that the same is true of protein-peptide and
protein-small molecule complexes, although I don't know of any
systematic study.

Can anyone shed light on this?

I guess we can look in the Marseilles database

Best wishes to all

Patrick



On Thu, Jul 28, 2011 at 2:32 PM, Ed Pozharski  wrote:
>
> On Thu, 2011-07-28 at 05:07 +0100, Sean Seaver wrote:
> > Spoiler - Fabs like ammonium sulfate.
>
> Not really - in my hands the ammonium sulfate was one hit out of 7.
>
> While Ivan's question is about Fab complexes with protein antigen, I
> think it brings up a more general question of protein class-dependent
> crystallization bias.  While some general trends exist for classes of
> biopolymers (e.g. MPD is number one precipitant for DNA; protein:DNA
> complexes tend to crystallize in PEG-based conditions), a general idea
> of assigning a preferred precipitant to a protein class is, imho,
> pointless.  Fabs are a good example - one would think that with half of
> the protein more or less the same in all instances some general trends
> should exist.  And perhaps they do, as this
>
> http://scripts.iucr.org/cgi-bin/paper?S0907444999016224
>
> seems to suggest.  But alas, Fab crystallization conditions, once you
> look into it, appear to be just as diverse as the same for proteins in
> general.  Crystallization conditions may change radically upon point
> mutation, so why would one expect that a class of proteins sharing some
> 50% identity will show unusual love for PEG, ammonium sulfate, sodium
> malonate or any other "miracle precipitant"?
>
> Consider this.  Thanks to great engineering at the Douglas Instruments,
> we can routinely set up ~1000 drops for a given protein.  If one of them
> shows a crystalline shower, we celebrate.  To me, the fact that we try
> wrong crystallization conditions 99.9% of the time, proves that any
> attempt to predict crystallization conditions beyond vague things like
> "keep pH close to protein pI", "sodium malonate is cool", "PEG and
> ammonium sulfate are two most successful precipitants in history of
> protein crystallography", etc., is futile.  Time wasted on looking into
> what is the most common precipitant for a particular class of proteins
> is better spent on setting up more trays.
>
> Cheers,
>
> Ed.
>
> --
> Oh, suddenly throwing a giraffe into a volcano to make water is crazy?
>         Julian, King of Lemurs



--
 patr...@douglas.co.uk    Douglas Instruments Ltd.
 DouglasHouse, EastGarston, Hungerford, Berkshire, RG177HD, UK
 Directors: Peter Baldock, Patrick Shaw Stewart

 http://www.douglas.co.uk
 Tel: 44 (0) 148-864-9090    US toll-free 1-877-225-2034
 Regd. England 2177994, VAT Reg. GB 480 7371 36

[ccp4bb] Vapor diffusion calculator

[Patrick Shaw Stewart]

Jacob and CCP4bb 

 

It's not exactly what you're looking for, but my colleague Peter Baldock
wrote a program called "VD to MB" a few years ago that does part of the
job.  It was a program to convert vapor diffusion crystallization
conditions into microbatch-under-oil conditions.

 

I tried it back then with several published and unpublished examples
where crystallization had been optimized in both vapor diffusion and
microbatch.  I was originally sceptical, but it seemed to work
remarkably well, generally getting the numbers right to within 5 or 10%.

 

The program uses a parameter called "1/e equilibration time for 1M salt
(days)".  I originally used a value of 1, but I think we changed it to
0.5 for 96-well plates.  Obviously the value will depend on the geometry
of the plates.  Does anyone have any practical information about
equilibration times?

 

Different salts have very different effects on vapor pressure.  I found
a list in an old "Rubber Book" (CRC Handbook of Physics and Chemistry)
part of which I have pasted below.  I tried quite hard to make sense of
this list - hoping that it would also shed light on the
protein-precipitating effect of salts - but concluded that the numbers
are pretty random apart from obvious valence effects.  (Someone here may
be able to explain them, though!)

 

You can download the program from http://www.douglas.co.uk/tipsntech.htm
near the middle of the page.  There's also an equivalent Excel
spreadsheet for playing around with.

 

See also http://www.douglas.co.uk/convert.htm for some (very old but
still valid!) examples and comments.

 

Also bear in mind that - with many proteins - roughly half of the
protein is lost on the surface of VD drops for 100 + 100 nl drops.

 

 

Peter also wrote an algorithm - now in our optimization software - that
calculates the pH of a solution with any number of buffers in it, where
the buffers can be at different concentrations too.  A sort of super
Henderson-Hasselbalch.  If anyone is interested I'm sure Peter could
show you the maths or pass on the code (it took him about a month of
lunch-breaks!)

 

Best wishes

 

Patrick

 

_

 

Reduction of vapor pressure in mmHg due to the presence of 1M salt at
100C

(at which temperature the vapor pressure of water is 760 mmHg)

>From Handbook of Physics and Chemistry, 76th Ed


CdSO4

8.9

ZnSO4

10.4

MnSO4

10.5

FeSO4

10.7

MgSO4

12

CdI2

14.8

CdBr2

17.8

ZnCl2

18.7

CdCl2

18.8

KNO3

21.1

NH4NO3

22

NaNO3

22.5

NH4Cl

23.7

NH4Br

23.9

NH42SO4

24

KCl

24.4

Na2SO4

25

NaCl

25.2

KI

25.3

LiCl

25.5

LiNO3

25.9

NaBr

25.9

LiBr

26.2

BaNO32

27

Li2SO4

28.1

LiI

28.6

K2CrO4

29.5

Na3PO4

30

Li2CrO4

32.6

MnCl2

34

CaNO32

34.8

CoCl2

34.8

Al2S043

36.5

BaCl2

36.7

NiCl2

37

NiNO32

37.3

BaBr2

38.8

MgCl2

39

CaCl2

39.8

MgNO32

42

MgBr2

44

CaBr2

44.2

AlCl3

61


StDev

10.7

Av

27.7

CV

0.4



 

 

 

 

 

--

For information and discussion about protein crystallization and
automation, please join 

our bulletin board at
http://groups-beta.google.com/group/oryx_group?hl=en

 

 patr...@douglas.co.ukDouglas Instruments Ltd.

 DouglasHouse, EastGarston, Hungerford, Berkshire, RG177HD, UK

 Directors: Peter Baldock, Patrick Shaw Stewart

 http://www.douglas.co.uk/

 Tel: 44 (0) 148-864-9090US toll-free 1-877-225-2034

 Regd. England 2177994, VAT Reg. GB 480 7371 36

 

> -Original Message-

> From: CCP4 bulletin board [mailto:ccp...@jiscmail.ac.uk] On Behalf Of

> Jacob Keller

> Sent: 02 February 2010 22:34

> To: CCP4BB@JISCMAIL.AC.UK

> Subject: [ccp4bb] Vapor diffusion calculator

> 

> Dear Crystallographers,

> 

> Is anybody aware of a calculator for vapor diffusion experiments to

> plot

> concentrations of various solvent components as a function of time?
For

> a

> simple example, what happens when I mix a protein solution containing

> 50mM

> NaCl 1:1 with a reservoir containing 50% MPD but no salt? Where is the

> vapor

> diffusion equilibrium, and how does the drop composition change as a

> function of time? More complicated would be experiments involving

> volatile

> components other than water, as I think, for example, ethanol would

> almost

> instantly equilibrate, then the water diffusion would kick in over a

> longer

> time scale. Even more complicated would be pH-dependent volatilities

> such as

> acetate. I don't think this would be impossible to figure out, but it

> would

> be nice if there were a pre-existing tool/server to do such.

> 

> Regards,

> 

> Jacob Keller

> 

> 

> ***

> Jacob Pearson Keller

> Northwestern University

> Medical Scientist Training Program

> Dallos Laboratory

> F. Searle 1-240

> 2240 Campus Drive

> Evanston IL 60208

> lab: 847.491.2438

> cel: 773.608.9185

> email: j-kell...@northwestern.edu

> ***

Re: [ccp4bb] 24-well sitting-drop plates

[Patrick Shaw Stewart]

Jacob

There is the MRC Maxi, and also XtalQuest plate, both with 48 wells.
Less confusing for filling by hand than 96 wells


--
For information and discussion about protein crystallization and
automation, please join 
our bulletin board at
http://groups-beta.google.com/group/oryx_group?hl=en

 patr...@douglas.co.ukDouglas Instruments Ltd.
 DouglasHouse, EastGarston, Hungerford, Berkshire, RG177HD, UK
 Directors: Peter Baldock, Patrick Shaw Stewart
 http://www.douglas.co.uk/
 Tel: 44 (0) 148-864-9090US toll-free 1-877-225-2034
 Regd. England 2177994, VAT Reg. GB 480 7371 36

> -Original Message-
> From: CCP4 bulletin board [mailto:ccp...@jiscmail.ac.uk] On Behalf Of
> Jacob Keller
> Sent: 24 February 2010 00:02
> To: CCP4BB@JISCMAIL.AC.UK
> Subject: [ccp4bb] 24-well sitting-drop plates
> 
> Dear Crystallogrpahers,
> 
> what are the best 24-well sitting drop plates on the market? I have
> used the
> standard pilar-type ones from Hampton, but I would like to have the
> ability
> to set up a few drops per well, and also those plates have a lot of
> background polarization. Also, the reason I am looking for 24-well
> plates is
> that I would like to set them up by hand, and 96 wells seems like a
lot
> to
> do before sealing!
> 
> Best Regards,
> 
> Jacob Keller
> 
> ***
> Jacob Pearson Keller
> Northwestern University
> Medical Scientist Training Program
> Dallos Laboratory
> F. Searle 1-240
> 2240 Campus Drive
> Evanston IL 60208
> lab: 847.491.2438
> cel: 773.608.9185
> email: j-kell...@northwestern.edu
> ***

Re: [ccp4bb] 24-well sitting-drop plates

[Patrick Shaw Stewart]

We have had dozens of boxes of XtalQuest 42-2 plates sitting on the
shelf for three years and I've just been told we've only sold three
boxes so far

We'll accept any reasonable offers!


> -Original Message-
> From: CCP4 bulletin board [mailto:ccp...@jiscmail.ac.uk] On Behalf Of
> Patrick Shaw Stewart
> Sent: 25 February 2010 16:37
> To: CCP4BB@JISCMAIL.AC.UK
> Subject: Re: [ccp4bb] 24-well sitting-drop plates
> 
> Jacob
> 
> There is the MRC Maxi, and also XtalQuest plate, both with 48 wells.
> Less confusing for filling by hand than 96 wells
> 
> 
> --
> For information and discussion about protein crystallization and
> automation, please join
> our bulletin board at
> http://groups-beta.google.com/group/oryx_group?hl=en
> 
>  patr...@douglas.co.ukDouglas Instruments Ltd.
>  DouglasHouse, EastGarston, Hungerford, Berkshire, RG177HD, UK
>  Directors: Peter Baldock, Patrick Shaw Stewart
>  http://www.douglas.co.uk/
>  Tel: 44 (0) 148-864-9090US toll-free 1-877-225-2034
>  Regd. England 2177994, VAT Reg. GB 480 7371 36
> 
> > -Original Message-
> > From: CCP4 bulletin board [mailto:ccp...@jiscmail.ac.uk] On Behalf
Of
> > Jacob Keller
> > Sent: 24 February 2010 00:02
> > To: CCP4BB@JISCMAIL.AC.UK
> > Subject: [ccp4bb] 24-well sitting-drop plates
> >
> > Dear Crystallogrpahers,
> >
> > what are the best 24-well sitting drop plates on the market? I have
> > used the
> > standard pilar-type ones from Hampton, but I would like to have the
> > ability
> > to set up a few drops per well, and also those plates have a lot of
> > background polarization. Also, the reason I am looking for 24-well
> > plates is
> > that I would like to set them up by hand, and 96 wells seems like a
> lot
> > to
> > do before sealing!
> >
> > Best Regards,
> >
> > Jacob Keller
> >
> > ***
> > Jacob Pearson Keller
> > Northwestern University
> > Medical Scientist Training Program
> > Dallos Laboratory
> > F. Searle 1-240
> > 2240 Campus Drive
> > Evanston IL 60208
> > lab: 847.491.2438
> > cel: 773.608.9185
> > email: j-kell...@northwestern.edu
> > ***

Re: [ccp4bb] freezing crystals grown in isopropanol condition

[Patrick Shaw Stewart]

Chris

Isopropanol is said a very good precipitant but it's unpopular because it's
so difficult to harvest crystals

However there's a very convenient way to grow and harvest crystals in
isopropanol using Vapor Batch plates.

Basically you set up microbatch-under-oil drops containing all the
ingredients except for the isopropanol, and cover with Al's Oils (silicone
mixed with paraffin oil).  Then you put e.g. in your case 25% isopropanol in
the reservoir around the outside of the Vapor Batch plate.  Over a few hours
the isopropanol will diffuse through the Al's Oils into the drops.

The great advantage is that the oil also becomes saturated with isopropanol
(they are only partially miscible in fact) so that the oil acts as a barrier
when you're harvesting crystals.

You can usually convert vapor diffusion conditions to microbatch in a single
24-well experiment where you vary protein against precipitant.

You don't need to remove the oil to collect data.

This is all described in Lesley Haire's winning entry to a competition we
organized a few years ago: http://www.douglas.co.uk/winner1.htm

See also Mortuza et al. High-resolution structure of a retroviral capsid
hexameric amino-terminal domain.  Nature 431 (2004), pp 481-485.

The Vapor Batch plate can be seen at http://www.douglas.co.uk/vb.htm

If you or anyone on the b.b. would like to try some samples of Vapor Batch
plates just let me know

Best wishes

Patrick





On Fri, Apr 9, 2010 at 9:53 AM, Chris Meier <
crystallogra...@christophmeier.com> wrote:

> Dear all,
>
> I have a protein which crystallizes in 25% isopropanol, at pH4.5.
>
> Does anyone have experience freezing crystals grown in such a condition?
> What cryoprotectants should I try?
> Can isopropanol itself act as a cryoprotectant?
> Any suggestions on how to deal with isopropanol evaporation during
> mounting?
>
> Many thanks and best wishes,
> Chris
>
>
>



-- 
patr...@douglas.co.ukDouglas Instruments Ltd.
DouglasHouse, EastGarston, Hungerford, Berkshire, RG177HD, UK
Directors: Peter Baldock, Patrick Shaw Stewart

http://www.douglas.co.uk
Tel: 44 (0) 148-864-9090US toll-free 1-877-225-2034
Regd. England 2177994, VAT Reg. GB 480 7371 36

Re: [ccp4bb] control of nucleation

[Patrick Shaw Stewart]

Hi Zq Deng

 

No-one has mentioned microseeding into random screens, the so-called
Microseeding Matrix Screening (MMS) method , or just "matrix seeding".

 

This is exactly the kind of situation where the method works really
well.  You will very often get many new leads, as well as bigger
crystals. 

 

See the excellent paper by D'Arcy et al., Acta Cryst. (2007). D63,
550-554, and also the original paper of Ireton and Stoddard, Acta Cryst.
(2004). D60, 601-605.  See also the practical and theoretical comments
at http://www.douglas.co.uk/mms.htm

 

Best wishes

 

Patrick

 

 

--

For information and discussion about protein crystallization and
automation, please join 

our bulletin board at
http://groups-beta.google.com/group/oryx_group?hl=en

 

 patr...@douglas.co.ukDouglas Instruments Ltd.

 DouglasHouse, EastGarston, Hungerford, Berkshire, RG177HD, UK

 Directors: Peter Baldock, Patrick Shaw Stewart

 http://www.douglas.co.uk/

 Tel: 44 (0) 148-864-9090US toll-free 1-877-225-2034

 Regd. England 2177994, VAT Reg. GB 480 7371 36

 

From: CCP4 bulletin board [mailto:ccp...@jiscmail.ac.uk] On Behalf Of zq
deng
Sent: 06 May 2010 09:04
To: CCP4BB@JISCMAIL.AC.UK
Subject: [ccp4bb] control of nucleation

 

hello,everybody . due to excess nucleation,I often get many tiny
crystals instead of  few,large crystals.i wana optimize the condition,
does anyone have adivce about this?   

 

Best regards.

Re: [ccp4bb] Scaling up from an Intelliplate to Linbro Plate

[Patrick Shaw Stewart]

Hi Mo

 

What you need to remember is that a relatively large amount of protein
is lost from smaller drops.  The ratio of surface area to volume is
greater.  With 100 + 100 nl drops about half of the protein is lost,
either as skin on the drops or on the plastic of the plate.

 

So when you scale up you need to reduce the protein by about half.
(Another approach, suggested by Heather Ringrose, is to put extra
protein into the drops at the screening stage, e.g. 200 nl protein + 100
nl reservoir solution.  The hits found can usually be scaled up by
dispensing 1 + 1 microlitre drops.)

 

This is counterintuitive because people expect the small drops to dry
out more quickly - so they expect, if anything, to get more
precipitation in the small drops.  Instead they get precipitation when
they scale up, assuming they keep the ratio of protein to reservoir
constant.

 

 

It can also help, when you scale up, to increase the salt by 50 to 100%
- this is indicated by data mining but I'm not sure what the mechanism
is

 

Hope that's helpful

 

Patrick

 

 

--

For information and discussion about protein crystallization and
automation, please join 

our bulletin board at
http://groups-beta.google.com/group/oryx_group?hl=en

 

 patr...@douglas.co.ukDouglas Instruments Ltd.

 DouglasHouse, EastGarston, Hungerford, Berkshire, RG177HD, UK

 Directors: Peter Baldock, Patrick Shaw Stewart

 http://www.douglas.co.uk/

 Tel: 44 (0) 148-864-9090US toll-free 1-877-225-2034

 Regd. England 2177994, VAT Reg. GB 480 7371 36

 

From: CCP4 bulletin board [mailto:ccp...@jiscmail.ac.uk] On Behalf Of Mo
Wong
Sent: 18 August 2010 16:18
To: CCP4BB@JISCMAIL.AC.UK
Subject: [ccp4bb] Scaling up from an Intelliplate to Linbro Plate

 

Hi all,

I know scaling up from a hit found from a high throughput screen is an
empirical process, but does anyone have a good rule of thumb as a
starting point when it comes to scaling up from a hit observed in an
Intelliplate to a Linbro plate (i.e., change in volume ratios, amount to
add to reservoir, etc)? I've Googled around but haven't seen anything
which either suggests I shouldn't be asking this question, I've not
looked hard enough, or it really is a case of "try and see".

Thanks

Re: [ccp4bb] turn granular to crystal

[Patrick Shaw Stewart]

Rui

 

Assuming that they are protein, this is a perfect candidate for "MMS"
microseeding into random screens

 

You can do it with a robot or by hand

 

See D'Arcy et al. Acta Cryst. (2007). D63, 550 - 554.   'An automated
microseed matrix-screening method for protein crystallization'

 

A very good recent article is Obmolova et al. Acta Cryst. (2010). D66,
927-933 'Promoting crystallization of antibody-antigen

complexes via microseed matrix screening'

 

(See also our website at http://www.douglas.co.uk/mms.htm)

 

 

Yibin, what proteases do you use, what conc, how much do you add?

 

 

Patrick

 

 

 

 

 

--

For information and discussion about protein crystallization and
automation, please join 

our bulletin board at
http://groups-beta.google.com/group/oryx_group?hl=en

 

 patr...@douglas.co.ukDouglas Instruments Ltd.

 DouglasHouse, EastGarston, Hungerford, Berkshire, RG177HD, UK

 Directors: Peter Baldock, Patrick Shaw Stewart

 http://www.douglas.co.uk/

 Tel: 44 (0) 148-864-9090US toll-free 1-877-225-2034

 Regd. England 2177994, VAT Reg. GB 480 7371 36

 

From: CCP4 bulletin board [mailto:ccp...@jiscmail.ac.uk] On Behalf Of
rui
Sent: 25 August 2010 13:37
To: CCP4BB@JISCMAIL.AC.UK
Subject: [ccp4bb] turn granular to crystal

 

Hi, All,

I'm trying to crystallize a soluble protein and got something like
granular, they are rounded shaped and not so regular and also don't have
sharp edges. See the attached pic. The current condition is PEG4000 and
pH around 5. How can I improve this condition? Thanks a lot.

[ccp4bb] Fab purification and crystallization

[Patrick Shaw Stewart]

Again you should read the spectacular paper by Obmolova and co. where
they solved the structures of three Fab-antigen complexes using "MMS"
microseeding (seeding into random screens), starting with one hit
containing clusters of needles - which could not themselves be optimized

 

The paper is available on open access (free)

 

http://journals.iucr.org/d/issues/2010/08/00/issconts.html

http://journals.iucr.org/d/issues/2010/08/00/bw5361/bw5361.pdf

 

Acta Cryst. (2010). D66, 927-933  [ doi:10.1107/S0907444910026041
<http://dx.doi.org/10.1107/S0907444910026041>  ]


Promoting crystallization of antibody-antigen complexes via microseed
matrix screening


G. Obmolova
<http://scripts.iucr.org/cgi-bin/citedin?search_on=name&author_name=Obmo
lova%2C%20G%2E> , T. J. Malia
<http://scripts.iucr.org/cgi-bin/citedin?search_on=name&author_name=Mali
a%2C%20T%2EJ%2E> , A. Teplyakov
<http://scripts.iucr.org/cgi-bin/citedin?search_on=name&author_name=Tepl
yakov%2C%20A%2E> , R. Sweet
<http://scripts.iucr.org/cgi-bin/citedin?search_on=name&author_name=Swee
t%2C%20R%2E>  and G. L. Gilliland
<http://scripts.iucr.org/cgi-bin/citedin?search_on=name&author_name=Gill
iland%2C%20G%2EL%2E> 


Synopsis: The application of microseed matrix screening to the
crystallization of related antibodies in complex with IL-13 is
described. Both self-seeding or cross-seeding helped promote nucleation
and increase the hit rate.

Online 14 July 2010

The application of microseed matrix screening to the crystallization

of antibody-antigen complexes is described for a set

of antibodies that include mouse anti-IL-13 antibody C836, its

humanized version H2L6 and an affinity-matured variant of

H2L6, M1295. The Fab fragments of these antibodies were

crystallized in complex with the antigen human IL-13. The

initial crystallization screening for each of the three complexes

included 192 conditions. Only one hit was observed for H2L6

and none were observed for the other two complexes. Matrix

self-microseeding using these microcrystals yielded multiple

hits under various conditions that were further optimized to

grow diffraction-quality H2L6 crystals. The same H2L6 seeds

were also successfully used to promote crystallization of the

other two complexes. The M1295 crystals appeared to be

isomorphous to those of H2L6, whereas the C836 crystals were

in a different crystal form. These results are consistent with the

concept that the conditions that are best for crystal growth

may be different from those that favor nucleation. Microseed

matrix screening using either a self-seeding or cross-seeding

approach proved to be a fast, robust and reliable method not

only for the refinement of crystallization conditions but also to

promote crystal nucleation and increase the hit rate.

 

 

 

--

For information and discussion about protein crystallization and
automation, please join 

our bulletin board at
http://groups-beta.google.com/group/oryx_group?hl=en

 

 patr...@douglas.co.ukDouglas Instruments Ltd.

 DouglasHouse, EastGarston, Hungerford, Berkshire, RG177HD, UK

 Directors: Peter Baldock, Patrick Shaw Stewart

 http://www.douglas.co.uk/

 Tel: 44 (0) 148-864-9090US toll-free 1-877-225-2034

 Regd. England 2177994, VAT Reg. GB 480 7371 36

 

From: CCP4 bulletin board [mailto:ccp...@jiscmail.ac.uk] On Behalf Of
xaravich ivan
Sent: 10 September 2010 04:00
To: CCP4BB@JISCMAIL.AC.UK
Subject: [ccp4bb] Fab purification and crystallization

 

Hi CCP4bb,

I have two questions regarding Fab purification and Fab-antigen complex
crystallization and would really appreciate any input from the
experienced board.

1) I have got some hits for Fab-antigen complex (150 kD) but they are
all needle clusters. Whatever fine screen I formulate, it always gives
me these needle clusters. Are there some better common ways to change
needles to single crystals?

2) I have certain IgGs from which I purify the Fab by papain digestion
(resin from ThermoSci). One of the first steps is to dialyze the IgG
with the digestion buffer,( 20mM Na-phosphate and 10mM EDTA pH 7.0) Over
night. I always get 30-60% of the IgG precipitated during this overnight
dialysis. I tried to increase the salt by adding 200mM NaCl but of no
effect. Have anyone experienced such problem? Is there any thing that
could be tried to stop this precipitation.

thanks in advance.

ivan

Re: [ccp4bb] crystal friendly solvents that are useful for dissolving hydrophobic small molecules?

[Patrick Shaw Stewart]

 

I've just remembered another approach that I've heard suggested,
although I don't know anyone who has tried it.

 

Dissolve plenty of the small molecule in paraffin or silicone oil, and
use this mixture to cover the drop.  This can be used with regular vapor
diffusion or (probably better) microbatch-under-oil.  The oil acts as a
reservoir that contains excess small molecule that (you hope) will be
fed into the crystals.

 

Patrick Shaw Stewart

 

--  
[EMAIL PROTECTED]Douglas Instruments Ltd.  
DouglasHouse, EastGarston, Hungerford, Berkshire, RG177HD, UK 
Directors: Peter Baldock, Patrick Shaw Stewart, James Smith 
http://douglas.co.uk <http://douglas.co.uk/>  or
http://www.douglasinstruments.com <http://www.douglasinstruments.com/>  
Tel: 44 (0) 148-864-9090US toll-free 1-877-225-2034 
Regd. England 2177994, VAT Reg. GB 480 7371 36

 



From: CCP4 bulletin board [mailto:[EMAIL PROTECTED] On Behalf Of
Green, Todd
Sent: 22 January 2007 20:40
To: CCP4BB@JISCMAIL.AC.UK
Subject: crystal friendly solvents that are useful for dissolving
hydrophobic small molecules?

 

Hello All,

I am trying to soak some crystals with a small molecule that is quite
hydrophobic. I am having trouble with solubilty of the small molecule.
It will dissolve up to about 1 mM in 100 % DMSO, but precipitates at
concentrations of less than 15 micromolar when the DMSO concentration is
below 20 percent in my crystal growth solutions(which are peg 4k, low
pH, low salt). Can anyone suggest solvents other than DMSO which might
help dissolve the inhibitor and might be somewhat friendly to my
crystals.

Thanks in advance-
Todd Green 

Re: [ccp4bb] Question about glove boxes for protein crystallization

[Patrick Shaw Stewart]

Hi Mathews

One of our customers, Bret Dillard at the University of Georgia, has
had great success with one of our robots in a Bactron X anaerobic
chamber.

In this case, Bret mainly used the microbatch-under-oil method, which
works very well for anaerobic work:  (1) the oil protects the sample
and reduces exposure to oxygen, (2) the amount of work is far less
because you can keep several degassed screens in the chamber to use
many times with different protein samples.  With vapor diffusion you
will have to degass the solutions every for every few samples (if not
every sample).

Bret won our competition for this work last year.  You can find his report at
http://www.douglas.co.uk/news.htm, plus more info below

Patrick



_

Douglas Instruments has announced the winner of the second round of
its competition for the best new crystallization technique.
Congratulations to Bret Dillard from the University of Georgia, for
his winning entry, "Automatic Protein Crystallization in an Anaerobic
Environment."

Bret placed an Oryx1-6 robot in a Bactron X anaerobic chamber, and
used mainly microbatch-under-oil crystallization to crystallize four
proteins that are not stable in an environment with oxygen.  He found
that microbatch avoided the need for frequent degassing of solutions
which reduced the work-load enormously.  The oil also provided extra
protection from oxidation.

One of the proteins crystallized is rubrerythrin from the
hyperthermophilic archaeon, Pyrococcus furiosus.  The native protein
contains iron, but is unstable in oxygen.  A previously-reported
structure was determined in the presence of oxygen, but the iron had
been replaced by zinc.  Using the anaerobic system, Bret has now
obtained the native form containing iron.

_



On 2/23/07, Mathews, Irimpan <[EMAIL PROTECTED]> wrote:



Dear Friends,

Sorry for the non CCP4 question. We are planning to purchase a small glove
box to setup crystallization trays under anaerobic conditions. If you have
used glove boxes for crystallization, would you please give me some idea?

We are thinking of getting the 815 series from Plas-labs (link below).

http://www.plas-labs.com/

Thank you very much,
Mathews

Ps: If others are interested, I will post a summary.

Re: [ccp4bb] Main topic of the day: Protein crystallization

[Patrick Shaw Stewart]

Ronaldo

I have a database of crystallization conditions extracted from the
PDB.  I was able to parse the data to extract the concentration of
protein in around 900 cases.

The lowest 9 protein concentrations were as follows:

PDB ID  TYPEDATEProtein conc, mg/ml 
1EYMISOMERASE.  07/05/2000  0.75
1ADQCOMPLEX (IMMUNOGLOBULIN/AUTOANTIGEN)18/02/1997  1   
1W5GFOUR HELIX BUNDLE.  06/08/2004  1   
1UU4HYDROLASE.  15/12/2003  1   
1W2UHYDROLASE.  08/07/2004  1   
1DXPSERINE PROTEASE.13/01/2000  1   
1DY8SERINE PROTEASE.18/01/2000  1   
1DY9SERINE PROTEASE.31/01/2000  1   
1DG6APOPTOSIS.  23/11/1999  1.2 

The maximum protein conc was 200 mg/ml (1BLF)

My database goes up to October 2004.  Janet Newman and Tom Peat have
done this job far more conscientiously and could probably give you
better and more up-to-date data.

Patrick


On 2/23/07, Ronaldo Alves Pinto Nagem <[EMAIL PROTECTED]> wrote:



Dear all,

As protein crystallization is the main topic of the day may I include
another question?

What was the minimun protein concentration reported with success in
crystallization trials?

I ask that because the protein I am trying to crystallize is much less
soluble than the one mentioned in the lasts emails.

Thanks

Ronaldo.

[ccp4bb] Demonstration and support specialist

[Patrick Shaw Stewart]

Douglas Instruments is seeking a motivated individual with practical
aptitude to demonstrate and support its automatic crystallization
systems in Europe and/or N America.  Knowledge of macromolecular
crystallization will be an advantage, scientific (or engineering)
experience essential.  No "salesmen" please.

Please reply to the address below, or e-mail.

Patrick Shaw Stewart


--  
[EMAIL PROTECTED] Douglas Instruments Ltd.  
DouglasHouse, EastGarston, Hungerford, Berkshire, RG177HD, UK 
Directors: Peter Baldock, Patrick Shaw Stewart, James Smith 
http://douglas.co.uk or http://www.douglasinstruments.com 
Tel: 44 (0) 148-864-9090    US toll-free 1-877-225-2034 
Regd. England 2177994, VAT Reg. GB 480 7371 36

Re: [ccp4bb] Help with reducing crystal mosaicity

[Patrick Shaw Stewart]

Just a thought, Mary - going back to your original question about MPD.  I 
extracted the crystallization conditions from REMARK 280 of 3939 PDB entries a 
couple of years ago.  The average concentration of the MPD used was high - 
38.6%, while PEGs tended to be used at lower concs, e.g. PEG400 25.7%.  You can 
see the data at www.douglas.co.uk/top14.htm 

I thought this information could be useful if you want to replace some of the 
MPD with another precipitant (or cryoprotectant).

Best wishes

Patrick Shaw Stewart


--  
[EMAIL PROTECTED] Douglas Instruments Ltd.  
DouglasHouse, EastGarston, Hungerford, Berkshire, RG177HD, UK 
Directors: Peter Baldock, Patrick Shaw Stewart, James Smith 
http://douglas.co.uk or http://www.douglasinstruments.com 
Tel: 44 (0) 148-864-9090    US toll-free 1-877-225-2034 
Regd. England 2177994, VAT Reg. GB 480 7371 36


> -Original Message-
> From: CCP4 bulletin board [mailto:[EMAIL PROTECTED] On Behalf Of Mary
> Fitzgerald
> Sent: 09 July 2007 23:05
> To: CCP4BB@JISCMAIL.AC.UK
> Subject: [ccp4bb] Help with reducing crystal mosaicity
> 
> Help please!
> 
> I'm looking for some new ideas.  I have crystals that come out of a
> sitting drop with a mixture of sodium cacodylate at pH 6.5, magnesium
> acetate and MPD for the well solution.  The MPD concentration is
> sufficient to act as a cryoprotectant.  Currently, I directly freeze
> these crystals in liquid nitrogen.  When I collect data, I typically
> have high anisotropic mosaicity; it ranges from 0.8 to 1.2.  This is
> further complicated with a weakly diffracting crystal (4-5 A) that has
> a long unit cell axis of ~500 and often twinning.
> 
> It has been suggested to me that the cryoprotectent is a problem.  I
> haven't checked the diffraction at room temperature, yet.  Please no
> suggestions of finding a different crystal form as that's not a
> consideration at the moment.  I have my reasons.  I did find one
> crystal that has lower mosaicity (0.5 to 0.8) but had weaker
> diffraction then the typical crystal.  Attempts at flash cryoannealing
> have not helped.
> 
> So, what's a good way to change the cryoprotectant if the
> cryoprotectant is the precipitant?  I've considered trying dehydration
> but wasn't certain if that would help with the mosaicity.
> 
> Thanks for any ideas,
> 
> Mary X. Fitzgerald
> Postdoctoral Associate

Re: [ccp4bb] Off Topic:crystallization in the presence of glycerol

[Patrick Shaw Stewart]

Rob,

A couple of years ago my colleague and I "mined" the crystallization
data in REMARK 280 from 3939 entries in the PDB.  In 109 entries,
glycerol came out as the ingredient with the highest concentration
that was measured with a % (percent) sign i.e. including '%', '%W/V',
'%V/V' etc.

The average concentration of these 109 entries was 15.5%

Many of these appeared to be "salting in" conditions.

So 10% glycerol should be no problem - it may be close to the overall
average (which we don't know).

Patrick



On 8/25/07, Rob Gruninger <[EMAIL PROTECTED]> wrote:
>
>
>
> Dear All,
>  I am working with a protein that requires 10% glycerol throughout the
>  purification to keep it soluble. I have been very worried that having
>  glycerol in my protein solution when I am trying to crystallize it will
>  prevent me from obtaining crystals. I am curious to see if others have
>  successfully obtained crystals of proteins that required glycerol to keep
>  them soluble and if so what concentration of glycerol could you use?
>  Should I be concerned about this or am I worrying too much?
>  Thanks for your input
>  Rob
>
>  --
>  Robert J.Gruninger B.Sc.
>  PhD Student
>  Department of Chemistry & Biochemistry
>  University of Lethbridge, 4401 University Dr.
>  Lethbridge, AB, Canada, T1K 3M4
>  Phone:(403)329-2746
>  Fax:(403)329-2057
>

Re: [ccp4bb] crystallization robot

[Patrick Shaw Stewart]

Madhavi

Although the Douglas robots are generally cheaper, we think they beat
all other robots in several areas:
1.  All of the Oryx systems waste virtually no protein - you would set
up a (100 + 100 nl) sitting drop plate with only 9.8 microlitres of
protein

2.  They are very versatile: simply by choosing a different icon/script
you can set up a microseeding "MMS", additive experiment, or grid (e.g.
additive etc. vs protein conc.)

3.  You can do large (2 + 2) drops as well as small.  This is very
important for crystal harvesting etc.

The robots don't dispense the reservoirs, but they can do optimization
of the drops.

Best wishes

Patrick



--
 [EMAIL PROTECTED]Douglas Instruments Ltd.
 DouglasHouse, EastGarston, Hungerford, Berkshire, RG177HD, UK
 Directors: Peter Baldock, Patrick Shaw Stewart, James Smith
 http://douglas.co.uk or http://www.douglas.co.uk
 Tel: 44 (0) 148-864-9090US toll-free 1-877-225-2034
 Regd. England 2177994, VAT Reg. GB 480 7371 36

> -Original Message-
> From: CCP4 bulletin board [mailto:[EMAIL PROTECTED] On Behalf Of
> Nalam, Madhavi
> Sent: 09 January 2008 14:57
> To: CCP4BB@JISCMAIL.AC.UK
> Subject: [ccp4bb] crystallization robot
> 
> Hi,
> Sorry for the non-ccp4 related question.
> We are planning to buy a crystallization robot. We looked at the
> 'Mosquito'. We felt it is good for setting 96 well plates (for
> screening
> the conditions). Though they say that we can use it for 24 well plates
> (hanging drop) it didn't seem to be ideal because all it does is set
> the
> drops and everything else has to be done manually.
> Can anyone suggest us other crystallization robots out in the market
> that are good?
> Thanks in advance,
> Regards,
> Madhavi

[ccp4bb] Fwd: [ccp4bb] crystallisation robot

[Patrick Shaw Stewart]

One thing that people often overlook is that quite a lot of protein
can be lost by denaturation on the surface of the drop.  This is more
significant for smaller drops.  Two suggestions: (1) increase the
proportion of protein in the - technical term - teeny drop to say two
thirds and (2) cover the drops with oil eg Al's oils
(silicone/paraffin).  You still get vapor diffusion though the oil ,
and you'd like to slow up equilibration.  of course (2) slows up the
robotics a little, but both should be trivial to set up..

On 1/17/08, Oganesyan, Vaheh <[EMAIL PROTECTED]> wrote:
>
>
>
>
> Mark,
>
>
>
> What was the state of the larger drops when tiny counterparts had crystals?
> My guess - they all precipitated.
>
> I'm trying to understand why some proteins or some conditions require change
> in protein concentration while others do not when migrating from smaller
> drops to larger ones. If it is protein dependent then I'm afraid there might
> be no one answer; if it is not then there should be a trend and explanation
> of phenomena.
>
>
>
>
>
>
> Vaheh
>
>  
>
>
> From: CCP4 bulletin board [mailto:[EMAIL PROTECTED] On Behalf Of
> [EMAIL PROTECTED]
>  Sent: Wednesday, January 16, 2008 8:31 PM
>  To: CCP4BB@JISCMAIL.AC.UK
>  Subject: Re: [ccp4bb] crystallisation robot
>
>
>
>
>
> Once upon a time I worked in a group that was interested in developing
> crystallization in microfluidics. This was before the time that Fluidigm
> existed and we had not heard of crystallization with the aid of
> microfluidics at the time. We had good reason to try to make a system that
> was as small and light as possible - it had something to do with the cost of
> shipping proteins and precipitants - less was better. And we also wanted all
> protein drops to be fully enclosed, out of safety considerations.
>
>  Like Tassos, we were very worried what would happen if you scaled back
> drops along the lines of this discussion - several uL downto tens of
> nanoliters. If the stochastic process had a major influence over this
> process, we thought that we would never get any crystals. So we set up
> side-by-side experiments at larger volumes and smaller volumes - basically
> scanning several orders of magnitude - expecting a decrease of the number of
> crystals when volumes decrease. To our great surprise the outcome was that
> smaller volumes almost always gave MORE (I almost want to say 'dramatically
> more') crystals, more nucleation, and indeed in various cases the crystals
> grew much faster also. Indeed, it was trivial to observe that the
> surface-to-volume ratio was the primary driver for the nucleation process.
> We had control over geometry to some extent and were able to observe
> surfaces while crystals grow. The crystals would most commonly nucleate on a
> surface.
>
>  So although there probably is something to stochastic aspects, it is clear
> that other aspects can be more important and "overrule" the stochastic
> considerations.
>  The somewhat unpleasant consquence is of course that results acquired in
> very small volumes (with larger surface-to-volume ratio) cannot necessarily
> be repeated in larger volumes (smaller surface-to-volume ratio).
>
>  This is not a flame, even if heat might be a good thing on a night with
> temperatures predicted far below 0F.
>
>   :-)
>
>  Mark
>
>
>
>
>
>
>
> -Original Message-
>  From: Anastassis Perrakis <[EMAIL PROTECTED]>
>  To: CCP4BB@JISCMAIL.AC.UK
>  Sent: Wed, 16 Jan 2008 6:17 am
>  Subject: Re: [ccp4bb] crystallisation robot
>
>
> > Oryxnano 50+50 nL
>  >
>  > Demetres
>  >
>
>  Which, indirectly, brings up an interesting (but not relevant to the Oryx)
> question.
>
>  Nucleation is a process that does have a stochastic aspect.
>
>  Thus, one could argue that compromising to 200-300 nl might be better than
> either extremes of 50nl (too small volume and less chance for nucleation) or
> 1000 nl (too much sample).
>
>  any comments ? (let the flames begin).
>
>  A.
>
>  PS1
>  another interesting issue that has has been hardly touched in these emails
> is the real sample loss: left in wells and not easy to recover, lost because
> of contamination with system liquid, etc ...
>

>  PS2
>  I see lots of people with new robots. please do have a look at the
> www.BIOXHIT.org page and if you have a few minutes to assemble a table we
> will be happy to add your specs to our pages. it can be a nice resource and
> it has already enough things and already one response to my last email ;-)
> To make life easier to potential contributors we can provide an Excel sheet
> to fill up with your specs - just ask.
>
>  On Jan 16, 2008, at 12:46, Demetres D. Leonidas wrote:
>
>  >
>  > David Briggs wrote:
>  >> I'll defend the honour of the phoenix... (again)
>  >>
>  >> Bernhard Rupp 100+100 nl
>  >> Dave Briggs (and all users at Univ of Manchester, UK) 100+100nl
>  >> Others..
>  >>
>  >> Only time we have ANY problems is when the nano dispensing tip >> gets

Re: [ccp4bb] isopropanol as a precipitant

[Patrick Shaw Stewart]

Shivesh

 

It's often very difficult to harvest crystals from conditions that
contain isopropanol because the alcohol is volatile - especially with
50% or over!

 

A solution that has worked several times  it so use the Vapor Batch
plates.  http://www.douglas.co.uk/vb.htm

 

You can cover the drops with oil, and then put isopropanol solution into
the "moat" of the plate.  The alcohol diffuses through the oil into the
drops, while the oil acts as a buffer, reducing loss of alcohol during
harvesting and freezing.

 

For a case study see http://www.douglas.co.uk/winner1.htm

 

Please let me know if anyone wants samples.

 

Patrick

 

 

--

 [EMAIL PROTECTED]Douglas Instruments Ltd.

 DouglasHouse, EastGarston, Hungerford, Berkshire, RG177HD, UK

 Directors: Peter Baldock, Patrick Shaw Stewart, James Smith

 http://www.douglas.co.uk/

 Tel: 44 (0) 148-864-9090US toll-free 1-877-225-2034

 Regd. England 2177994, VAT Reg. GB 480 7371 36

 

From: CCP4 bulletin board [mailto:[EMAIL PROTECTED] On Behalf Of
shivesh kumar
Sent: 05 March 2008 07:23
To: CCP4BB@JISCMAIL.AC.UK
Subject: [ccp4bb] isopropanol as a precipitant

 

Dear all
Sorry for non-CCP4 query.
I have crystallized a 7kDa protein in 50-60% of isopropanol,pH
4.0-4.6.The interesting thing is that the xtal appears within 5 hrs at
16 degree.
The protein conc is 5mg/ml and drop size is 3+1 with mother liquor 300
micro lt.Numerous xtals appears and but small is size.Do anyone can
share their experience with Isopropanol as a precipitant and to improve
the xtal quality with other precipitants.All suggestions are welcome.
Thanx in advance.
Shivesh 

[ccp4bb] crystallisation robot

[Patrick Shaw Stewart]

Joe

 

The Oryx robots take about 8 minutes to dispense 96 wells, plus about a
minute to pick up protein etc.  Evaporation is not an issue even for 100
+ 100 nl drops, because there's an evaporation shield.

 

This can include microseeding into screens (the D'Arcy "MMS" method) -
which we now regard as an absolutely essential facility.  Many robots
can't do this because the tips get clogged.

 

It can also include a simple 2-d optimization grid.

 

Setup is very simple because you only have to put the protein (and seed
stock) into one well.

 

Experiments with three drops per reservoir take about 14 minutes.

 

Additive experiments take longer - the tip has further to go.

 

Patrick

 

 

http://www.douglas.co.uk/mms.htm

http://www.douglas.co.uk/products.htm

 

 

--

 [EMAIL PROTECTED]Douglas Instruments Ltd.

 DouglasHouse, EastGarston, Hungerford, Berkshire, RG177HD, UK

 Directors: Peter Baldock, Patrick Shaw Stewart, James Smith

 http://www.douglas.co.uk/

 Tel: 44 (0) 148-864-9090US toll-free 1-877-225-2034

 Regd. England 2177994, VAT Reg. GB 480 7371 36

 

From: CCP4 bulletin board [mailto:[EMAIL PROTECTED] On Behalf Of
JOE CRYSTAL
Sent: 14 April 2008 22:10
To: CCP4BB@JISCMAIL.AC.UK
Subject: Re: [ccp4bb] Fwd: [ccp4bb] crystallisation robot

 

Hi,


Does anyone have information about how long it takes to set up a 96-well
tray for the crystallization robots available?  Besides cost per tray
and maintenance cost, another important feature we consider is the time
for setting up a 96-well tray.  It is an important factor since we are
talking about sub-microliter drops.


Best,


Joe

 

Re: [ccp4bb] about microbatch

[Patrick Shaw Stewart]

Jiamu

 

Although we no longer focus on microbatch-under-oil, we have a small
utility called VDTOMB that converts from vapor diffusion conditions to
microbatch.  I have tested it with known published and  in-house
crystallization conditions and it seems to work remarkably well.  Go to
http://www.douglas.co.uk/tipsntech.htm  (you must use Internet Explorer,
not Firefox or something) and click on the link near the middle of the
page.

 

In most cases where the main precipitant is PEG there will be very
little equilibration in the VD experiment, so the MB conditions are
almost the same as the VD conditions.

 

The typical size for manual dispensing is 1 + 1 ul.  For robotic
dispensing, 0.3 + 0.3 is typical.

 

As long as you have a couple of mm of paraffin (or silicone mixed with
paraffin for screening) over the drops you will be OK.

 

If you or anyone else would like plates for microbatch, please ask me
for samples - see http://www.douglas.co.uk/vb.htm.  They're about $4,
which is cheaper than most VD plates.

 

MB often works well for proteins that are sensitive to oxidation, and
for membrane proteins.  Generally, less protein is lost on the surface
of the drop, and the crystallization conditions are better known.  It is
also great for conditions with isopropanol or other volatile liquids -
see http://www.douglas.co.uk/winner1.htm

 

Good luck with your project

 

Patrick

 

 

--

 [EMAIL PROTECTED]Douglas Instruments Ltd.

 DouglasHouse, EastGarston, Hungerford, Berkshire, RG177HD, UK

 Directors: Peter Baldock, Patrick Shaw Stewart

 http://www.douglas.co.uk/

 Tel: 44 (0) 148-864-9090US toll-free 1-877-225-2034

 Regd. England 2177994, VAT Reg. GB 480 7371 36

 

From: CCP4 bulletin board [mailto:[EMAIL PROTECTED] On Behalf Of
Jiamu Du
Sent: 26 July 2008 12:39
To: CCP4BB@JISCMAIL.AC.UK
Subject: [ccp4bb] about microbatch

 

Dear all,
I want to screen crystal using microbatch method. I do not have standard
microbatch plate, so I have to using a 96 well cell culture plate
instead.
My question is below:
What is a typical drop size for microbatch? 1ul protein + 1ul mother
solution or larger? 
How much paraffin oil is sufficient for cover the drop? 

Thanks.

-- 
Jiamu Du, Ph.D.
State Key Laboratory of Molecular Biology
Institute of Biochemistry and Cell Biology
Shanghai Institutes for Biological Sciences
Chinese Academy of Sciences
320 Yue-Yang Road
Shanghai 200031
P. R. China
Tel: +86-21-5492-1117
E-mail: [EMAIL PROTECTED] 

Re: [ccp4bb] Query on program for creating random crystallization screen

[Patrick Shaw Stewart]

Dear Rajakumara

I forgot to say, there's a very simple way to do this by "aliasing".  

You write (let's say by hand) one or more random screens with solutions
called e.g. Precipitate1, Precipitate2,  PrecipitateN; Buffer1 to
BufferN; Additive1 to AdditiveN etc.

Each time you want to make a screen you simply replace Precipitate1,
Precipitate2 etc. with the precipitates you want to use, say 30% PEG, 2M
AS etc.

It's almost trivial to do the whole thing in Excel using a look-up table
- or just links

If you have a robot you can run the same script each time, just put the
appropriate solutions into the stock wells.

Patrick


--
For information and discussion about protein crystallization and
automation, please join 
our bulletin board at
http://groups.google.com/group/oryx_group/members_invite?hl=en

 [EMAIL PROTECTED]Douglas Instruments Ltd.
 DouglasHouse, EastGarston, Hungerford, Berkshire, RG177HD, UK
 Directors: Peter Baldock, Patrick Shaw Stewart
 http://www.douglas.co.uk/
 Tel: 44 (0) 148-864-9090US toll-free 1-877-225-2034
 Regd. England 2177994, VAT Reg. GB 480 7371 36


> -Original Message-
> From: CCP4 bulletin board [mailto:[EMAIL PROTECTED] On Behalf Of
E
> rajakumar
> Sent: 12 September 2008 15:17
> To: CCP4BB@JISCMAIL.AC.UK
> Subject: [ccp4bb] Query on program for creating random crystallization
> screen
> 
> Dear All
> I want to create a random crystallization screen using
> given set of crystallization parameters (pH,
> Precipitant, salt, additive.) for protein-DNA
> complex crystallization. I was using Brent Segelke's
> CRYSTOOL program, not accessible online now. Please
> can you suggest any other such programs and/ how do I
> can access the CRYSTOOL (sort of registration or
> purchase?)
> 
> Thanking you in advance
> Rajakumara
> 
> 
> E. Rajakumara
> Postdoctoral Fellow
>   Strcutural Biology Program
>   Memorial Sloan-Kettering Cancer Center
>   New York-10021
>   NY
>   001 212 639 7986 (Lab)
>   001 917 674 6266 (Mobile)
> 
> 
> 
>   Get your preferred Email name!
> Now you can @ymail.com and @rocketmail.com.
> http://mail.promotions.yahoo.com/newdomains/aa/

Re: [ccp4bb] Crystallography plates, hanging drop but templated sealing film.

[Patrick Shaw Stewart]

You lose about 1 microlitre of water per well per day with polystyrene
Linbro plates - it goes through the plastic

Polypropylene and COC are better (or maybe worse if the evaporation
encourages crystallization)

--
For information and discussion about protein crystallization and
automation, please join 
our bulletin board at
http://groups.google.com/group/oryx_group/members_invite?hl=en

 patr...@douglas.co.ukDouglas Instruments Ltd.
 DouglasHouse, EastGarston, Hungerford, Berkshire, RG177HD, UK
 Directors: Peter Baldock, Patrick Shaw Stewart
 http://www.douglas.co.uk/
 Tel: 44 (0) 148-864-9090US toll-free 1-877-225-2034
 Regd. England 2177994, VAT Reg. GB 480 7371 36


> -Original Message-
> From: CCP4 bulletin board [mailto:ccp...@jiscmail.ac.uk] On Behalf Of
> Diana Tomchick
> Sent: 15 January 2009 21:56
> To: CCP4BB@JISCMAIL.AC.UK
> Subject: Re: [ccp4bb] Crystallography plates, hanging drop but
> templated sealing film.
> 
> Are you saying that you'd like to re-use the plate with the original
> screening solutions, or that you plan to clean the plates, then
> dispense fresh screening solutions?
> 
> If you would like to re-use the original screening solutions,
> beware...after many weeks, they will not be the same concentrations
> (and in some cases, not even the same pH) as they were when first
> dispensed into the plates. Slow evaporation of water occurs through
> the plastic of the plates as well as through the tape.
> 
> Diana
> 
> 
> On Jan 15, 2009, at 3:34 PM, Francis E Reyes wrote:
> 
> > Does such a thing exist? A 24-well microplate configuration where in
> > substitution of glass cover slips, you have a roll of tape templated
> > such that there are circular areas where you can add your protein
> > where there is no adhesive, but there is adhesive everywhere else?
> >
> > This may be a nightmare for plate manufacturers, but to reuse the
> > plate, you just throw away the film and tear a new one.
> >
> > Thanks!
> > FR
> >
> > -
> > Francis Reyes M.Sc.
> > 215 UCB
> > University of Colorado at Boulder
> >
> > gpg --keyserver pgp.mit.edu --recv-keys 67BA8D5D
> >
> > 8AE2 F2F4 90F7 9640 28BC  686F 78FD 6669 67BA 8D5D
> 
> * * * * * * * * * * * * * * * * * * * * * * * * * * * *
> Diana R. Tomchick
> Associate Professor
> University of Texas Southwestern Medical Center
> Department of Biochemistry
> 5323 Harry Hines Blvd.
> Rm. ND10.214B
> Dallas, TX 75390-8816, U.S.A.
> Email: diana.tomch...@utsouthwestern.edu
> 214-645-6383 (phone)
> 214-645-6353 (fax)

Re: [ccp4bb] Crystal vacuum cleaner

[Patrick Shaw Stewart]

Jacob

 

Have you seen the Crystal Catcher system, developed in Japan?

 

http://adsabs.harvard.edu/abs/2008APExp...1c7002K

 

Some of us saw it at a recent IUCr meeting, but I don't know anyone who
has tried it with their own proteins

 

Patrick

 

 

--

For information and discussion about protein crystallization and
automation, please join 

our bulletin board at
http://groups-beta.google.com/group/oryx_group?hl=en
<http://groups-beta.google.com/group/oryx_group?hl=en> 

 

 patr...@douglas.co.uk <mailto:patr...@douglas.co.uk> Douglas
Instruments Ltd.

 DouglasHouse, EastGarston, Hungerford, Berkshire, RG177HD, UK

 Directors: Peter Baldock, Patrick Shaw Stewart

 http://www.douglas.co.uk/ <http://www.douglas.co.uk/> 

 Tel: 44 (0) 148-864-9090US toll-free 1-877-225-2034

 Regd. England 2177994, VAT Reg. GB 480 7371 36

 

From: CCP4 bulletin board [mailto:ccp...@jiscmail.ac.uk] On Behalf Of
Jacob Keller
Sent: 26 March 2009 19:43
To: CCP4BB@JISCMAIL.AC.UK
Subject: [ccp4bb] Crystal vacuum cleaner

 

Dear Crystallographers,

 

Has anybody ever heard of mounting crystals in tiny crystal-sized
capillaries, such as are pulled by patch-pipet machines, or those used
in microfluidics? The material could be either glass or plastic, and one
could have some method of continuous positive or negative pressure,
perhaps through a hole in the crystal cap. Anyway, once safely inside
the tiny capilary, one could freeze it at leisure, without concern for
evaporation. It would really make harvesting easy--just vacuum up the
crystal, then plop in LiqN2/propane as per usual. I guess it could also
really be done with appropriate modification of a micro-manipulator.

 

Jacob

 

***
Jacob Pearson Keller
Northwestern University
Medical Scientist Training Program
Dallos Laboratory
F. Searle 1-240
2240 Campus Drive
Evanston IL 60208
lab: 847.491.2438
cel: 773.608.9185
email: j-kell...@northwestern.edu
***

Re: [ccp4bb] microbatch vs hanging drop

[Patrick Shaw Stewart]

Rui

 

Microbatch - which I take to mean crystallization under oil with no
reservoir - has many advantages, but with some robots it's a little
slower to set up (20 mins on ours).   So most people I know start off
with vapor diffusion and only move to microbatch if they have problems
with VD.

 

It seems to find as many hits as vapor diffusion, but in different
conditions - see http://www.douglas.co.uk/mbnvdall.htm
<http://www.douglas.co.uk/mbnvdall.htm> 

 

Main advantages:

1.   Gives thinner skins on drops and less protein is lost on the
surface

2.   The oil often protects sensitive proteins such as membrane
proteins or oxygen sensitive proteins

3.   You can change temperature freely (no condensation etc.)

4.   Very good for use with volatile organics, see e.g.
http://www.douglas.co.uk/winner1.htm
<http://www.douglas.co.uk/winner1.htm> 

 

And you can use it with "MMS" microseeding just like VD - very important
I believe.

 

I guess the main disadvantage is that it can be hard to harvest crystals
through the oil (although some say the oil makes it easier because you
can take your time)

 

People are using smaller and smaller reservoirs so I guess one day
they'll realize that you don't need a reservoir  ;-)

 

Good luck

 

Patrick

 

 

 

--

For information and discussion about protein crystallization and
automation, please join 

our bulletin board at
http://groups-beta.google.com/group/oryx_group?hl=en

 

 patr...@douglas.co.ukDouglas Instruments Ltd.

 DouglasHouse, EastGarston, Hungerford, Berkshire, RG177HD, UK

 Directors: Peter Baldock, Patrick Shaw Stewart

 http://www.douglas.co.uk/

 Tel: 44 (0) 148-864-9090US toll-free 1-877-225-2034

 Regd. England 2177994, VAT Reg. GB 480 7371 36

 

 

From: CCP4 bulletin board [mailto:ccp...@jiscmail.ac.uk] On Behalf Of
rui
Sent: 22 April 2009 17:06
To: CCP4BB@JISCMAIL.AC.UK
Subject: [ccp4bb] microbatch vs hanging drop

 

Hi,

 

I have a question about the method for crystallization. With traditional
hanging drop(24 wells), one slide can also hold for multiple drops but
it requires the buffer quite a lot, > 600uL? Microbatch can save
buffers,only 100uL is required, and also  can hold up to three samples
in the sitting well. Other than saving the buffer, what's the advantage
of microbatch? Which method will be easier to get crystals or no big
difference? Thanks for sharing.

 

R

Re: [ccp4bb] Experimental design and response surface methods for crystal optimization

[Patrick Shaw Stewart]

Hi Christian

We often use a simple approach where people design their experiments using 
rational multivariate design, but then simply use the best well that is found 
as the centre of the next round of experiments.  This means that you don't have 
to score all the wells - which is time-consuming!

There's more info at http://www.douglas.co.uk/rat_des.htm

Patrick

--
 patr...@douglas.co.uk    Douglas Instruments Ltd.
 DouglasHouse, EastGarston, Hungerford, Berkshire, RG177HD, UK
 Directors: Peter Baldock, Patrick Shaw Stewart
 http://www.douglas.co.uk/
 Tel: 44 (0) 148-864-9090    US toll-free 1-877-225-2034
 Regd. England 2177994, VAT Reg. GB 480 7371 36


-Original Message-
From: CCP4 bulletin board [mailto:ccp...@jiscmail.ac.uk] On Behalf Of Benda, 
Christian
Sent: 15 May 2009 15:07
To: CCP4BB@JISCMAIL.AC.UK
Subject: [ccp4bb] Experimental design and response surface methods for crystal 
optimization

Dear all

I recently came across the "experimental design" method for systematic 
optimization of multiparametric problems like macromolecular crystal growth.
(The response surface concept has been introduced to protein crystallization by 
Carter et al. (e.g. Meth. Mol. Biol, vol. 363) and should theoretically enable 
optimization of a multiparatmetric problem by simultaneous variation of several 
variables).

I am wondering if anyone is actually making use of this method on a regular 
basis and what their experiences are. It would also be interesting to now if 
tools (web-based) are available to help in designing and evaluating experiments.

Any comment appreciated!

Thanks very much
Christian

Re: [ccp4bb] How to improve crystal which is twinning?

[Patrick Shaw Stewart]

If you haven't already used it, I would certainly try the approach of
microseeding into screens since you already have crystals

 

http://scripts.iucr.org/cgi-bin/paper?S0907444907007652

 

 

 

--

 patr...@douglas.co.uk <mailto:patr...@douglas.co.uk> Douglas
Instruments Ltd.

 DouglasHouse, EastGarston, Hungerford, Berkshire, RG177HD, UK

 Directors: Peter Baldock, Patrick Shaw Stewart

 http://www.douglas.co.uk/ <http://www.douglas.co.uk/> 

 Tel: 44 (0) 148-864-9090US toll-free 1-877-225-2034

 Regd. England 2177994, VAT Reg. GB 480 7371 36

 

From: CCP4 bulletin board [mailto:ccp...@jiscmail.ac.uk] On Behalf Of
HanJie_HCT Tai
Sent: 17 May 2009 13:27
To: CCP4BB@JISCMAIL.AC.UK
Subject: [ccp4bb] How to improve crystal which is twinning?

 

Hi,
 
I have a 22kDa protein that the floopy N & C terminus have been deleted.
It was crystallized in 35%MPD/0.1m Tris (pH 8.5)/0.2M/(NH4)2SO4 in 2 - 3
days. Previously, a few small twining crystals were grown in this
condition.
 
I tried Hampton Research 96-additive screen . Additives such as
glycerol, dioxane, etc didn't work well to improve/reduce twining issue.
 
The 0.3% DMSO is the best additive I found that can grow a single
crystal in the 1(pro)+0.8(buff)+0.2(add) drop.
 
However, If looking careful under microscope it may be some other
crystals growing inside that single crystal(hardly see under the
microscope, but I can see it in other drops). I conducted the x-ray
diffraction experiment for this 0.1x 0.1 mm crystal for which no
cryoprotectant is required. The highest resolution is 2A but there are a
lot of smear on the diffraction pattern.  Thus, the index procedures
failed due to the crystal quality.
 
Do you have any brilliant ideas to improve the crystal growing condition
in my case in order to get a truly single crystal?
 
regards,
Heng 



Windows Live(tm): Keep your life in sync. Check it out.
<http://windowslive.com/explore?ocid=TXT_TAGLM_BR_life_in_synch_052009> 

Re: [ccp4bb] Seeding

[Patrick Shaw Stewart]

HanJie

 

The easy way to seed either by hand or using a robot is to use the
approach of D'Arcy (ref below)

 

Comments:

1.   Seeding into SCREENS will give you new leads and may solve your
twinning problem

2.   If you are seeding into screens DON'T DILUTE THE SEED STOCK.
The more seeds you put in, the more new hits you're likely to get.  Only
use dilutions if you get too many crystals

3.   You can make the seed stock using the reservoir solution that
gave the hit - you don't need to have protein present or to increase the
precipitant.  However the seeds are often unstable so you must KEEP THEM
ON ICE all the time and freeze them as soon as possible.  They'll then
last at least a year.

4.   You don't need to fish out crystals.  You should put the whole
contents of the well into the seed bead tube, including precipitant,
crystals, dust etc

 

This method has given outstanding results and is very popular

 

Patrick

 

 

[2] Allan D'Arcy, Frederic Villarda, May Marsh.  'An automated microseed
matrix-screening method for protein crystallization'.  Acta
Crystallographica section D63 (2007), 550-554.  On-line at
http://scripts.iucr.org/cgi-bin/paper?S0907444907007652

 

--

For information and discussion about protein crystallization and
automation, please join 

our bulletin board at
http://groups-beta.google.com/group/oryx_group?hl=en
<http://groups-beta.google.com/group/oryx_group?hl=en> 

 

 patr...@douglas.co.uk <mailto:patr...@douglas.co.uk> Douglas
Instruments Ltd.

 DouglasHouse, EastGarston, Hungerford, Berkshire, RG177HD, UK

 Directors: Peter Baldock, Patrick Shaw Stewart

 http://www.douglas.co.uk/ <http://www.douglas.co.uk/> 

 Tel: 44 (0) 148-864-9090US toll-free 1-877-225-2034

 Regd. England 2177994, VAT Reg. GB 480 7371 36

 

From: CCP4 bulletin board [mailto:ccp...@jiscmail.ac.uk] On Behalf Of
HanJie_HCT Tai
Sent: 29 May 2009 21:04
To: CCP4BB@JISCMAIL.AC.UK
Subject: [ccp4bb] Seeding

 

Hi,
 
I set up some seeding trials (microseeding) from 1 x to 1000x dilution.
 
I am just wondering
 
(a) How long the seed stock solutions can be kept? some said they can be
kept for up to 1 year, some said the seed stock solutions need to be
freshly prepared before use, which one is true?
 
(b) Each well I set up two drops, and then I streaked these two drops
continously. Between each well (means each dilution microseeding) do I
need to use ethanol or water to rinse the whisker? Or I can just
continue to streak seed as long as the sequence is from low dilution
(1000x) to high dilution (1x).
 
(c)From my result, how come some crystals showed up in 10 X dilution
while some showed up in 100X and even 1X while other  no crystals were
grown. The result wasn't consistent. On the same well, sometime 1st
seeding drop got crystal, and someting 2nd seeding drop got crystal, Is
this phenomenon common?
 
(d)After trying 1-2 rounds of microseeding, the crystal remained as
twinned or multiple plates overlapping with each other? Any suggestion
to improve the twinning crystal condition?
 
My microseeding protocol is as followed.
(1) loop up a crystal either from normal optimization or seeding drop
(eg 23% precipitant), size may be 0.1 mm.
(2) transfer to slightly 5ul dissolving solution (eg 17%
precipitant)...30seconds
(3) transfer to 50 ul stablizing solution (normally I used the same
solution from equilibrium well, eg 23%)
(4) use pipet to withdraw all 50ul solution that contains the crystal
(5) transfer to 1.5 ml seed bead centrifuge tube (Hampton Research)
(6) vortex 90s
(7) add 450 ul same stablizing solution; this is 500ul seed stock (1:1).
Sometime, I manipulated the final volume a little bit, such as 100ul or
300 ul.
(8) transfer 5 ul 1:1 seed stock to another 45ul stablizing solution
(9) vortex 90s
(10) The final 50 ul seed solution became 1:10 dilution stock.
 
 
Regards,
HengChiat Tai (HanJie)



  



Hotmail(r) goes with you. Get it on your BlackBerry or iPhone.
<http://windowslive.com/Tutorial/Hotmail/Mobile?ocid=TXT_TAGLM_WL_HM_Tut
orial_Mobile1_052009> 

Re: [ccp4bb] anaerobic crystallization

[Patrick Shaw Stewart]

Chris

Although generally less popular nowadays, microbatch-under-oil has great
advantages for anaerobic work.  You can keep your stock solutions in the
chamber all the time, so you only need to degas your protein. Microbatch
finds roughly as many crystals in screening experiments as vapor
diffusion (summary at http://www.douglas.co.uk/mbnvdall.htm ).  Of
course the oil helps to protect the protein too - generally less is
denatured on the surface

For an automatic setup that fits in an anaerobic chamber conveniently
see the winning entry in Douglas Instrument's competition (2006), from
the University of Georgia, Athens
http://www.douglas.co.uk/presentations/winner2_files/v3_document.htm

Hope that's useful

Patrick


--
For information and discussion about protein crystallization and
automation, please join 
our bulletin board at
http://groups-beta.google.com/group/oryx_group?hl=en

 patr...@douglas.co.ukDouglas Instruments Ltd.
 DouglasHouse, EastGarston, Hungerford, Berkshire, RG177HD, UK
 Directors: Peter Baldock, Patrick Shaw Stewart
 http://www.douglas.co.uk/
 Tel: 44 (0) 148-864-9090US toll-free 1-877-225-2034
 Regd. England 2177994, VAT Reg. GB 480 7371 36

> -Original Message-
> From: CCP4 bulletin board [mailto:ccp...@jiscmail.ac.uk] On Behalf Of
> Christopher Rife
> Sent: 02 September 2009 18:34
> To: CCP4BB@JISCMAIL.AC.UK
> Subject: [ccp4bb] anaerobic crystallization
> 
> Hi,
> 
> Does anyone have tips or suggestions for getting started with
anaerobic
> crystallization? Searching through the archives, I was able to find
> some
> discussion about various glove box options
> (http://tinyurl.com/ccp4-glovebox), but not about the process itself
> (we
> already have a box).
> 
> To simplify things, would it be worthwhile to perform the initial
> screens
> in something like the pre-filled Qiagen screens
> (http://tinyurl.com/qiagen-xseal)? Do I need to worry about
evaporation
> while solutions are being degassed (esp volatiles)? Better/easier to
> try
> microbatch?
> 
> Thanks for any input.
> 
> Chris
>
___
> _
> ___
> 
> This is an e-mail from Danisco and may contain confidential
> information. If you
> are not the intended recipient and you
> receive this e-mail by mistake, you are not allowed to use the
> information, to
> copy it or distribute it further.
> Please notify us and return it to Danisco by e-mail and delete all
> attachments.
> Thank you for your assistance.
>
___
> _
> __

Re: [ccp4bb] stabilizing solution

[Patrick Shaw Stewart]

James

 

Generally you can use the reservoir solution to make your seed stocks,
as is routinely done with the "MMS" microseeding method.  However, the
seeds will not be completely stable because there will not be much
protein in the solution, so you must keep your seed stocks on ice, and
freeze them as soon as you've finished using them

 

I imagine that MPD would stabilize your seed crystals as well as
anything else

 

Reference below

 

Best wishes

 

Patrick

 

 

[2] Allan D'Arcy, Frederic Villarda, May Marsh.  'An automated microseed
matrix-screening method for protein crystallization'.  Acta
Crystallographica section D63 (2007), 550-554.  On-line at
http://scripts.iucr.org/cgi-bin/paper?S0907444907007652

 

 

 

--

For information and discussion about protein crystallization and
automation, please join 

our bulletin board at
http://groups-beta.google.com/group/oryx_group?hl=en

 

 patr...@douglas.co.ukDouglas Instruments Ltd.

 DouglasHouse, EastGarston, Hungerford, Berkshire, RG177HD, UK

 Directors: Peter Baldock, Patrick Shaw Stewart

 http://www.douglas.co.uk/

 Tel: 44 (0) 148-864-9090US toll-free 1-877-225-2034

 Regd. England 2177994, VAT Reg. GB 480 7371 36

 

From: CCP4 bulletin board [mailto:ccp...@jiscmail.ac.uk] On Behalf Of
james09 pruza
Sent: 06 September 2009 09:14
To: CCP4BB@JISCMAIL.AC.UK
Subject: [ccp4bb] stabilizing solution

 

Dear CCP4bbers,

Please comment on the stabilizing solution for seed stocks. If the
crystal is in 30% MPD and coming after 2-3 days, what should be the
stabilizing solution for seeding.
Thanks.
James

Re: [ccp4bb] Protein concentration for crystallization

[Patrick Shaw Stewart]

A
>
> Ph: (205)934-0124; Fax: (205)934-0480
>
>  
>
> ** **
> --
>
>
> This e-mail message (including any attachments) is for the sole use of
> the intended recipient(s) and may contain confidential and privileged
> information. If the reader of this message is not the intended
> recipient, you are hereby notified that any dissemination, distribution
> or copying of this message (including any attachments) is strictly
> prohibited.
>
> If you have received this message in error, please contact
> the sender by reply e-mail message and destroy all copies of the
> original message (including attachments).
>



-- 
 patr...@douglas.co.ukDouglas Instruments Ltd.
 Douglas House, East Garston, Hungerford, Berkshire, RG17 7HD, UK
 Directors: Peter Baldock, Patrick Shaw Stewart

 http://www.douglas.co.uk
 Tel: 44 (0) 148-864-9090US toll-free 1-877-225-2034
 Regd. England 2177994, VAT Reg. GB 480 7371 36

Re: [ccp4bb] structural homologs as cross seeds

[Patrick Shaw Stewart]

There are many examples where "cross-seeding" with homologous proteins has
worked, both in classical and recent work.  You should add seed-stocks from
any crystals with significant homology to your routine screening
experiments in the first place.

The important thing is to use *random *screens at first.  This has the
effect of giving you new leads and also optimizing the ones that you have
(plus you can control the number of crystals per drop).

See http://hamptonresearch.com/documents/ramc/RAMC2011_T11_Obmolova.pdf
(Omolova and colleagues have examples where complexes were seeded with
crystals of one of the components and vice versa.)

The excellent review by Stura and co covers most of the theoretical points.
 (1999). Epitaxial jumps. *J. crystal growth*, *196*(2), 250-260.

For practical details see the original paper by D'Arcy (Acta Cryst D:
63.4 (2007):
550-554) and also our paper "Random microseeding: a theoretical and
practical exploration  " *Crystal Growth & Design* 11.8 (2011):
3432-3441.

also http://www.douglas.co.uk/MMS_proc.htm

Acoot, this is also the approach to use with your "cubic" crystals.  Don't
think about it too much, just try it!

The only thing that I can't explain is why this random seeding method,
including cross-seeding, is not more well-known.

Hope it works

Patrick



On 27 December 2013 21:03, Mark van Raaij  wrote:

> the differences are likely to be on the protein surface, and these would
> make the crystal contacts, i.e. it would be unlikely the protein could
> crystallise in the same crystal habit.
> Never say never in crystallisation (i.e. try anything), but I would go for
> other things first like additives, different crystallisation techniques,
> temperatures, concentrations etc.
>
> On 27 Dec 2013, at 20:29, Mahesh Lingaraju wrote:
>
> > Dear all,
> >
> > I was wondering if it sounds logical to use the crystals from a possible
> structural homolog as seeds to induce nucleation ? (in terms of overall
> sequence, the proteins are considerably different but based on sequence
> alignment and structures from other related proteins, it is highly likely
> the protein would have the same structure.)
> >
> > Please comment if any of you had experience with this.
> >
> > Thank you
> >
> > Happy holidays :)
> >
> > Mahesh
>



-- 
 patr...@douglas.co.ukDouglas Instruments Ltd.
 Douglas House, East Garston, Hungerford, Berkshire, RG17 7HD, UK
 Directors: Peter Baldock, Patrick Shaw Stewart

 http://www.douglas.co.uk
 Tel: 44 (0) 148-864-9090US toll-free 1-877-225-2034
 Regd. England 2177994, VAT Reg. GB 480 7371 36

Re: [ccp4bb] seeding, reproducibility

[Patrick Shaw Stewart]

Mahesh, this is a very interesting and slightly controversial question.

One approach is to mix together all of the crystals that you have in the
initial screen.  The idea at the beginning of the project is to get as many
diverse hits as possible - you can worry about crystal size, space group
and quality later on.

If you can collect data from crystals and determine the unit cell then you
can be more rational.  You can construct a "library" of polymorphs having
different unit cells.  This *may *allow you to push the space group in a
given condition to the unit cell or space group that you want - maybe you
find e.g. that your ligand can only diffuse into the active site with a
certain unit cell.

There is a very interesting paper with several examples of how to use
polymorphs by the Stura group, see below.

However, seeding can give rise to crystals with different but related space
groups.  A very nice example is shown in the wikipedia article about
epitaxy - titanium oxide growing on iron oxide.  Also Stura's paper on
epitaxial jumps is interesting and relevant.

Make sure you dilute your seed stock in a systematic way as part of your
final optimization - one great advantage of microseeding is that oyu can
control the number of crystals per drop by diluting the seed stock.

Also, make sure that you use fresh crystals to make the seed stock.  For
some strange reason old crystals sometimes fail to act as seeds, even
though they can be crushed and still diffract.  Maybe the unit cell
shrinks, or maybe the crystals become cross-linked.  Make the seed stock as
soon as your crystals stop growing, then freeze them.  Seed stocks can
almost always be frozen.

Best wishes, Patrick



*Library of polymorphs:*
Vera, Laura, Claudia Antoni, Laurent Devel, Bertrand Czarny, Evelyn
Cassar-Lajeunesse, Armando Rossello, Vincent Dive, and Enrico A. Stura.
"Screening Using Polymorphs for the Crystallization of Protein–Ligand
Complexes." Crystal Growth & Design 13, no. 5 (2013): 1878-1888.

Stura, Enrico A., Jean-Baptiste Charbonnier, and Michael J. Taussig.
"Epitaxial jumps." Journal of crystal growth 196, no. 2 (1999): 250-260.


*Cross-seeding:*
Obmolova, Galina, Thomas J. Malia, Alexey Teplyakov, Raymond Sweet, and
Gary L. Gilliland. "Promoting crystallization of antibody-antigen complexes
via microseed matrix screening." Acta Crystallographica Section D:
Biological Crystallography 66, no. 8 (2010): 927-933.

Abuhammad, Areej, Edward D. Lowe, Michael A. McDonough, P. D. Shaw Stewart,
Stefan A. Kolek, Edith Sim, and Elspeth F. Garman. "Structure of arylamine
N-acetyltransferase from Mycobacterium tuberculosis determined by
cross-seeding with the homologous protein from M. marinum: triumph over
adversity." Acta Crystallographica Section D: Biological Crystallography
69, no. 8 (2013): 1433-1446.


*Seed stability etc*
Shaw Stewart, Patrick D., Stefan A. Kolek, Richard A. Briggs, Naomi E.
Chayen, and Peter FM Baldock. "Random microseeding: a theoretical and
practical exploration of seed stability and seeding techniques for
successful protein crystallization." Crystal Growth & Design 11, no. 8
(2011): 3432-3441.



*Original description of the "random" microseeding method*D'Arcy, Allan,
Frederic Villard, and May Marsh. "An automated microseed matrix-screening
method for protein crystallization." Acta Crystallographica Section D:
Biological Crystallography 63, no. 4 (2007): 550-554.





On 17 January 2014 22:24, Mahesh Lingaraju  wrote:
>
> Hi Folks
>
> The protein that I am working on gives several initial hits which are
needles. And at random, I picked the needles from a condition (0.2 M cacl2,
0.1 M HEPES pH 7.5 & 28% PEG 400) and seeded into another screen where I
added 1µl protein + 1µl reservoir solution + 0.3 µl seed stock. I prepared
the seed stock fresh by adding 36 µl of the reservoir solution to
preexisting 2µl drop.
> One of the conditions from the seeded screen gave me a hit that looks
really promising ( see attached). I am sort of positive that these crystals
are protein as they are UV active.
>
> I tried to reproduce these but with needles from another condition which
actually look much nicer than the seeds i used to produce these crystals.
However, I failed to do so.
>
> While i understand that seed quality is important, I find it interesting
that the crystals do not reproduce with similar or better looking seeds. Is
it common that the seeds absolutely need to be from the same condition to
reproduce hits ?
>
> thanks for any suggestions
>
> Mahesh
>
>



--
 patr...@douglas.co.ukDouglas Instruments Ltd.
 Douglas House, East Garston, Hungerford, Berkshire, RG17 7HD, UK
 Directors: Peter Baldock, Patrick Shaw Stewart

 http://www.douglas.co.uk
 Tel: 44 (0) 148-864-9090US toll-free 1-877-225-2034
 Regd. England 2177994, VAT Reg. GB 480 7371 36

Re: [ccp4bb] seeding, reproducibility

[Patrick Shaw Stewart]

One or more ingredients in the original hit (which you use to suspend the
seed crystals in) can indeed be essential, and may be all you need to get
nice crystals.  In D'Arcy's original paper you will see that he needed Ca2+
to get nice crystals of one of his proteins.  The same is true in Stoddards
paper, which inspired D'Arcy, ref below.  However in the majority of cases
it is just the seed that you need, i.e. there was a nucleation problem in
the new hits that appear with seed stock.  You can see this very clearly
because (in most cases) diluting the seed stock in the same solution gives
a corresponding reduction in the number of crystals.


Ireton, Gregory C., and Barry L. Stoddard. "Microseed matrix screening to
improve crystals of yeast cytosine deaminase." *Acta Crystallographica
Section D: Biological Crystallography* 60, no. 3 (2004): 601-605.



On 18 January 2014 00:18, Mahesh Lingaraju  wrote:

> Thanks you for the suggestions, Patrick and Matthias. I was actually
> wondering if any of the components from the seeding solution actually were
> important but your explanations sound more logical.
>
> I apologize for the large attachment. I did not realize that it was so
> big.
>
> Have a nice weekend !
>
> Mahesh
>
>
> On Fri, Jan 17, 2014 at 6:18 PM, Patrick Shaw Stewart <
> patr...@douglas.co.uk> wrote:
>
>>
>> Mahesh, this is a very interesting and slightly controversial question.
>>
>> One approach is to mix together all of the crystals that you have in the
>> initial screen.  The idea at the beginning of the project is to get as many
>> diverse hits as possible - you can worry about crystal size, space group
>> and quality later on.
>>
>> If you can collect data from crystals and determine the unit cell then
>> you can be more rational.  You can construct a "library" of polymorphs
>> having different unit cells.  This *may *allow you to push the space
>> group in a given condition to the unit cell or space group that you want -
>> maybe you find e.g. that your ligand can only diffuse into the active site
>> with a certain unit cell.
>>
>> There is a very interesting paper with several examples of how to use
>> polymorphs by the Stura group, see below.
>>
>> However, seeding can give rise to crystals with different but related
>> space groups.  A very nice example is shown in the wikipedia article about
>> epitaxy - titanium oxide growing on iron oxide.  Also Stura's paper on
>> epitaxial jumps is interesting and relevant.
>>
>> Make sure you dilute your seed stock in a systematic way as part of your
>> final optimization - one great advantage of microseeding is that oyu can
>> control the number of crystals per drop by diluting the seed stock.
>>
>> Also, make sure that you use fresh crystals to make the seed stock.  For
>> some strange reason old crystals sometimes fail to act as seeds, even
>> though they can be crushed and still diffract.  Maybe the unit cell
>> shrinks, or maybe the crystals become cross-linked.  Make the seed stock as
>> soon as your crystals stop growing, then freeze them.  Seed stocks can
>> almost always be frozen.
>>
>> Best wishes, Patrick
>>
>>
>>
>> *Library of polymorphs:*
>> Vera, Laura, Claudia Antoni, Laurent Devel, Bertrand Czarny, Evelyn
>> Cassar-Lajeunesse, Armando Rossello, Vincent Dive, and Enrico A. Stura.
>> "Screening Using Polymorphs for the Crystallization of Protein–Ligand
>> Complexes." Crystal Growth & Design 13, no. 5 (2013): 1878-1888.
>>
>> Stura, Enrico A., Jean-Baptiste Charbonnier, and Michael J. Taussig.
>> "Epitaxial jumps." Journal of crystal growth 196, no. 2 (1999): 250-260.
>>
>>
>> *Cross-seeding:*
>> Obmolova, Galina, Thomas J. Malia, Alexey Teplyakov, Raymond Sweet, and
>> Gary L. Gilliland. "Promoting crystallization of antibody-antigen complexes
>> via microseed matrix screening." Acta Crystallographica Section D:
>> Biological Crystallography 66, no. 8 (2010): 927-933.
>>
>> Abuhammad, Areej, Edward D. Lowe, Michael A. McDonough, P. D. Shaw
>> Stewart, Stefan A. Kolek, Edith Sim, and Elspeth F. Garman. "Structure of
>> arylamine N-acetyltransferase from Mycobacterium tuberculosis determined by
>> cross-seeding with the homologous protein from M. marinum: triumph over
>> adversity." Acta Crystallographica Section D: Biological Crystallography
>> 69, no. 8 (2013): 1433-1446.
>>
>>
>> *Seed stability etc*
>> Shaw Stewart, Patrick D., Stefan A. Kolek, Richard A. Briggs, Naomi E.
>> Chayen, and Peter FM Baldock. "Ra

Re: [ccp4bb] First stucture of FCFV

[Patrick Shaw Stewart]

Those who use lysozyme as a model protein should note that fungal spores of
an unknown strain can have a dramatic effect on lysozyme crystal
nucleation, as noticed by my student many years ago (I wasn't completely
happy with the report because we never knew what we were working with!).

Chayen, N. E., Radcliffe, J. W., & Blow, D. M. (1993). Control of
nucleation in the crystallization of lysozyme. *Protein Science*, *2*(1),
113-118.
http://onlinelibrary.wiley.com/doi/10.1002/pro.5560020112/full


I've often wondered why crystallization experiments at room temp don't
become a sea of bacteria and fungi within a week.  Is it because the high
precipitant concs used stop growth?  After all, medical saline is only 150
mM - much less than the average NaCl conc used for crystallization, which
is about 1.7M.  I guess not many bugs can grow in 20% PEG either.

Patrick




On 3 April 2014 15:25, Reza Khayat  wrote:

> I think fungus dependent crystallization has occurred for some
> labs. A paper that pops into mind is from my graduate
> laboratory (not my work though):
>
> http://www.ncbi.nlm.nih.gov/pmc/articles/PMC2225192/
>
> Reza
>
> Reza Khayat, PhD
> Assistant Professor
> The City College of New York
> Department of Chemistry, MR-1135
> 160 Convent Avenue
> New York, NY  10031
> Tel. (212) 650-6070
> www.khayatlab.org
>
>
>  Original message 
> >Date: Thu, 3 Apr 2014 06:36:37 -0700
> >From: CCP4 bulletin board  (on behalf
> of Chad Brautigam )
> >Subject: Re: [ccp4bb] First stucture of FCFV
> >To: CCP4BB@JISCMAIL.AC.UK
> >
> >   I once encountered mold-dependent crystallization of
> >   a protein.  Wouldn't that have made for a lively
> >   Methods section?
> >   Luckily, we determined the structure from crystals
> >   derived from a different, non-moldy condition.
> >   Whew.
> >   Chad
> >   From: Artem Evdokimov 
> >   To: CCP4BB@JISCMAIL.AC.UK
> >   Sent: Thursday, April 3, 2014 7:55 AM
> >   Subject: Re: [ccp4bb] First stucture of FCFV
> >   Common molds like aspergillus or penicillium. After
> >   a while you sometimes get sporangia, then you can
> >   tell with more certainty. ..
> >   A.
> >   On Apr 3, 2014 3:50 AM, "Bernhard Rupp"
> >wrote:
> >
> > Several people were asking what this FCFV
> > tentacles actually might be. I think it is some
> > fungus/yeast growing out of nutritious drops. Does
> > resemble fungus/mushroom mycelium. I have also
> > some that look like huge bacteriophages with nice
> > heads on them, probably yeast buds. There is also
> > a yeast lab next to the Xtallization facility :-/
> > *** feel free to speculate.
> >
> > Best, BR
> >
> >
>



-- 
 patr...@douglas.co.ukDouglas Instruments Ltd.
 Douglas House, East Garston, Hungerford, Berkshire, RG17 7HD, UK
 Directors: Peter Baldock, Patrick Shaw Stewart

 http://www.douglas.co.uk
 Tel: 44 (0) 148-864-9090US toll-free 1-877-225-2034
 Regd. England 2177994, VAT Reg. GB 480 7371 36

[ccp4bb] investigating "random" microseeding / improving sea urchins / crystallization diffraction problem

[Patrick Shaw Stewart]

Is there anyone out there who works in a high-throughput crystallization
lab that would be interested in running some experiments to see how well
"random" microseeding / rMMS works when it is used routinely (i.e. as soon
as the first crystals stop growing)?  I have in mind a very simple protocol
and a simple way to measure its effectiveness for getting more structures.

The reason I am asking is that the obvious thing for both William and
Anamika to try is rMMS, as has been suggested many times on this bb.

I don't understand why everyone doesn't know about and use this method,
which was published seven years ago.  I think part of the reason is that -
although lots of small labs use it - as far as I know none of the
high-throughput centers use it routinely at an early stage.  I've
approached several H.T. groups about this but none of them were interested
in giving it a try.

If anyone from a high-thoughput lab is interested I'd be very happy to stop
by and give a seminar with all the theory and practical details, plus put
forward some simple ideas for testing the effectiveness of the method.
 Please let me know off-board.

William and Anamika, I would make a seed stock with the crystals that you
have and add it to a couple of random screens.  References and practical
info are below.  (B.t.w. it very often works well with sea urchins,
William.)

Best wishes to all, Patrick

__


Refs etc:

1. Galina Obmolova reported in 2011 that 38 of her 70 structures were
determined using MMS.  That included 70% of the complexes.  See slide 5 of
http://hamptonresearch.com/documents/ramc/RAMC2011_T11_Obmolova.pdf


2. The original publication by D'Arcy *et al.* (based on Stoddard's work):
http://scripts.iucr.org/cgi-bin/paper?S0907444907007652


3. Our (slightly "heavy") article in Crystal Growth and Design about how to
adapt the method to different situations:
http://pubs.acs.org/doi/abs/10.1021/cg2001442


4. A fun project that we were involved in where "random" cross-seeding
worked brilliantly:  http://scripts.iucr.org/cgi-bin/paper_yard?wd5214


5.  Our latest recommendations for the method:
http://www.douglas.co.uk/MMS_proc.htm





On 11 April 2014 01:50, william lee  wrote:

>  Dear All,
>
>
>
> I am currently working on a ligand bound protein complex. From my initial
> crystallization screens I have identified a condition which gives me sea
> urchin like crystals. I managed to repeat these crystals in my optimization
> conditions, in fact I can see crystals in all the wells but there is no
> significant difference between them. All conditions give me similar size
> and amount of crystals. To confirm these are protein crystals or not, I
> tried expose the crystals to X-ray beam (in-house). Good news is that I
> have no obvious salt diffraction at high resolution, but the bad news is my
> low resolution diffractions are not really believable. In addition, these
> crystals seem to be quite easy to separate into needles but they are too
> small to tell if they do crack like most the protein crystals.
>
>
>
> I have attached a picture of my crystals and the diffraction pattern I got
> at low resolution.
>
>
>
> I am hoping if anyone can suggest me on how to improve or change the shape
> of these crystals if they are genuine protein crystals.
>
>
>
>
>
> Many thanks
>
>
>
> Kind regards
>
> William
>



-- 
 patr...@douglas.co.ukDouglas Instruments Ltd.
 Douglas House, East Garston, Hungerford, Berkshire, RG17 7HD, UK
 Directors: Peter Baldock, Patrick Shaw Stewart

 http://www.douglas.co.uk
 Tel: 44 (0) 148-864-9090US toll-free 1-877-225-2034
 Regd. England 2177994, VAT Reg. GB 480 7371 36

Re: [ccp4bb] PDB passes 100,000 structure milestone

[Patrick Shaw Stewart]

(see http://pdbwiki.org/) They are now directing people to
> Proteopedia. However Proteopedia has a more educative focus I think -
> rather than capturing technical questions and input.
>
>
>
> Pubmed commons (http://www.ncbi.nlm.nih.gov/pubmedcommons/), which is a
> forum for discussing the literature, is currently under testing. Perhaps
> this is the sort of thing that could work for structural data?
>
>
>
> cheers
>
>  Martyn
>
>
> --
>
> *From:* Ethan A Merritt 
> *To:* CCP4BB@JISCMAIL.AC.UK
> *Sent:* Wednesday, 14 May 2014, 19:22
> *Subject:* Re: [ccp4bb] PDB passes 100,000 structure milestone
>
>
> On Wednesday, 14 May, 2014 13:52:02 Phil Jeffrey wrote:
> > As long as it's just a Technical Comments section - an obvious concern
> > would be the signal/noise in the comments themselves.  I'm sure PDB
> > would not relish having to moderate that lot.
> >
> > Alternatively PDB can overtly link to papers that discuss technical
> > issues that reference the particular structure - wrong or fraudulent
> > structures are often associated with refereed publications that point
> > that out, and structures with significant errors often show up in that
> > way too.  I once did a journal club on Muller (2013) Acta Cryst
> > F69:1071-1076 and wish that could be associated with the relevant PDB
> > file(s).
>
> Perhaps some combination of those two ideas?
>
> The PDB could associate with each deposited structure  a crowd-sourced
> list of published articles citing it.They already make an effort to
> attach the primary citation, but so far as I know there is currently
> no effort to track subsequent citations.
>
> While spam comments in a free-format forum are probably inevitable,
> spam submission of citing papers seems less likely to be a problem.
>
> - Ethan
>
> > > On Wed, May 14, 2014 at 12:32 PM, Zachary Wood  > > <mailto:z...@bmb.uga.edu>> wrote:
> > >
> > >Hello All,
> > >
> > >Instead of placing the additional burden of policing on the good
> > >people at the PDB, perhaps the entry page for each structure could
> > >contain a comments section. Then the community could point out
> > >serious concerns for the less informed users. At least that will
> > >give users some warning in the case of particularly worrisome
> > >structures. The authors of course could still reply to defend their
> > >structure, and it may encourage some people to even correct their
> > >errors.
> > >
> --
> Ethan A Merritt
> Biomolecular Structure Center,  K-428 Health Sciences Bldg
> MS 357742,  University of Washington, Seattle 98195-7742
>
>
>



-- 
 patr...@douglas.co.ukDouglas Instruments Ltd.
 Douglas House, East Garston, Hungerford, Berkshire, RG17 7HD, UK
 Directors: Peter Baldock, Patrick Shaw Stewart

 http://www.douglas.co.uk
 Tel: 44 (0) 148-864-9090US toll-free 1-877-225-2034
 Regd. England 2177994, VAT Reg. GB 480 7371 36

Re: [ccp4bb] PDB passes 100,000 structure milestone

[Patrick Shaw Stewart]

I may be missing something here, but I don't think you have to rebut
anything.  You simply report that someone else has rebutted it.  Along the
lines of

Many scientists regard this published structure as unreliable since a
misconduct investigation by the University of Alabama at Birmingham has
concluded that it
was, "more likely than not", faked [1]

[1] http://www.nature.com/news/2009/091222/full/462970a.html






On 15 May 2014 18:00, Nat Echols  wrote:

> On Thu, May 15, 2014 at 9:53 AM, Patrick Shaw Stewart <
> patr...@douglas.co.uk> wrote:
>
>> It seems to me that the Wikipedia mechanism works wonderfully well.  One
>> rule is that you can't make assertions yourself, only report pre-existing
>> material that is attributable to a "reliable published source".
>>
>
> This rule would be a little problematic for annotating the PDB.  It
> requires a significant amount of effort to publish a peer-reviewed article
> or even just a letter to the editor, and none of us are being paid to write
> rebuttals to dodgy structures.
>
> -Nat
>



-- 
 patr...@douglas.co.ukDouglas Instruments Ltd.
 Douglas House, East Garston, Hungerford, Berkshire, RG17 7HD, UK
 Directors: Peter Baldock, Patrick Shaw Stewart

 http://www.douglas.co.uk
 Tel: 44 (0) 148-864-9090US toll-free 1-877-225-2034
 Regd. England 2177994, VAT Reg. GB 480 7371 36

Re: [ccp4bb] PDB passes 100,000 structure milestone

[Patrick Shaw Stewart]

Hi Joel and Jaime - very nice to hear from you.  I hope everything is going
well in Rehovot.

Proteopedia is the natural place to put comments etc.  However it might
look more natural if there was more info there in the first place - ie if
people gave more explanation about the significance of their and other
people's structures, then comments like the one I suggested could be added.
 I don't know how you get people to become more active at Proteopedia.
 Maybe your students could post occasional messages to eg the CCP4bb with
comments that show how useful Proteopedia can be.  Tricky though!

Best wishes, Patrick




On 16 May 2014 14:35, Joel Sussman  wrote:

>  16-May-2014
> Dear Patrick,
> *Proteopedia* [*http://proteopedia.org] <http://proteopedia.org%5D>* uses
> exactly the same style for referencing published material.
>
>  *Proteopedia* allows for the easy insertion of Pubmed and DOI references
> by only requesting from the user to enter the Pubmed or DOI ids. We have
> extended the same software used in Wikipedia for the internal
> *Proteopedia* engine to, based on this reference ID, retrieve, format and
> insert the correctly formatted reference at the bottom of the page.
>
>  For example, *type PMID 18673581 or doi
> 10.1093/nar/gku213* in the wikitext box and save the page. If you
> type the reference in this manner, the properly formatted reference will be
> created automatically at the bottom of the page (or wherever you place the
> necessary wikitext "").
>
>  See *http://proteopedia.org/w/Help:Editing#Citing_Literature_References
> <http://proteopedia.org/w/Help:Editing#Citing_Literature_References>* and
> Proteopedia pages for actual examples.
> best regards,
> Jaime & Joel
>
> On 15May, 2014, at 13:48, Patrick Shaw Stewart 
> wrote:
>
>
> I may be missing something here, but I don't think you have to rebut
> anything.  You simply report that someone else has rebutted it.  Along the
> lines of
>
>  Many scientists regard this published structure as unreliable since a
> misconduct investigation by the University of Alabama at Birmingham has
> concluded that it
> was, "more likely than not", faked [1]
>
> [1] http://www.nature.com/news/2009/091222/full/462970a.html
>
>
>
>
>
>
> On 15 May 2014 18:00, Nat Echols  wrote:
>
>> On Thu, May 15, 2014 at 9:53 AM, Patrick Shaw Stewart <
>> patr...@douglas.co.uk> wrote:
>>
>>> It seems to me that the Wikipedia mechanism works wonderfully well.  One
>>> rule is that you can't make assertions yourself, only report pre-existing
>>> material that is attributable to a "reliable published source".
>>>
>>
>>  This rule would be a little problematic for annotating the PDB.  It
>> requires a significant amount of effort to publish a peer-reviewed article
>> or even just a letter to the editor, and none of us are being paid to write
>> rebuttals to dodgy structures.
>>
>>  -Nat
>>
>
>
>
>  --
>  patr...@douglas.co.ukDouglas Instruments Ltd.
>  Douglas House, East Garston, Hungerford, Berkshire, RG17 7HD, UK
>  Directors: Peter Baldock, Patrick Shaw Stewart
>
>  http://www.douglas.co.uk
>  Tel: 44 (0) 148-864-9090US toll-free 1-877-225-2034
>  Regd. England 2177994, VAT Reg. GB 480 7371 36
>
>
>


-- 
 patr...@douglas.co.ukDouglas Instruments Ltd.
 Douglas House, East Garston, Hungerford, Berkshire, RG17 7HD, UK
 Directors: Peter Baldock, Patrick Shaw Stewart

 http://www.douglas.co.uk
 Tel: 44 (0) 148-864-9090US toll-free 1-877-225-2034
 Regd. England 2177994, VAT Reg. GB 480 7371 36

Re: [ccp4bb] suggestion of crystallization optimization

[Patrick Shaw Stewart]

Hi Liuqing Chen

You have a lot of good suggestions, but everyone except for Janet has
missed out the most important suggestion, and Janet has called it something
funny - cross seeding often refers to something else.

You may well have a nucleation problem - that's to say many of your
screening experiments may be in the metastable zone of your protein's phase
diagram.

Try making a seedstock with your existing crystals and adding it to *random
*screens.  This can be combined with Janet's suggestions 2 (second part),
3, 4, 5, 7, 6 again, and 8.

For more information google MMS crystallization, or rMMS crystallization.

I hope it works - it very often does!

Good luck,

Patrick





On 4 June 2018 at 21:41, Janet Newman  wrote:

> Liuqing Chen,
>
> Everything that has been said seems reasonable, but there are always
> infinite possibilities in crystallisation, so it is more a question of
> priorities. Do the easy (or quick) things first. If you have buckets of
> prepared protein then what you will try first might be different than if
> you have to go and make your protein from scratch each time you set up
> crystal trays.
>
> 1. If you have crystals from an additive screen or seeding - try putting
> them in the beam. If you have access to in-plate screening, you can test
> the crystals without disturbing them, which will give the best idea of
> their native diffraction. Perhaps one of the ugly crystals diffracts well
> enough?
>
> 2. Try cross seeding - seed one or more initial screen(s) (rather than an
> optimisation).  Try initial screening with seeding at different
> temperatures. If you are currently using vapour diffusion, try microbatch.
> Or vice versa.
>
> 3. Try in-situ proteolysis. Add a very small amount of protease to your
> protein sample (chymotrypsin is traditional) - say 1:10,000 or 1:1000
> compared to your protein concentration then set up that mixture in initial
> screens.
>
> 4. Is there a ligand/inhibitor/other small molecule that binds? Add that
> to your protein before crystallisation. Maybe even try this first!
>
> 5. Lysine methylation/cysteine modification/other side chain modifications.
>
> 6. Try using DSF or some other technique to look at your protein's
> stability in the formulation it is in. Maybe you can make happier protein
> by changing the pH, buffer or salt.
>
> 7. If you want to be a little more rigorous, take your protein, and a
> number of different proteases, and do a time-course experiment with each
> protease (add 1:1000 protease to your protein, then take samples at
> timepoints - say 0.5 hours, 1 hour, 5 hours and overnight) then run out on
> a gel (or analyse by MS) and see if you come down to a stable fragment. If
> you do - then use that protease, and while you are waiting for the
> crystallisation trials to do their thing, find out what the end points of
> the proteolysis fragment are, and make that construct.
>
> 6. Try a different expression system (different tag, different position of
> the tag, cleave/don't cleave the tag). If the protein is produced in a
> eukaryotic system (and is glycosylated) try a different one to get
> different glycosylation pattern. Try kifunensine treated cells if you are
> in a mammalian expression system.
>
> 8. Try the same protein from other species
>
> Janet Newman
> Principal Scientist / Director, Collaborative Crystallisation Centre (C3)
> CSIRO Material Science and Engineering
> 343 Royal Parade
> Parkville.  VIC. 3052
> Australia
> Tel +613 9662 7326
> Email janet.new...@csiro.au
>
> 
> From: CCP4 bulletin board  on behalf of Liuqing
> Chen <519198...@163.com>
> Sent: 04 June 2018 20:57
> To: CCP4BB@JISCMAIL.AC.UK
> Subject: [ccp4bb] suggestion of crystallization optimization
>
> Hello everyone!
>
> I get a crystal several months ago, but the crystals diffraction very low
> resolution (around 8A)  or no diffraction.
>   My sample buffer is 20mm Hepes ph7.0,  50mm NaCl,   my protein pI is 5.
>   the codition grow crytal  is : 30% PEG400, 100mm hepes 7.5,  200mm MgCl2.
>
> I also tried  additive screen,  all the crystals appear the same
> apparence,even i seeding optimization,  have no improve.
> the  attach is  my crystals.
>
> what should   i  do next?
>
> thanks in advance.
> sincerely
> Liuqing chen
>
> 
>
> To unsubscribe from the CCP4BB list, click the following link:
> https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB&A=1
>
> ########
>
> To unsubscribe from the CCP4BB list, click the following link:
> https://www.jiscmail

Re: [ccp4bb] Oxford University Press

[Patrick Shaw Stewart]

ofit is above 10 per cent. Elsevier is the place to start as their profit
> margins are like those of Apple, and of competition there is none.
>
>
> Elsevier: Like Apple, but without the design sense.
>
>
> But seriously, Adrian makes an excellent point. And the large profit
> margins wouldn’t be quite so galling, if only the publishers were able to
> provide competent and helpful administrative support; but in my recent
> experience, not-for-profit scientific society journals are actually
> providing better experiences for reviewers and authors than the big
> commercial ones.
>
> Pat
>
> 
> ---
>
> Patrick J. Loll, Ph. D.
>
> Professor of Biochemistry & Molecular Biology
>
> Drexel University College of Medicine
>
> Room 10-102 New College Building
>
> 245 N. 15th St
> <https://maps.google.com/?q=245+N.+15th+St&entry=gmail&source=g>.,
> Mailstop 497
>
> Philadelphia, PA  19102-1192  USA
>
>
> (215) 762-7706
>
> pjl...@gmail.com
>
> pj...@drexel.edu
>
> To unsubscribe from the CCP4BB list, click the following link:
> https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB&A=1
>
>
>
> --
> Prof. George M. Sheldrick FRS
> Dept. Structural Chemistry,
> University of Goettingen,
> Tammannstr. 4,
> D37077 Goettingen, Germany
> Tel. +49-551-39-33021 or +49-5594-227312
>
>
> ------
>
> To unsubscribe from the CCP4BB list, click the following link:
> https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB&A=1
>



-- 
 patr...@douglas.co.ukDouglas Instruments Ltd.
 Douglas House, East Garston, Hungerford, Berkshire, RG17 7HD, UK
 Directors: Peter Baldock, Patrick Shaw Stewart

 http://www.douglas.co.uk
 Tel: 44 (0) 148-864-9090US toll-free 1-877-225-2034
 Regd. England 2177994, VAT Reg. GB 480 7371 36



To unsubscribe from the CCP4BB list, click the following link:
https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB&A=1

Re: [ccp4bb] Please share your experience about "ugly" crystals showing good diffraction

[Patrick Shaw Stewart]

Hi All

I have a comment, based on my old supervisor's explanation, which seemed to
make sense.

Crystals usually grow layer by layer.  Once a new layer is formed it
quickly expands to cover the whole surface.  That's why crystals normally
have flat surfaces and sharp edges - the layers/steps expand rapidly until
they get to the edges.

However it doesn't have to be like that.  Sometimes new layers can form
roughly as quickly as the previous layers can spread.  The result is
crystals with curved surfaces - or even just blobs.

Just because the new layers form at a rate that is comparable to the
spreading doesn't mean that the crystals won't be ordered, and won't
diffract well.

Once I understood that I understood what I was seeing better when I checked
my drops.

Best wishes Patrick


On 5 July 2018 at 22:06, Sanishvili, Ruslan  wrote:

> Hi Anirban,
>
> It would be great if you could share the compilation of relevant responses
> to your request. I think many others in the community could use these
> examples for educational purposes.
>
> Best,
>
> Nukri
>
>
> Ruslan Sanishvili (Nukri), Ph.D.
> Macromolecular Crystallographer
> GM/CA@APS
> X-ray Science Division, ANL
> 9700 S. Cass Ave.
> Lemont, IL 60439
>
> Tel: (630)252-0665
> Fax: (630)252-0667
> rsanishv...@anl.gov
>
>
>
> --
> *From:* CCP4 bulletin board  on behalf of Anirban
> Banerjee 
> *Sent:* Thursday, June 28, 2018 7:07 PM
> *To:* CCP4BB@JISCMAIL.AC.UK
> *Subject:* [ccp4bb] Please share your experience about "ugly" crystals
> showing good diffraction
>
>
> Dear all,
>
> Apologies for the non-CCP4 related question.
>
> If you have concrete experience about visually unappealing, i.e. ugly
> crystals ( your own take on ugly is fine)  diffracting better than
> comparably similar sized nicer looking crystals of the same protein, will
> you please share here ? Even better if that led to a published structure.
> Might you also have pictures ?
>
> We have all heard anecdotes about not using visual appearance to judge the
> quality of crystals as far as their ability to give good diffraction data
> is concerned but I am trying to gather some concrete pointers here to
> motivate trainees.
>
> Thanks very much for any help.
>
> Best,
>
> Anirban
>
> P.S. I know that there is probably a lot of thought and wisdom  on this
> this specific topic but I am really looking for actual experience.
>
> --
>
> To unsubscribe from the CCP4BB list, click the following link:
> https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB&A=1
>
> --
>
> To unsubscribe from the CCP4BB list, click the following link:
> https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB&A=1
>



-- 
 patr...@douglas.co.ukDouglas Instruments Ltd.
 Douglas House, East Garston, Hungerford, Berkshire, RG17 7HD, UK
 Directors: Peter Baldock, Patrick Shaw Stewart

 http://www.douglas.co.uk
 Tel: 44 (0) 148-864-9090US toll-free 1-877-225-2034
 Regd. England 2177994, VAT Reg. GB 480 7371 36



To unsubscribe from the CCP4BB list, click the following link:
https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB&A=1

Re: [ccp4bb] Fishing crystals from volatile solvent as precipitant

[Patrick Shaw Stewart]

Hi Thomas

One problem with conventional approaches is that you tend to get high
mosaicity when harvesting from drops with isopropanol.

A very good method, invented by my old friend Lesley Haire, that has always
worked (so far!) is to use microbatch-under-oil with a plate called the
Vapor Batch plate.

   - Set up the drops with everything in them except for the isopropanol.


   - Cover the drops with 50:50 paraffin and silicone oil ("Al's Oil").


   - Put a few mL of 27% isopropanol in the "moat" around the outside of
   the plate.


The isopropanol will saturate the oil and then diffuse into the drops.  You
can take your time and harvest the crystals through the oil. The oil
protects the crystals, preventing evaporation of isopropanol.

Let me know if you (or anyone) would like some sample plates to try this
out.

See example and ref. below.

Best wishes, Patrick

___


Example: https://www.douglas.co.uk/winner1.htm

*G. B. Mortuza et al.. High-resolution structure of a retroviral capsid
hexameric amino-terminal domain.  Nature 431 (2004), pp 481-485. (This
paper describes the use of the vapor batch plate with isopropanol.)*

Sent from mobile

Patrick Shaw Stewart
+44 7901 548 201

On Wed, 15 Aug 2018, 08:41 Yvonne Thielmann,  wrote:

> Dear Thomas,
>
> maybe you can try to overlay your drop with LV CryoOil from Jena
> Bioscience. Then the evaporation of the solvent is slowed down and the
> crystals are directly cryoprotected when you move the crystals through
> the oil. We had quite good results when we cryoprotected crystals in
> this oil.
>
> Best wishes,
> Yvonne
>
>
> --
> Dr. Yvonne Thielmann
> Max Planck Institute of Biophysics
> Molecular Membrane Biology
> Max-von-Laue-Strasse 3
> 60438 Frankfurt / Main
> Germany
>
> Office +49 69 6303 1056
> Lab +49 69 6303 1074
> Fax +49 69 6303 1002
>
> Am 15.08.2018 um 08:05 schrieb Kajander, Tommi A:
> > Yes sorry, i meant paratone-N also.
> >
> > Tommi
> >
> > Kohteesta: ferrer
> > Lähetetty: keskiviikko 15. elokuuta klo 0.41
> > Aihe: Re: [ccp4bb] Fishing crystals from volatile solvent as precipitant
> > Vastaanottaja: ccp4bb@jiscmail.ac.uk
> >
> >
> > Dear Thomas,
> >
> > Alternatively you can try shooting on crystals in the drop, in situ. So
> > fishing, no cryo. But potentially high radiation damage. Can be
> > considered if you have enough crystals, and if your crystallization
> > plate makes it possible.
> >
> > Regards
> >
> > JL
> >
> > On 14/08/2018 20:58, Thomas Krey wrote:
> > Dear crystallization experts,
> >
> > We have 3D protein crystals grown from a microseed matrix screening
> > vapor diffusion experiment in either
> >
> > 15% (v/v) Reagent alcohol
> > HEPES Na pH 7.5
> > 0.2 M MgCl2
> >
> > or in
> >
> > 27% Isopropanol
> > 0.18 M MgCl2
> > 90 mM HEPES Na pH 7.5
> > 10% Glycerol
> >
> > Upon opening the corresponding wells these crystals move quite a bit –
> > presumably due to the volatility of the alcohols. Does anyone have a
> > good suggestion to stabilize the swirling movements? Does anyone have
> > experience, whether these conditions alone can serve as cryo-protectant
> > (i.e., do we really have to fish, move into cryo solution and fish
> again)?
> > Any suggestion or input would be highly welcome.
> >
> > Thank you very much in advance.
> >
> > Thomas
> >
> >
> > Prof. Dr. Thomas Krey
> > Hannover Medical School
> > Institute of Virology
> > Structural Virology Group
> > Carl-Neuberg-Str. 1
> > D-30625 Hannover
> > phone: +49 (0) 511 - 532 4308
> > email: krey.tho...@mh-hannover.de <mailto:krey.tho...@mh-hannover.de>
> >
> >
> > To unsubscribe from the CCP4BB list, click the following link:
> > https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB&A=1
> >
> > --  Jean-Luc Ferrer Institut de
> Biologie
> > Structurale 71 Avenue des Martyrs CS 10090 38044 Grenoble Cedex 9 -
> > FRANCE Ph.: +33 (0)4 57 42 85 22 Cell: +33 (0)6 89 45 13 57 email:
> > jean-luc.fer...@ibs.fr <mailto:jean-luc.fer...@ibs.fr>
> > 
> > To unsubscribe from the CCP4BB list, click the following link:
> > https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB&A=1
> >
> >
> >
> > 
> >
> > To unsubscribe from the CCP4BB list, click the following link:
> > https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB&A=1
> >
>
> 
>
> To unsubscribe from the CCP4BB list, click the following link:
> https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB&A=1
>



To unsubscribe from the CCP4BB list, click the following link:
https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB&A=1

Re: [ccp4bb] crystals that dont diffract :( :(

[Patrick Shaw Stewart]

Hi Careina

Expanding on what Tim says, try crushing your crystals to make a seed
stock, and adding it to a few *random screens - *preferably screens that
you have already tried with this target.

Search for instructions for MMS or rMMS online.

Good luck,

Patrick



On 14 August 2018 at 11:34, Tim Gruene  wrote:

> Dear Careina,
>
> you could use the old crystals, that did not diffract, for microseeding
> to regrew nicer crystals. Once you have them, try to use them as quickly
> as possible. Three weeks can be a long time for crystals.
>
> Storage in liquid nitrogen should not be the problem.
>
> Best,
> Tim
>
>
> On 08/14/2018 11:58 AM, Careina Edgooms wrote:
> > I got the most beautiful crystals I have ever seen and they don't
> > diffract at all. Not poor diffraction, NO diffraction. Anyone know why
> > this could be and how I can go about fixing it? I had three beautiful
> > crystals and not one diffracted. I did leave them in the drop for about
> > 3 weeks before harvesting and in liquid nitrogen for about a month
> > before diffracting. Could that be a factor? If I regrew more beautiful
> > crystals and diffracted straight away could that help?
> > Careina
> >
> > 
> >
> > To unsubscribe from the CCP4BB list, click the following link:
> > https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB&A=1
> >
>
> --
> --
> Paul Scherrer Institut
> Tim Gruene
> - persoenlich -
> OSUA/204
> CH-5232 Villigen PSI
> phone: +41 (0)56 310 5297
>
> GPG Key ID = A46BEE1A
>
>
> 
>
> To unsubscribe from the CCP4BB list, click the following link:
> https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB&A=1
>



-- 
 patr...@douglas.co.ukDouglas Instruments Ltd.
 Douglas House, East Garston, Hungerford, Berkshire, RG17 7HD, UK
 Directors: Peter Baldock, Patrick Shaw Stewart

 http://www.douglas.co.uk
 Tel: 44 (0) 148-864-9090US toll-free 1-877-225-2034
 Regd. England 2177994, VAT Reg. GB 480 7371 36



To unsubscribe from the CCP4BB list, click the following link:
https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB&A=1

Re: [ccp4bb] Is there any alternative to siliconized glass coverslips for crystallization?

[Patrick Shaw Stewart]

https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB&A=1
> >
> >
> > ########
> >
> > To unsubscribe from the CCP4BB list, click the following link:
> > https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB&A=1
>
>
> 
>
> To unsubscribe from the CCP4BB list, click the following link:
> https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB&A=1
>


-- 
 patr...@douglas.co.ukDouglas Instruments Ltd.
 Douglas House, East Garston, Hungerford, Berkshire, RG17 7HD, UK
 Directors: Peter Baldock, Patrick Shaw Stewart

 http://www.douglas.co.uk
 Tel: 44 (0) 148-864-9090US toll-free 1-877-225-2034
 Regd. England 2177994, VAT Reg. GB 480 7371 36



To unsubscribe from the CCP4BB list, click the following link:
https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB&A=1

Re: [ccp4bb] challenges in structural biology

[Patrick Shaw Stewart]

unding is hard to get, but
> crystallization seems to me like the absolute underdog of the method pool -
> the true 'red headed stepchild' of the methods development funders.
>
> At risk of repeating myself - the other problems (worthy, significant, and
> urgent as they are!) are subservient to the main issue at hand - namely
> that crystallization remains an unpredictable and artful phenomenon while
> literally all other aspects of structure determination process (the gene to
> structure pipeline, whatever you might call it)have made astronomic leaps
> forward.
>
> Artem
> - Cosmic Cats approve of this message
>
>
> On Mon, Jul 15, 2019 at 3:44 PM Holton, James M <
> 270165b9f4cf-dmarc-requ...@jiscmail.ac.uk> wrote:
>
>> Hello folks,
>>
>> I have the distinct honor of chairing the next Gordon Research
>> Conference on Diffraction Methods in Structural Biology (July 26-31
>> 2020).  This meeting will focus on the biggest challenges currently
>> faced by structural biologists, and I mean actual real-world
>> challenges.  As much as possible, these challenges will take the form of
>> friendly competitions with defined parameters, data, a scoring system,
>> and "winners", to be established along with other unpublished results
>> only at the meeting, as is tradition at GRCs.
>>
>> But what are the principle challenges in biological structure
>> determination today?  I of course have my own ideas, but I feel like I'm
>> forgetting something.  Obvious choices are:
>> 1) getting crystals to diffract better
>> 2) building models into low-resolution maps (after failing at #1)
>> 3) telling if a ligand is really there or not
>> 4) the phase problem (dealing with weak signal, twinning and
>> pseudotranslation)
>> 5) what does "resolution" really mean?
>> 6) why are macromolecular R factors so much higher than small-molecule
>> ones?
>> 7) what is the best way to process serial crystallography data?
>> 8) how should one deal with non-isomorphism in multi-crystal methods?
>> 9) what is the "structure" of something that won't sit still?
>>
>> What am I missing?  Is industry facing different problems than
>> academics?  Are there specific challenges facing electron-based
>> techniques?  If so, could the combined strength of all the world's
>> methods developers solve them?  I'm interested in hearing the voice of
>> this community.  On or off-list is fine.
>>
>> -James Holton
>> MAD Scientist
>>
>>
>> 
>>
>> To unsubscribe from the CCP4BB list, click the following link:
>> https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB&A=1
>>
>
> --
>
> To unsubscribe from the CCP4BB list, click the following link:
> https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB&A=1
>


-- 
 patr...@douglas.co.ukDouglas Instruments Ltd.
 Douglas House, East Garston, Hungerford, Berkshire, RG17 7HD, UK
 Directors: Peter Baldock, Patrick Shaw Stewart

 http://www.douglas.co.uk
 Tel: 44 (0) 148-864-9090US toll-free 1-877-225-2034
 Regd. England 2177994, VAT Reg. GB 480 7371 36



To unsubscribe from the CCP4BB list, click the following link:
https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB&A=1

Re: [ccp4bb] challenges in structural biology

[Patrick Shaw Stewart]

On a completely different tack, isn’t the most pressing requirement in
current structural biology a really good method of characterizing
macromolecular samples *before *they are put onto cryoEM grids – ie
analysing *and screening them *in solution.

For one thing I’m told those huge microscopes are quite prone to breaking
down, which makes the queues (lines) to get onto them even longer.

That method might be (micro-scale) DLS – or something completely different.

Thx, Patrick


On Mon, Jul 15, 2019 at 8:44 PM Holton, James M <
270165b9f4cf-dmarc-requ...@jiscmail.ac.uk> wrote:

> Hello folks,
>
> I have the distinct honor of chairing the next Gordon Research
> Conference on Diffraction Methods in Structural Biology (July 26-31
> 2020).  This meeting will focus on the biggest challenges currently
> faced by structural biologists, and I mean actual real-world
> challenges.  As much as possible, these challenges will take the form of
> friendly competitions with defined parameters, data, a scoring system,
> and "winners", to be established along with other unpublished results
> only at the meeting, as is tradition at GRCs.
>
> But what are the principle challenges in biological structure
> determination today?  I of course have my own ideas, but I feel like I'm
> forgetting something.  Obvious choices are:
> 1) getting crystals to diffract better
> 2) building models into low-resolution maps (after failing at #1)
> 3) telling if a ligand is really there or not
> 4) the phase problem (dealing with weak signal, twinning and
> pseudotranslation)
> 5) what does "resolution" really mean?
> 6) why are macromolecular R factors so much higher than small-molecule
> ones?
> 7) what is the best way to process serial crystallography data?
> 8) how should one deal with non-isomorphism in multi-crystal methods?
> 9) what is the "structure" of something that won't sit still?
>
> What am I missing?  Is industry facing different problems than
> academics?  Are there specific challenges facing electron-based
> techniques?  If so, could the combined strength of all the world's
> methods developers solve them?  I'm interested in hearing the voice of
> this community.  On or off-list is fine.
>
> -James Holton
> MAD Scientist
>
>
> 
>
> To unsubscribe from the CCP4BB list, click the following link:
> https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB&A=1
>


-- 
 patr...@douglas.co.ukDouglas Instruments Ltd.
 Douglas House, East Garston, Hungerford, Berkshire, RG17 7HD, UK
 Directors: Peter Baldock, Patrick Shaw Stewart

 http://www.douglas.co.uk
 Tel: 44 (0) 148-864-9090US toll-free 1-877-225-2034
 Regd. England 2177994, VAT Reg. GB 480 7371 36



To unsubscribe from the CCP4BB list, click the following link:
https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB&A=1

Re: [ccp4bb] challenges in structural biology

[Patrick Shaw Stewart]

I take the view that I'm trying to communicate with as many people as
possible, without distracting them with my spelling . . . So go for US
spellings.

Sent from mobile

On Tue, 23 Jul 2019, 22:39 Goldman, Adrian, 
wrote:

> ..and responding in the same vein:
>
> my OED says that its etymology also comes from the Latin sulfur, sulphura
> in the plural.  So there is an etymological basis for the ph, even if it
> doesn’t come from Greek.
>
> Plus, since when has etymological logic has _anything_ to do with English
> spelling?
>
> Finally, it may be how the RSC is spelling it, but I would take a fair bet
> that writers of English prose today (pace America), contemplating an stinky
> inferno, will write “sulphurous flames”, not the unattractive and less
> stinky “sulfurous ones”.
>
> Adrian
>
>
> On 23 Jul 2019, at 22:21, CCP4BB <
> 193323b1e616-dmarc-requ...@jiscmail.ac.uk> wrote:
>
> Hi
>
> Going off at a tangent...
>
> The accepted spelling by the Royal Society of Chemistry (i.e. the
> professional body representing chemists in the U.K.) since at least the
> early 1990s has been "sulfate" too. "Sulphur", etc, has been deprecated for
> quite some time. Why? Well, there's no good etymological reason for the
> "ph" in "sulphate". My 1984 copy of Greenwood and Earnshaw's "Chemistry of
> the Elements", written in Yorkshire, uses "sulfur" etc throughout.
>
> "Phosphorus" comes from the Greek, so retains the "ph"s on both sides of
> the pond.
>
> Element 13 appears to have started life as "alumium", mutated to
> "aluminum", and finally (in the English speaking world outside North
> America) settled down as "aluminium".
>
> Harry
> --
> Dr Harry Powell
>
> On 23 Jul 2019, at 17:12, Engin Özkan  wrote:
>
> On 7/23/19 3:35 AM, melanie.voll...@diamond.ac.uk wrote:
>
> No longer those 20 odd names for ammonium sulphate
>
>
> You mean ammonium *sulfate*. As it is called across the pond. :)
>
> On a related note on common nomenclature for recording crystallization
> experiments that Janet brought up:
>
> I find it odd that we still do not report cryo-protection methods and
> conditions in PDB depositions. Given that a large fraction of the small
> molecules observed in crystal structures are derived from the
> cryo-protectants, one would think that reporting the contents of that
> solution (and pH) would be paramount to a PDB deposition. Surely, the
> crystallographic experiment has changed since 1990/use of synchrotron
> sources, which PDB has adjusted well to in most other aspects (e.g.,
> including reporting of synchrotron x-ray optics and all the new
> detectors during submission).
>
> Engin
>
>
> 
>
> To unsubscribe from the CCP4BB list, click the following link:
> https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB&A=1
>
>
> --
>
> To unsubscribe from the CCP4BB list, click the following link:
> https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB&A=1
>
>
>
> --
>
> To unsubscribe from the CCP4BB list, click the following link:
> https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB&A=1
>



To unsubscribe from the CCP4BB list, click the following link:
https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB&A=1

Re: [ccp4bb] challenges in structural biology

[Patrick Shaw Stewart]

I have regularly been struck by how closely related proteins crystallize in
completely different conditions. Eg see Galina Obmolova and colleagues'
excellent paper (ref below).  A set of sixteen highly homologous Fabs were
crystallized in apparently random conditions.  Roughly half used PEG, half
high-salt conditions, salts used included sulfate (sic!), formate, citrate,
acetate, tartrate, chloride etc etc, while pHs ranged from 4.5 to 9.5.

I also once downloaded the entire PDB and looked for correlations between
the reported crystallization conditions and the (summed) areas of every
atom of every residue on the surface of the proteins.  I came up with . . .
hmm  . . absolutely nothing useful.

I conclude that we need to start with regular screening for pretty much
every new sample that we have - so an unbiased empirical approach is the
only good way to go.

Thx Patrick


Galina ref - Obmolova, G., et al. "Protein crystallization with microseed
matrix screening: application to human germline antibody Fabs." *Acta
Crystallographica Section F: Structural Biology Communications* 70.8
(2014): 1107-1115.



On Tue, 23 Jul 2019, 23:53 Newman, Janet (Manufacturing, Parkville),
 wrote:

> There are a bunch of people doing this – in the small molecule world. And
> a lot of work has been done on some very robust protein systems too. Can
> you guess which ones?
>
>
>
> The real issue (at the moment) is that all the pre-work needed to predict
> if or how a protein might crystallise takes more work and more protein than
> setting up crystallisation experiments.
>
> How many people do DSL on protein in a crystallisation screen, for
> example? Or do self-association chromatography to determine the B22 (which
> changes under different conditions, naturally). Or try mapping out a phase
> diagram (for each condition)?
>
>
>
> Many people are not even aware that a simple PCT can help one work out a
> sensible starting concentration for crystallisation trials.
>
>
>
> As for AI, at the moment unsupervised learning doesn’t seem to do much,
> which means we need vast, well annotated datasets to make progress. MARKO,
> which Sarah mentioned, required half a million scored images, which took
> years to get together.
>
>
>
> Janet
>
>
>
> *From:* CCP4 bulletin board  *On Behalf Of *Keller,
> Jacob
> *Sent:* Wednesday, 24 July 2019 4:18 AM
> *To:* CCP4BB@JISCMAIL.AC.UK
> *Subject:* Re: [ccp4bb] challenges in structural biology
>
>
>
> What about developing a theory of how crystallization happens, i.e., what
> does the microscopic “picture” look like when crystals are forming, then
> predicting based on that picture? I remember looking into these things
> about ten years ago, and there were some cool things being done with
> various scattering methods and with AFM, but am not sure now what is the
> state of that art.
>
>
>
> It would seem to me that crystallization is the search for intermolecular
> docking sites of sufficiently good (albeit presumably weak) affinity and
> consistent with the formation of a 3D lattice. I wonder what the affinity
> of these sites is, actually—I guess somewhere in the micromolar range,
> based on usual protein concentrations under crystallization conditions (10
> mg/ml of a 40 kD protein is 250 uM).
>
>
>
> Presumably the various docking sites would change affinity based on the
> crystallization conditions, which would explain why some crystallization
> conditions work, others don’t?
>
>
>
> Maybe a systematic look at all crystallization contacts in the PDB might
> yield some insight into crystallization? Maybe it’s already been done?
>
>
>
> JPK
>
>
> --
>
> To unsubscribe from the CCP4BB list, click the following link:
> https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB&A=1
>
> --
>
> To unsubscribe from the CCP4BB list, click the following link:
> https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB&A=1
>



To unsubscribe from the CCP4BB list, click the following link:
https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB&A=1

Re: [ccp4bb] Importance of temperature during initial crystallization screening

[Patrick Shaw Stewart]

Hi Sergei

We did some data-mining on this way, way back, in 2004.

See the second section in this link

https://www.douglas.co.uk/PDB_data.htm


When you consider the *non-standard *temps - ie NOT 4C or 20C - it *looks*
as though the higher-end temps *may *work better.  But of course it's hard
to make sense of the results of a martingale.

Thx Patrick

PS Janet (Newman) do you have anything more up-to-date on this?



On Thu, Aug 1, 2019 at 10:24 AM Sergei Strelkov 
wrote:

> Dear all,
>
>
> I wondered if someone could point me to a recent study on the importance
> of temperature during initial search for crystallization conditions. It
> would be interesting to see any real statistics on this subject.
>
>
> We typically try to perform screening at at two temperatures, such as
> duplicating a given kit screen at 20C and 4C if there is enough sample. My
> 'gut feeling' is that this is not as important as sampling the chemical
> space though.
>
>
> Thank you!
>
> Sergei
>
>
> Prof. Sergei V. Strelkov Laboratory for Biocrystallography Department of 
> Pharmaceutical Sciences, KU Leuven O&N2, Campus Gasthuisberg, Herestraat 49 
> bus 822, 3000 Leuven, Belgium Phone: +32 16 33 08 45, mobile: +32 486 29 41 
> 32 Lab pages: http://pharm.kuleuven.be/Biocrystallography 
> <http://pharm.kuleuven.be/anafar>
>
>
> --
>
> To unsubscribe from the CCP4BB list, click the following link:
> https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB&A=1
>


-- 
 patr...@douglas.co.ukDouglas Instruments Ltd.
 Douglas House, East Garston, Hungerford, Berkshire, RG17 7HD, UK
 Directors: Peter Baldock, Patrick Shaw Stewart

 http://www.douglas.co.uk
 Tel: 44 (0) 148-864-9090US toll-free 1-877-225-2034
 Regd. England 2177994, VAT Reg. GB 480 7371 36



To unsubscribe from the CCP4BB list, click the following link:
https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB&A=1

Re: [ccp4bb] Optimization from needle shaped crystals

[Patrick Shaw Stewart]

Hi Chitra

Needles usually work very well for making seed stocks for random Microseed
Matrix Screening (MMS).  Your protein probably crystallizes well, but it is
growing too fast in one direction.

MMS has lots of advantages.  If it's going to work it will almost certainly
work within 12 hours.  Also, it allows you to control the number of
crystals per drop by diluting the seed stock.

Another excellent (open-access) paper that gives lots of examples of
seeding, cross-seeding, dilution, optimization etc within a defined set of
fabs is here:

https://scripts.iucr.org/cgi-bin/paper?nj5193


Good luck, Patrick



On Sun, Sep 8, 2019 at 1:46 PM David Briggs 
wrote:

> 4. Matrix microseeding. Make a seed stock from these crystals and then
> re-run your primary screens.
>
> https://www.ncbi.nlm.nih.gov/m/pubmed/25195878/
>
> --
> Dr David C. Briggs
> Senior Laboratory Research Scientist
> Signalling and Structural Biology Lab
> The Francis Crick Institute
> London, UK
> ==
> about.me/david_briggs
>
> --
> *From:* CCP4 bulletin board  on behalf of chitra
> latka 
> *Sent:* Sunday, September 8, 2019 12:12:28 PM
> *To:* CCP4BB@JISCMAIL.AC.UK 
> *Subject:* Re: [ccp4bb] Optimization from needle shaped crystals
>
> I can share what has worked for my crystals :
>
> 1. You can put a grid across your condition with same or altered drop
> ratios.
>
> 2. You can try micro seeding. (This has given me the best results so far).
>
> 3. You can try Hampton's additive screen.
>
> On Sun, Sep 8, 2019 at 10:09 AM Prem Prakash  wrote:
>
>> Dear all,
>> Sorry for a trivial query. I am trying to Co-crystallize my protein with
>> its substrate (peptide) using commercial screenings. In one condition of
>> JCSG plus (Molecular Dimension) that contains  0.2 M Magnesium chloride
>> hexahydrate,  0.1 M Tris 8.5 50 % v/v Ethylene glycol, I got needle like
>> crystals (picture attached). Does anyone have idea to optimize such needles
>> into better crystals. I would appreciate all your suggestions.
>>
>> Thank you
>> With kind regards,
>> Prem Prakash  (Ph.D.)
>>
>>
>> --
>>
>> To unsubscribe from the CCP4BB list, click the following link:
>> https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB&A=1
>> <https://eur03.safelinks.protection.outlook.com/?url=https%3A%2F%2Fwww.jiscmail.ac.uk%2Fcgi-bin%2Fwebadmin%3FSUBED1%3DCCP4BB%26A%3D1&data=02%7C01%7C%7C9e5bd9b3c9e7485ed8af08d7344ee01c%7C4eed7807ebad415aa7a99170947f4eae%7C0%7C1%7C637035385686224007&sdata=635CdZ1OnWv%2BoTW6YrzI%2BJaPg64OrVyWzz7p9HiAt2c%3D&reserved=0>
>>
>
>
> --
> Regards
> Chitra
>
> --
>
> To unsubscribe from the CCP4BB list, click the following link:
> https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB&A=1
> <https://eur03.safelinks.protection.outlook.com/?url=https%3A%2F%2Fwww.jiscmail.ac.uk%2Fcgi-bin%2Fwebadmin%3FSUBED1%3DCCP4BB%26A%3D1&data=02%7C01%7C%7C9e5bd9b3c9e7485ed8af08d7344ee01c%7C4eed7807ebad415aa7a99170947f4eae%7C0%7C1%7C637035385686234001&sdata=iT7qhIjkuHu1eO%2BqZMthtr4gWL%2B3pI0eYOfJOR0Jm9I%3D&reserved=0>
>
> The Francis Crick Institute Limited is a registered charity in England and
> Wales no. 1140062 and a company registered in England and Wales no.
> 06885462, with its registered office at 1 Midland Road London NW1 1AT
>
> ----------
>
> To unsubscribe from the CCP4BB list, click the following link:
> https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB&A=1
>


-- 
 patr...@douglas.co.ukDouglas Instruments Ltd.
 Douglas House, East Garston, Hungerford, Berkshire, RG17 7HD, UK
 Directors: Peter Baldock, Patrick Shaw Stewart

 http://www.douglas.co.uk
 Tel: 44 (0) 148-864-9090US toll-free 1-877-225-2034
 Regd. England 2177994, VAT Reg. GB 480 7371 36



To unsubscribe from the CCP4BB list, click the following link:
https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB&A=1

Re: [ccp4bb] Intergrown crystals and excess of nucleation

[Patrick Shaw Stewart]

Hi Nikolaus

I completely agree with Claude's comments.  Microseeding is the first thing
to try.  You would like to find conditions where you *don't *get crystals
without seeding, but you *do *get crystals with seeding.  Then, just by
diluting the seed stock, you can control nucleation.  Look at D'Arcy and
Obmolova's papers, links below (second time!).

I also agree that crystallization in agarose can work well - if seeding
doesn't solve your problem.

The only person that I know who tried containerless crystallization ended
up with more crystals rather than fewer.

Actually your case is not very unusual - when you scale up you tend to
get *more
*crystals.  The reason is that the surface-area-to-volume ratio is greater
for smaller drops.  This means that you lose a greater proportion of the
protein on the plastic or glass surface of your plate, and also on the
air-drop interface.  Therefore you should dilute the protein and/or the
precipitant when you scale up.

Good luck, Patrick

http://scripts.iucr.org/cgi-bin/paper?S2053230X14015507
https://scripts.iucr.org/cgi-bin/paper?nj5193



On Mon, Sep 9, 2019 at 4:45 PM Claude Sauter 
wrote:

> Le 09/09/2019 à 17:22, Nikolas a écrit :
>
> Dear crystalgrowers,
>
> I am currently working with a protein that appeared to be friendly but
> turned out it was not the case.
> I found myself to face -in the scale up- the opposite of the usual problem
> of nucleation (I really love how this topic finds new ways to make fun of
> me). In 24-well plates, hanging-drop, for the same condition but in
> different drops I found few big but intergrown crystals and/or a full with
> microcrystals. Sometimes also in the same well, when having more drops.
> I already decreased the concentration to less than 4mg/mL, made small
> adjustments in the optimizations - both with apo and ligand samples, used
> Al's oil.
>
> I have read about the "containerless crystallization" but since I cannot
> obtain the sample myself I would like to know if there are any experiences
> and/or if there are suggestions for solving this problem.
>
> Many thanks!
>
> Best regards,
> Nikolas
>
> --
>
> To unsubscribe from the CCP4BB list, click the following link:
> https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB&A=1
>
> Dear Nikolas,
>
> since you have some crystal stock, I would definitely try seeding to
> better control nucleation events in your drops. Then, instead of using the
> containerless approach which requires two types of oils to prepare floating
> drops, I suggest the crystallization in agarose gel. Easy to perform, it
> favors the 3D growth of well separated crystals in ideal convection-less
> conditions. In addition, the gel provides a physical protection of your
> crystals during handling, mounting and cryocooling. For more details, see 
> "Crystal
> growth of proteins, nucleic acids, and viruses in gels. Lorber et al. Prog.
> Biophys. Mol. Biol. (2009), 101: 13-25."
>
> Happy crystallization!
>
> Claude
>
> --
> Dr Claude Sauter
> Institut de Biologie Moléculaire et Cellulaire (IBMC-ARN-CNRS)
> Biologie des ARNt et pathogénicité  tel +33 (0)388 417 102
> 2 allée Conrad Roentgen fax +33 (0)388 602 218
> F-67084 Strasbourg - France  http://cj.sauter.free.fr/xtal
>
>
> --
>
> To unsubscribe from the CCP4BB list, click the following link:
> https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB&A=1
>


-- 
 patr...@douglas.co.ukDouglas Instruments Ltd.
 Douglas House, East Garston, Hungerford, Berkshire, RG17 7HD, UK
 Directors: Peter Baldock, Patrick Shaw Stewart

 http://www.douglas.co.uk
 Tel: 44 (0) 148-864-9090US toll-free 1-877-225-2034
 Regd. England 2177994, VAT Reg. GB 480 7371 36



To unsubscribe from the CCP4BB list, click the following link:
https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB&A=1

Re: [ccp4bb] AW: [EXTERNAL] Re: [ccp4bb] AW: [ccp4bb] challenges in structural biology

[Patrick Shaw Stewart]

Dear Herman

Animals that are sick tend not to move around a lot.  One can imagine that
this limits the tendency for animal viruses and other animal pathogens to
become more and more virulent, because the very virulent strains won't
spread as fast.  And (importantly) when the most virulent strains finally
arrive at some particular location, they will find that their potential
hosts are already immune*.

Since plants don't move around, I have always wondered why plant pathogens
don't increase in virulence until they wipe out their hosts, especially
when you bear in mind that plants don't have complex immune systems.

Could these multiple genes be a way to avoid being wiped out by disease?
Ie if the plant gets sick, it just switches on a batch of "reserve"
genes**.  Is that possible?

Thx, Patrick


* This is a pet theory of mine: https://oldwivesandvirologists.blog

**Or maybe the expression of these genes is random - two genetically
identical individuals growing side-by-side might express different batches
of genes on a random basis.  Again, this might be mainly about disease
prevention.



On Fri, Sep 20, 2019 at 8:51 AM  wrote:

> Dear John,
>
> Plants cannot walk away to a more favorable spot. They remain stuck where
> they germinate, e.g. whether the place is sunny, shady, wet, dry, fertile,
> poor etc. So plants compensate by having a lot of genes available to be
> able to adapt to the particular spot where happen to be. And indeed, plants
> have usually more genes then animals!
>
> Best,
>
> Herman
>
>
>
> *Von:* CCP4 bulletin board [mailto:CCP4BB@JISCMAIL.AC.UK] *Im Auftrag von
> *John R Helliwell
> *Gesendet:* Freitag, 20. September 2019 09:19
> *An:* CCP4BB@JISCMAIL.AC.UK
> *Betreff:* [EXTERNAL] Re: [ccp4bb] AW: [ccp4bb] challenges in structural
> biology
>
>
>
> *EXTERNAL : *Real sender is owner-ccp...@jiscmail.ac.uk
>
>
>
> Dear Martin,
>
> Many thanks for these details of the size of the human genome over the
> decades and also the news of your most interesting upcoming review. I shall
> read it with great interest.
>
> Incidentally is the over 4 genes for the rice genome number correct?
> This number caught my eye as being interesting how the rice genome is more
> complicated than our genome.
>
> Best wishes,
>
> John
>
> Emeritus Professor John R Helliwell DSc
>
>
>
>
>
>
>
>
> On 19 Sep 2019, at 08:35, Kollmar, Martin  wrote:
>
> Dear John,
>
> the „100,000 human genes“ is a long-standing myth broad forward by the
> initiators of the U.S. human genome sequencing projects in 1990. This large
> number completely contradicted all genetics and mutation data since the 1940
> th, but the sequencing community (genome, cDNA, EST) didn’t read even the
> standard text books. Thus, the “30,000” genes published with the two human
> genome papers in 2001 are not “surprisingly low” but just in accordance
> with the predictions and the data since the 1940th. The gene number went
> down to about 23,000 already in 2004, and the current numbers (depending on
> database) range around 20,000 human protein-coding genes. The myth of the
> large numbers is only propagated by those who profit from larger numbers
> (e.g. bigger grants, papers in higher IF journals, big consortia).
>
>
>
> I have written a review about the current state (and history) of the human
> protein-coding genes, which will appear online in BioEssays soon and
> finally in the November issue (will be open access). In this review there
> will be some (hopefully) useful plots showing the gene numbers since the
> 1940th and a detailed review of all the numbers and their experimental
> basis (most were actually just extrapolations from small-scale data).
>
>
>
> Please excuse this kind of self-advertisement, but it is really more than
> time to move this myth out of science literature and communication.
>
>
>
> Best regards,
>
> Martin
>
>
>
> Priv. Doz. Dr. Martin Kollmar
>
>
>
> Group Systems Biology of Motor Proteins
>
> Department NMR-based Structural Biology
>
> Max-Planck-Institute for Biophysical Chemistry
>
> Am Fassberg 11
>
> 37077 Goettingen
>
> Deutschland
>
>
>
> www.motorprotein.de
> 
> (Homepage)
>
> www.cymobase.org
> 
> (Database of Cytoskeletal and Motor Proteins)
>
> www.diark.org
> 

Re: [ccp4bb] design specs/tolerances for crystallization rooms?

[Patrick Shaw Stewart]

>  if you're in even vaguely warm or temperate regions (or seasons), cooling
> the intake air to 4C brings it to below dew point, and then condensation
> and snow are guaranteed.


I once serviced a robot in a 4C room in Singapore, which didn't seem to
have any kind of dehumidification - or maybe it had broken down.  Water was
running feely down the walls and poling on the floor, and the robot was
covered in condensation.  Every non-stainless screw on the controller,
computer, robot etc was rusty.  Interestingly, both the robot and the
computer still worked.

Patrick


On Wed, Sep 25, 2019 at 6:04 AM Frank Von Delft 
wrote:

> My colleague Opher Gileadi gave us an excellent tip when we were designing
> our 4C harvesting room, over a decade ago:  *set it to 7C*.  The crystals
> are unlikely to mind, but it's SO much more comfortable to be in for
> hours.
>
> I seem to remember he mentioned something like a comfort inflection point
> as you approach 4C.
>
> *Install low-flow fans*.  Fridge people seem to default to installing
> hurricane machines, you have to tell them that a very very small flow is
> enough.
>
> *Get strong light* - probably even those daylight things (we don't have
> them).  Being cold is miserable enough already, there's no need to compound
> it with weak light.
>
> *Vibration* - that dwindles to insignificance if the air flow goes down.
>
> *Humidity* - we installed (at considerable expense) a low humidity air
> supply - really hard to know just how much it helps, but a few years ago
> when I had it turned it off to help save energy, very quickly I heard
> complaints about snow in the liquid nitrogen becoming a major hassle.  So
> based on that set of anecdotes, I conclude it probably *is* worth having
> dry air.
>
> It's *much* cheaper though if they can design it into the building's
> infrastructure, if it's a new building;  retrofitting turned out to be
> super expensive (in our case).
>
> As dry as possible.  Look at and understand the psychrometric chart
> (google it):  if you're in even vaguely warm or temperate regions (or
> seasons), cooling the intake air to 4C brings it to below dew point, and
> then condensation and snow are guaranteed.
>
> *Size* - make it as big as you can get away with, with lots of bench and
> shelf space.  Your students will already be miserably cold, no need for
> them to be cramped too.
>
> Good luck!
> Frank
>
>
>
>
>
> On 24/09/2019 23:40, Scott, Emily wrote:
>
> Anyone out there specifically design rooms for (protein) crystallization
> at ~22 deg and 4 deg C?  If you have successes or failures and can share
> any design specs with regard to vibration, temperature, and humidity
> tolerances, it would be much appreciated to pass on to the architects for
> our new laboratory.
>
>
>
> Sincerely,
>
> Emily Scott
>
>
>
> --
>
> Emily Scott, Ph.D.
>
> Professor, Medicinal Chemistry/Pharmacology/Biophysics
>
> Faculty Director, BioNMR Core Lab
>
> University of Michigan
>
> 428 Church Street
>
> Ann Arbor, MI 48109-1065
>
> Phone:  734-764-3530
>
> https://pharmacy.umich.edu/people/scottee
>
> Lab webpage:  http://scottlab.info
>
>
>
>
>
> **
> Electronic Mail is not secure, may not be read every day, and should not
> be used for urgent or sensitive issues
>
> --
>
> To unsubscribe from the CCP4BB list, click the following link:
> https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB&A=1
>
>
>
> --
>
> To unsubscribe from the CCP4BB list, click the following link:
> https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB&A=1
>


-- 
 patr...@douglas.co.ukDouglas Instruments Ltd.
 Douglas House, East Garston, Hungerford, Berkshire, RG17 7HD, UK
 Directors: Peter Baldock, Patrick Shaw Stewart

 http://www.douglas.co.uk
 Tel: 44 (0) 148-864-9090US toll-free 1-877-225-2034
 Regd. England 2177994, VAT Reg. GB 480 7371 36



To unsubscribe from the CCP4BB list, click the following link:
https://www.jiscmail.ac.uk/cgi-bin/webadmin?SUBED1=CCP4BB&A=1

Re: [ccp4bb] frozen pellet insoluble protein

[Patrick Shaw Stewart]

Andreas, you probably know all this, but I only understood quite recently.
What happens is that as ice crystals form you get "brine rejection", the
same thing that happens in the arctic when sea water freezes.  Therefore
you can have protein concentrated in pockets of high salt.  Fine for some
proteins, but others don't like it.  And it can happen during (slow)
thawing as well as during freezing.  - Patrick





On 29 September 2014 16:02, Andreas Förster  wrote:

> Dear all,
>
> I've encountered people who refuse to freeze cells and always lyse fresh
> pellets.  Better protein, they say.  I've never had reason to do so myself,
> or even to believe in their voodoo.  Up until now, maybe.
>
> My protein expresses well and is almost all in the soluble fraction in an
> expression test from a fresh pellet.  The large-scale expression from the
> same pellet, now frozen and thawed, yielded 90% insoluble protein.
>
> If it's the freezing that dooms the protein, I'm happy to redo the
> fermentor run.  Are there other examples out there of this?
>
> Thanks.
>
>
> Andreas
>
>
>
>
> --
>   Andreas Förster
>  Crystallization and X-ray Facility Manager
>Centre for Structural Biology
>   Imperial College London
>



-- 
 patr...@douglas.co.ukDouglas Instruments Ltd.
 Douglas House, East Garston, Hungerford, Berkshire, RG17 7HD, UK
 Directors: Peter Baldock, Patrick Shaw Stewart

 http://www.douglas.co.uk
 Tel: 44 (0) 148-864-9090US toll-free 1-877-225-2034
 Regd. England 2177994, VAT Reg. GB 480 7371 36

Re: [ccp4bb] fastening crystal formation

[Patrick Shaw Stewart]

Michael (and some others)

You haven't mentioned - and I guess don't use regularly - the "random" MMS
approach, where crushed seed-crystals are added to random screens.  This
really is a terrific method, and it will on average roughly double
productivity.  It's the first thing I would think of in a case like
Vijaykumar's (as I told him this morning!).

Galina Obmolova and her colleagues published a great paper earlier this
year about MMS.  They were working with a set of 16 Fab fragments that
comprised all combinations of 4 different heavy chains and 4 different
light chains.  Three structures were generated without MMS, but by various
very creative uses of microseeding they were able to get all 16/16
structures.  Ref below.

Best wishes,

Patrick

__


Obmolova, G., Malia, T. J., Teplyakov, A., Sweet, R. W., & Gilliland, G. L.
(2014). Protein crystallization with microseed matrix screening:
application to human germline antibody Fabs. *Structural Biology and
Crystallization Communications*, *70*(8).




On 31 October 2014 16:07, R. M. Garavito  wrote:

> Although three months is a long time, it is no completely unheard of, and
> does not require the invocation of proteolysis.  The longest time I have
> heard of is ~1 yr, so count yourself lucky.  However to get good advice, as
> well as to use it, you need to ask yourself several questions:
>
> 1.  What kind of crystals are they?  Protein, salt, etc? If they are salt,
> don't pursue this condition.
>
> 2.  How many crystals did you get?  One or 2 in a drop or a microcrystal
> shower. And of what kind?  Single, well shaped, rosettes, needle clusters,
> or something that looks crystalline.  Screen more broadly around your
> initial hit.
>
> 3.  How many times have your tried to repeat this?  Once, twice, or more?
> Did you try setups in duplicate?  If so, did you get reproducible results?
> Have you actually screened around these conditions, varying each component
> systematically (PEG, salt, pH, buffer, etc.)?
>
> 4.  What method did you use? And in what kind of container?  For one
> thing, we don't completely trust the integrity of our setups for longer
> than 2 months.  All containers leak water slowly, so when crystals take
> longer than 2 months to grow (a) the real conditions are at much higher
> values than you naively think (i.e., the drop has dried out more than you
> expected) or (b) other components are crystallizing, for example a zinc
> salt.  It depends what else is in your protein buffer, as well.
>
> To quicken protein crystallization (which is not always a good thing),
> increase your protein concentration (by 1.5-2x) and/or PEG concentration
> (such as screening up to 40% PEGmme 550).  Sadly, crystallization is a
> combination of thermodynamic and kinetic factors:  you can get crystals
> (sometimes a single crystal only) when just outside the truly optimal
> conditions, but this may be only a sporadic event. You got to keep
> screening.
>
> Good luck,
>
> Michael
>
>
> **
> *R. Michael Garavito, Ph.D.*
> *Professor of Biochemistry & Molecular Biology*
> *603 Wilson Rd., Rm. 513*
> *Michigan State University  *
> *East Lansing, MI 48824-1319*
> *Office:*  *(517) 355-9724 Lab:  (517) 353-9125*
> *FAX:  (517) 353-9334Email:  rmgarav...@gmail.com
> *
> **
>
>
>
>
> On Oct 31, 2014, at 6:05 AM, Vijaykumar Pillalamarri <
> vijaypkuma...@gmail.com> wrote:
>
> Dear all,
>
> I am trying to crystallize a 30 kD protein. Protein crystals are formed
> after 3 months. The crystals are formed in the following condition:
> 0.01M Zinc sulphate
> 0.1M MES monohydrate pH 6.5
> 25% v/v PEG monomethyl ether 550
>
> Please suggest me how to grow these crystals faster.
>
> Thanking you
>
> --
> Vijaykumar Pillalamarri,
> UGC-JRF,
> C/O: Dr. Anthony Addlagatta,
> Senior Scientist,
> CSIR-IICT, Tarnaka,
> Hyderabad, India-57
> Mobile: +918886922975
>
>
>


-- 
 patr...@douglas.co.ukDouglas Instruments Ltd.
 Douglas House, East Garston, Hungerford, Berkshire, RG17 7HD, UK
 Directors: Peter Baldock, Patrick Shaw Stewart

 http://www.douglas.co.uk
 Tel: 44 (0) 148-864-9090US toll-free 1-877-225-2034
 Regd. England 2177994, VAT Reg. GB 480 7371 36

Re: [ccp4bb] Fabricating hamilton syringe coupler for LCP preparation

[Patrick Shaw Stewart]

Hi Thomas

We use a very simple solution.

We simply shorten a normal needle to 6.5 mm and push it into another
syringe that has *two *of the white PTFE ferrules made by Hamilton.  (We
salvage the extra ferrule from another needle.)

We use a 22 gauge needle (not 22S, where the S stands for *small *inner
diameter).

Now you can push the two syringes together and make your LCP. It helps if
you tighten the knurled nose-piece to compress the PTFE ferrules before you
join the syringes.  You have to keep a little pressure on the two syringes
to hold them together while you mix up the LCP, or use eg tape.  (Which is
why we've made a little mixer on a rail, but that's another story.)

One nice feature is that you hardly waste any LCP and the needle for
dispensing it is already attached to the syringe.

Let me know if you need more info or you'd like me to send you a short
needle.

Best wishes,

Patrick






On 16 December 2014 at 02:14, Thomas Cleveland 
wrote:
>
> Hi everyone,
>
> Thanks for the advice.  I had, in fact, already ordered some
> commercial couplers, but they haven't come in yet, and there was an
> experiment I wanted to do today.
>
> Here's what I found:
>
> 1.  The steel ferrules have an orientation, with a "tight" side and a
> loose side.  They can be removed by sliding in one direction, but not
> the other.  Even then, it's pretty difficult.  I had to use pliers,
> and pieces of needle broke off during the process.  The tight side of
> the ferrule then needed to be reamed open slightly with a steel tool
> before I was able to slide the ferrule onto the other needle.
>
> 2.  Soldering stainless steel is really a pain.
>
> In the end I got a coupler that seems to work well, but it was a pain,
> and it's a bit charred looking.
>
> Thanks again,
> Tom
>
>
> On Mon, Dec 15, 2014 at 6:01 PM, Aaron Thompson
>  wrote:
> > I agree with Jim – purchasing the couplers will get you up and running
> much
> > quicker.
> >
> > TTP also sells nice couplers:
> >
> https://www.ttplabtechstore.com/ttp_ecom/cc/ItemDetails.jsp?@where.ItemID@EQ=3072-01050&sessionkey=#
> >
> > Aaron
> >
> >
> >
> > On Mon, Dec 15, 2014 at 12:38 PM, Bernhard Rupp <
> hofkristall...@gmail.com>
> > wrote:
> >>
> >> Tried the RN kludge at least I did not get it to work. You cannot
> >> tighten the plastic swage lock type sleeves
> >> tight enough. On operation the pressure drives the PEEK tubing out of
> the
> >> compression fit.
> >> Maybe if you have a jig that holds the 2 syringes in a fixed position so
> >> they cannot move apart it can work.
> >>
> >> Best, BR
> >>
> >> -Original Message-
> >> From: CCP4 bulletin board [mailto:CCP4BB@JISCMAIL.AC.UK] On Behalf Of
> >> Daniel Anderson
> >> Sent: Monday, December 15, 2014 8:48 PM
> >> To: CCP4BB@JISCMAIL.AC.UK
> >> Subject: Re: [ccp4bb] Fabricating hamilton syringe coupler for LCP
> >> preparation
> >>
> >> Here's my addition to Jim Fairman's reply:
> >>
> >> You could use a pair of RN compression fittings (www.hamilton dot com
> part
> >> number 55751-01) and a segment of HPLC tubing. HPLC tubing within my
> field
> >> of view can have an inside diameter as small as 0.005 inch.
> >>
> >> hope that helps, Happy Merry, etc.,
> >>Dan
> >>
> >>
> >> On 12/15/2014 11:09 AM, Thomas Cleveland wrote:
> >> > Hi all,
> >> >
> >> > I'm trying to put together some homemade syringe couplers following
> >> > the published instructions from the Caffrey group.  I'm having a bit
> >> > of trouble with this part:
> >> >
> >> > "The stainless steel ferrule of the second needle is removed and
> >> > placed on the free end of the coupling needle such that the double
> >> > thumb nut is held symmetrically between the two steel ferrules"
> >> >
> >> > Has anyone done this, and if so, how did you remove the stainless
> >> > steel ferrule from the second needle in order to place it over the
> >> > first?  The stainless steel ferrule appears to be firmly attached and
> >> > I'm having trouble removing it.
> >> >
> >> > Thanks,
> >> > Thomas Cleveland
>


-- 
 patr...@douglas.co.ukDouglas Instruments Ltd.
 Douglas House, East Garston, Hungerford, Berkshire, RG17 7HD, UK
 Directors: Peter Baldock, Patrick Shaw Stewart

 http://www.douglas.co.uk
 Tel: 44 (0) 148-864-9090US toll-free 1-877-225-2034
 Regd. England 2177994, VAT Reg. GB 480 7371 36

Re: [ccp4bb] how to reduce protein solubility

[Patrick Shaw Stewart]

> I use a syringe with a needle and poke through the tape into the
reservoir and top it off

Another approach is to poke holes in the tape with a needle, and just let
the drops slowly evaporate and dry out.  I'm told it works!



On 17 February 2015 at 09:19, Bernhard Rupp 
wrote:

> Just a possibility for salvage of your already set-up drops:
>
>
>
> You can spike the reservoirs with some highly concentrated precipitant (no
> matter what as long as
>
> it sucks more water out of your drop). It does not solve your problem but
> maybe you can
>
> revive a few drops and get more information from your experiment.
>
> I use a syringe with a needle and poke through the tape into the reservoir
> and top it off with the
>
> high conc. precip. The tiny hole is easy to re-tape and does not hinder
> observation.
>
>
>
> Best, BR
>
>
>
> *From:* CCP4 bulletin board [mailto:CCP4BB@JISCMAIL.AC.UK] *On Behalf Of *
> Mattiroli,Francesca
> *Sent:* Tuesday, February 17, 2015 5:23 AM
> *To:* CCP4BB@JISCMAIL.AC.UK
> *Subject:* [ccp4bb] how to reduce protein solubility
>
>
>
> Hi all,
>
> I am struggling with a protein complex that is too soluble. I have reached
> about 20 mg/ml but I still observe very little precipitation (clear drops
> in 90-95% of the tested conditions). The proteins are expressed in insect
> cells and going to higher concentration is not easily achievable.
> I have tried different buffer conditions (salt concentration and pH) and I
> am testing temperatures. I am at a loss with what to try next.
> Do you think PTMs (phosphorylation, acetylation) might be causing this?
> Any input on how to decrease solubility?
>
> Thank you very much in advance,
>
> Francesca
>
>


-- 
 patr...@douglas.co.ukDouglas Instruments Ltd.
 Douglas House, East Garston, Hungerford, Berkshire, RG17 7HD, UK
 Directors: Peter Baldock, Patrick Shaw Stewart

 http://www.douglas.co.uk
 Tel: 44 (0) 148-864-9090US toll-free 1-877-225-2034
 Regd. England 2177994, VAT Reg. GB 480 7371 36

Re: [ccp4bb] Off-topic - Crystallisation in anaerobic glove box

[Patrick Shaw Stewart]

Hi Steve

I have one more comment for this thread.

The microbatch-under-oil method is very handy for anaerobic work:

1.  You can keep the microbatch stock solutions in normal microtitre plates
(polypropylene is best to reduce evaporation) for months, which hugely
reduces the amount of degassing that you need to do.  You will only use say
0.5 ul of stock per drop.

2.  The oil offers a surprising amount of protection from oxidation, which
may be helpful eg in harvesting.

3.  Microbatch can be automated - in parallel to vapor diffusion if desired


It's amazing how often (aerobic) microbatch produces far superior crystals
to V.D. for no obvious reason - it's well worth trying for both screening
and optimization.

Best wishes

Patrick




On 11 March 2015 at 10:17,  
wrote:

> Dear CCP4BBer's
>
> Apologies for the off-topic post, but the CCP4BB seems to be the best
> place to ask about crystallisation.
>
> I am looking to set up crystallisation in an anaerobic glove box and
> wondered how other people did this, specifically the crystallisation
> stage.  My initial thoughts were to place a small crystallisation incubator
> inside the box, however the smallest I have come across so far (~27L) is
> still rather large.  Has anyone come across smaller incubators?
> Alternatively are incubators even neccessary if the glove box is placed in
> a room with good air conditioning and stable temperature control?
>
> Any recommendations would be very helpful.
>
> Thanks in advance,
>
> Steve Carr
>
> Dr Stephen Carr
> Research Complex at Harwell (RCaH)
> Rutherford Appleton Laboratory
> Harwell Oxford
> Didcot
> Oxon OX11 0FA
> United Kingdom
> Email stephen.c...@rc-harwell.ac.uk
> tel 01235 567717
>
> This email and any attachments may contain confidential, copyright and or
> privileged material, and are for the use of the intended addressee only. If
> you are not the intended addressee or an authorized recipient of the
> addressee, please notify us of receipt by returning the e-mail and do not
> use, copy, retain, distribute or disclose the information in or attached to
> this email.
>
> Any views or opinions presented are solely those of the author and do not
> necessarily represent those of the Research Complex at Harwell.
>
> There is no guarantee that this email or any attachments are free from
> viruses and we cannot accept liability for any damage which you may sustain
> as a result of software viruses which may be transmitted in or with the
> message.
>
> We use an electronic filing system. Please send electronic versions of
> documents, unless paper is specifically requested.
>
> This email may have a protective marking, for an explanation, please see:
>
> http://www.mrc.ac.uk/About/informationandstandards/documentmarking/index.htm
> .
>



-- 
 patr...@douglas.co.ukDouglas Instruments Ltd.
 Douglas House, East Garston, Hungerford, Berkshire, RG17 7HD, UK
 Directors: Peter Baldock, Patrick Shaw Stewart

 http://www.douglas.co.uk
 Tel: 44 (0) 148-864-9090US toll-free 1-877-225-2034
 Regd. England 2177994, VAT Reg. GB 480 7371 36

Re: [ccp4bb] Off-topic - Crystallisation in anaerobic glove box

[Patrick Shaw Stewart]

Thank you for your comments everyone.

The CCP4BB is a wonderful resource and it has answered several questions
that have been bothering me for years!

Tristran has given us the correct conclusion as well as the important
facts: the capacity of oil for holding O2 is high, but the diffusion rate
is low.

This makes complete sense of the observations reported.  The O2 is (slowly)
diffusing OUT of the permanganate drop, and the oil is already saturated
with O2, therefore it takes a long time for the purple colour to be lost.

The O2 is diffusing INTO the drop in the dithionite experiment, and
presumably the oil that Julia used was already loaded with O2, so the
reducing environment was quickly lost.


I hadn't figured out how to take advantage of the protection of oil - I
just had a vague feeling that it might be helpful.  Now however I can see
that it's useful, because the oil will provide quite good protection
against a pulse of O2 e.g. if someone accidentally lets air into the
chamber.  (Or moves plates from one glovebox to another?)  O2 will start to
diffuse into the oil, but most of it will diffuse out again if the O2 pulse
is short.  And the lids that are standard on microbatch plates will help a
lot.

(The oil is almost the ideal barrier, although you *might* prefer something
with a very low solubility since it *might *give a lower O2 flux in the
steady state - as Tristran says it's complicated.  And I'm guessing that
the O2 flux through the thin plastic tape used in vapor diffusion setups
would be quite high.  Does anyone have a friend who works in food science?)

There's an even more exciting conclusion: we should degass our oil even for
use with *aerobic *microbatch setups.  I have heard of a case where
diffracting crystals were only obtained for aerobic targets in a glovebox,
and I think the skins on drops are, or can be, related to oxidation.

There may even be mileage in microbatch with the zip lock bag approach for
targets that are not overly sensitive - *if* you degas your oil before you
start  a vacuum should do it.

I agree that Al's Oil (silicone) should be avoided from this point of view
- although I would certainly use it anyway for screening experiments
(whether aerobic or anaerobic).


Riveting stuff.

Thx to all, Patrick



On 18 March 2015 at 18:58, Tristan Croll  wrote:

> It's a little complicated. It's true that oxygen is more soluble in most
> oils than in water - but in a high viscosity mineral oil the diffusion rate
> is orders of magnitude lower. So the combination of an oil overlay and a
> reducing agent in your buffer should protect your sample much longer than
> the reducing agent alone - as long as your oil was degassed to start with.
> Note that silicon oils are a bad choice for this - silicones have an
> enormous affinity for oxygen (so much so that they've been explored as
> artificial blood substitutes), and it diffuses through them very readily.
>
>
>
> Tristan Croll
> Lecturer
> Faculty of Health
> School of Biomedical Sciences
> Institute of Health and Biomedical Engineering
> Queensland University of Technology
> 60 Musk Ave
> Kelvin Grove QLD 4059 Australia
> +61 7 3138 6443
>
> This email and its attachments (if any) contain confidential information
> intended for use by the addressee and may be privileged.  We do not waive
> any confidentiality, privilege or copyright associated with the email or
> the attachments.  If you are not the intended addressee, you must not use,
> transmit, disclose or copy the email or any attachments.  If you receive
> this email by mistake, please notify the sender immediately and delete the
> original email.
>
>
>
> > On 18 Mar 2015, at 11:49 pm, Edward A. Berry  wrote:
> >
> > Do you have evidence that the oil blocks diffusion of O2? O2 is a
> nonpolar molecule, generally much more soluble in oils than in water. I'm
> not sure about silicone oils, but I would think they also dissolve O2
> readily.
> > eab
> >
> >> On 03/18/2015 08:02 AM, Patrick Shaw Stewart wrote:
> >>
> >> Hi Steve
> >>
> >> I have one more comment for this thread.
> >>
> >> The microbatch-under-oil method is very handy for anaerobic work:
> >>
> >>1.  You can keep the microbatch stock solutions in normal microtitre
> plates (polypropylene is best to reduce evaporation) for months, which
> hugely reduces the amount of degassing that you need to do.  You will only
> use say 0.5 ul of stock per drop.
> >>
> >>2.  The oil offers a surprising amount of protection from oxidation,
> which may be helpful eg in harvesting.
> >>
> >>3.  Microbatch can be automated - in parallel to vapor diffusion if
> desired
> >>
> >>
>

Re: [ccp4bb] Choice of stereomicroscope

[Patrick Shaw Stewart]

Ronnie

I see a lot of cheap and expensive microscopes, and I notice that expensive
is not always better for protein crystallization.

Almost the most important thing is that illumination comes from *one
particular direction*.  Often this means that the light source is small and
far from the sample stage.  What does not work well is to have a large
light source (eg multiple LEDs, large white screen, mirror or sintered
transparent sheet) that is close to the sample - even with the best optics
in the world, you won't see crystals well.

Dark ground (see only scattered light) and ordinary transmission mode can
both work well - good to have both if possible.

Good luck,

Patrick




On 27 March 2015 at 13:08, Ronnie Berntsson  wrote:

> Dear all,
>
> I’m currently looking in to buying a new microscope for viewing crystal
> plates, mounting crystals etc, and would love some input into what I should
> get.
>
> What I would like is a microscope that has a high quality image, that is
> easy to work with and which is ergonomical. It does not have to have a
> fixed digital camera, but it should be possible to attach a digital camera
> to take pictures. Price is obviously also important...
>
> I’ve been looking at the standard microscopes that Molecular Dimensions
> sell, and also on a Nikon SMZ18. I remember that we used to have a Leica
> microscope in a previous lab that I liked, but can’t seem to find the model
> at the moment.
>
> I am also interested in getting a UV source, to inspect crystals under UV
> to see if you fluoresce (and hence are protein crystals). Molecular
> Dimension used to sell XtalLight 100, but doesn’t seem to do so anymore. Do
> any of you have other suggestions regarding the possibility of adding UV to
> a stereomicroscope?
>
> Suggestions and thoughts are more than welcome!
>
> Thanks,
> Ronnie
>
>
> --
> Ronnie Berntsson, PhD
> Assistant Professor
> Department of Medical Biochemistry and Biophysics
> Umeå University
> 90187 Umeå
> Sweden
>
> e-mail: ronnie.bernts...@medchem.umu.se
>



-- 
 patr...@douglas.co.uk    Douglas Instruments Ltd.
 Douglas House, East Garston, Hungerford, Berkshire, RG17 7HD, UK
 Directors: Peter Baldock, Patrick Shaw Stewart

 http://www.douglas.co.uk
 Tel: 44 (0) 148-864-9090US toll-free 1-877-225-2034
 Regd. England 2177994, VAT Reg. GB 480 7371 36

Re: [ccp4bb] handling crystals in volatile solvents

[Patrick Shaw Stewart]

Hi Len

In every case that I know of this problem has been solved by working under
oil.  The oil becomes saturated with the volatiles, and it prevents
crystals from doing backstroke, breaststroke or front crawl during
harvesting.

The most convenient way to get going is to dispense the wells without the
volatile solvents, then allow solvents to difuse through the oil and into
the drops.  We suggest our old Vapor Batch plates, and you should place the
same concentration of the solvent that you want in the drops into the large
"moat" around the plate.  If you put in higher concentrations you may
dehydrate your drops :-(

A very nice feature is that you can set up e.g. a random screen, then try
soaking in one or more volatile solvents if nothing grows in the first
round.

The approach was invented by Lesley Haire, and you can find her
presentation at

http://www.douglas.co.uk/winner1.htm



See also

Mortuza, Gulnahar B., et al. "High-resolution structure of a retroviral
capsid hexameric
amino-terminal domain." *Nature* 431.7007 (2004): 481-485.



The plates look like this:

http://www.douglas.co.uk/products.htm#Vapor Batch Plates



We'll send you some sample plates to try.

Best wishes,

Patrick



On 12 June 2015 at 22:11, Thomas, Leonard M.  wrote:

> Hi All,
>
> We have gotten some very nicely formed crystals out of a couple of
> different volatile solvents recently.  Besides looking for something easier
> to work in does anybody have any tips on handling crystals from these types
> of solvents.  It is very hard to loop a crystal while it is doing the
> backstroke in the well with all of its buddies.
>
> Thanks in advance.
> Len
>
> Leonard M. Thomas Ph.D.
> Macromolecular Crystallography Laboratory Manager
> University of Oklahoma
> Department of Chemistry and Biochemistry
> Stephenson Life Sciences Research Center
> 101 Stephenson Parkway
> Norman, OK 73019
> 405-325-1126
> lmtho...@ou.edu
> http://barlywine.chem.ou.edu
> http://structuralbiology.ou.edu




-- 
 patr...@douglas.co.ukDouglas Instruments Ltd.
 Douglas House, East Garston, Hungerford, Berkshire, RG17 7HD, UK
 Directors: Peter Baldock, Patrick Shaw Stewart

 http://www.douglas.co.uk
 Tel: 44 (0) 148-864-9090US toll-free 1-877-225-2034
 Regd. England 2177994, VAT Reg. GB 480 7371 36

Re: [ccp4bb] Crystals grow at the bottom of the tube.

[Patrick Shaw Stewart]

Hi Lingyuan

I would certainly make a seed stock and use it with RANDOM screens - this
will (usually) allow you to pick up new conditions and control the number
of crystals per drop.

However you say your crystals melt easily when you harvest them.  I don't
know how David stabilized his seedstock (if he did) but you may be able to
stabilize yours with a precipitant.

In all the cases that we looked at we found that if you soaked uncrushed
crystals in a precipitant (or cocktail) and the crystals were unchanged
after 24 hours, then the precipitant/cocktail could be used to make a
seedstock.

In practice 100% PEG 600 worked for 5 of the 6 model proteins that we
looked at.  The remaining seedstock worked with seed crystals suspended in
4M amm. sulfate.

I hope it works for you.

Best wishes, Patrick


___


Ref for stabilizing seed stocks with various precipitants:

Shaw Stewart, P.D., Kolek, S.A., Briggs, R.A., Chayen, N.E. and Baldock,
P.F., 2011. Random microseeding: a theoretical and practical exploration of
seed stability and seeding techniques for successful protein
crystallization.*Crystal Growth & Design*, *11*(8), pp.3432-3441.



Ref for random microseeding:

D'Arcy A, Villard F, Marsh M. An automated microseed matrix-screening
method for protein crystallization. Acta Crystallographica Section D:
Biological Crystallography. 2007 Apr 1;63(4):550-4.





On 19 October 2016 at 15:20, Hargreaves, David <
david.hargrea...@astrazeneca.com> wrote:

> I have been presented with crystals grown in nmr tubes on two separate
> occasions. Both diffracted very well and thankfully, neither required a
> magnetic field for optimisation. On the first occasion I did use the
> initial sample as a seed stock.
>
>
>
> Best wishes,
>
>
>
> David
>
>
>
> *From:* CCP4 bulletin board [mailto:CCP4BB@JISCMAIL.AC.UK] *On Behalf Of *
> kiki
> *Sent:* 18 October 2016 11:42
> *To:* CCP4BB@JISCMAIL.AC.UK
> *Subject:* [ccp4bb] Crystals grow at the bottom of the tube.
>
>
>
> Dear all users,
>
>
>
>  I got my crystals at the bottom of the tube on ice just before I started
> to screen crystals. Those crystals' shapes were good but easy to melt when
> I harvested them. I shot these crystals. They only diffracted to 7A to 8A.
> Has anyone ever met this situation before? How to improve?
>
>
>
> Thanks,
>
> Lingyuan
> --
>
> AstraZeneca UK Limited is a company incorporated in England and Wales with
> registered number:03674842 and its registered office at 1 Francis Crick
> Avenue, Cambridge Biomedical Campus, Cambridge, CB2 0AA.
>
> This e-mail and its attachments are intended for the above named recipient
> only and may contain confidential and privileged information. If they have
> come to you in error, you must not copy or show them to anyone; instead,
> please reply to this e-mail, highlighting the error to the sender and then
> immediately delete the message. For information about how AstraZeneca UK
> Limited and its affiliates may process information, personal data and
> monitor communications, please see our privacy notice at
> www.astrazeneca.com
>



-- 
 patr...@douglas.co.ukDouglas Instruments Ltd.
 Douglas House, East Garston, Hungerford, Berkshire, RG17 7HD, UK
 Directors: Peter Baldock, Patrick Shaw Stewart

 http://www.douglas.co.uk
 Tel: 44 (0) 148-864-9090US toll-free 1-877-225-2034
 Regd. England 2177994, VAT Reg. GB 480 7371 36

Re: [ccp4bb] Crystallization with antibody

[Patrick Shaw Stewart]

Try seeding the complex with the crystals that you have.  If you have
crystals of both proteins, crush them and mix them together.  Suspend
the seeds in whichever reservoir solution has the least salt in it*
(or suspend in 50% PEG**) .  Use random Microseed Matrix Screening
(rMMS) i.e. microseeding into random screens***.

rMMS with crystals of one component of a complex has successfully
given crystals of the complex in the past.  It's very quick and easy
to try with a robot or by hand.


*Radaev and Sun, J. Appl. Cryst. (2002). 35, 674-676
** Cryst. Growth Design (2011) 11(8), 3432-3441
*** D’Arcy et al. Acta Cryst. (2007). D63 550-554
 http://www.douglas.co.uk/MMS_proc.htm



On 28 June 2012 13:25, Theresa Hsu  wrote:
> Dear crystallographers
>
> Trying to crystallize a membrane protein complex of 100 kDa with a soluble 
> protein of 20 kDa which is interact with the membrane protein. So far, no 
> co-crystals in > 200 conditions. Some conditions gave crystals but mass spec 
> of crystals show only either one protein present. I am thinking of antibody 
> but don't know where to start. Can I use the anti-His tag antibody?
>
> Thank you.



--
 patr...@douglas.co.uk    Douglas Instruments Ltd.
 Douglas House, East Garston, Hungerford, Berkshire, RG17 7HD, UK
 Directors: Peter Baldock, Patrick Shaw Stewart

 http://www.douglas.co.uk
 Tel: 44 (0) 148-864-9090    US toll-free 1-877-225-2034
 Regd. England 2177994, VAT Reg. GB 480 7371 36

[ccp4bb] Punctuation etc.

[Patrick Shaw Stewart]

Could I make a request?

Could people who ask questions to the bb possibly lay out their questions
clearly, capitalize the word "I" and use the correct punctuation such as
question marks?

It makes it so much easier to read, and - this is more important -  you
will get more helpful responses if you help people to understand what
you're asking.

Giving your message a meaningful title is also very helpful!

Best wishes to all,

Patrick


-- 
 patr...@douglas.co.ukDouglas Instruments Ltd.
 Douglas House, East Garston, Hungerford, Berkshire, RG17 7HD, UK
 Directors: Peter Baldock, Patrick Shaw Stewart

 http://www.douglas.co.uk
 Tel: 44 (0) 148-864-9090US toll-free 1-877-225-2034
 Regd. England 2177994, VAT Reg. GB 480 7371 36

Re: [ccp4bb] Protein concentration vs Molecular wt...

[Patrick Shaw Stewart]

See  http://www.douglas.co.uk/PDB_data.htm, section 4


On 19 July 2012 20:58, james09 pruza  wrote:

> Dear Crystallographers,
> Is there any rule of thumb for Protein concentration and molecular weight
> for crystallization trials of a soluble protein? Looking for high molecular
> wt. protein ~50kDa.
> James.
>
>


-- 
 patr...@douglas.co.ukDouglas Instruments Ltd.
 Douglas House, East Garston, Hungerford, Berkshire, RG17 7HD, UK
 Directors: Peter Baldock, Patrick Shaw Stewart

 http://www.douglas.co.uk
 Tel: 44 (0) 148-864-9090US toll-free 1-877-225-2034
 Regd. England 2177994, VAT Reg. GB 480 7371 36

Re: [ccp4bb] Improvement in crystal quality

[Patrick Shaw Stewart]

Niks

Seeding often works very well with needles.  But start with seeding in
RANDOM SCREENS, i.e. "rMMS"


References -

Allan D’Arcy, Frederic Villarda, May Marsh.  'An automated microseed
matrix-screening method for protein crystallization'.  Acta
Crystallographica section D63 (2007) 550–554.  On-line at
http://scripts.iucr.org/cgi-bin/paper?S0907444907007652

**Patrick D. Shaw Stewart, Stefan A. Kolek, Richard A. Briggs, Naomi E.
Chayen and Peter F.M. Baldock. 'Random Microseeding: A Theoretical and
Practical Exploration of Seed Stability and Seeding Techniques for
Successful Protein Crystallization'.  Cryst. Growth Des., 2011, 11 (8), pp
3432–3441. On-line at http://pubs.acs.org/doi/abs/10.1021/cg2001442

*Chatty article that I wrote for SerCat newsletter in 2009*:
http://www.douglas.co.uk/SER-CAT09_1.html

*A bit of theory*:  http://www.douglas.co.uk/mms.htm

*Procedure*:  http://www.douglas.co.uk/MMS_proc.htm

A. G. Villaseñor, A. Wong, A. Shao, A. Garg, A. Kuglstatter and S. F.
Harris. 'Acoustic matrix microseeding: improving protein crystal growth
with minimal chemical bias.' Acta Crystallographica Section D66 (2010)
568-576. On-line at http://scripts.iucr.org/cgi-bin/paper?S0907444910005512

Galina Obmolova,* Thomas J. Malia, Alexey Teplyakov, Raymond Sweet and Gary
L. Gilliland. 'Promoting crystallization of antibody–antigen complexes via
microseed matrix screening.' Acta Crystallographica Section D66 (2010)
927–933.  Open-access at
http://journals.iucr.org/d/issues/2010/08/00/bw5361/bw5361.pdf




On 24 July 2012 14:40, Niks  wrote:
>
> Dear All,
>
> I am trying to crystallize a recombinant dehydrogenase protein. Got five
hits in PEG ION Screen from Hamptons (20% PEG 3350 with 0.2M Sodium
Acetate, 0.2M Potassium acetate, 0.2M ammonium acetate, 0.2M sodium formate
and 0.2M Potassium Chloride) after two days.
> Crystals looks like needles most of time, sometime broader needles
(Pictures attached). UV crystal scanner says those are protein crystals,
but when we tried to pick up one and shoot at room temperature, diffraction
patterns looks like similar like of  powder diffraction (picture attached).
> I have tried 50 of the 96 additives(whichever I can arrange of) mentioned
in the additive screen from Hamptons . I have tried detergent screen from
Hamptons (this time original screen solutions). I have tried incubating the
plate at 28degrees as well as 10degrees, Though waiting for 10degree
results but one drop  showed needles again after normal two days of growth
period.
> I tried to slow down the supersaturation by adding 100ul of 1:1 ratio of
silicon oil and paraffin oil over the 1ml of well solution. This time no
crystals but some precipitation.
>
> If anyone spare any word of wisdom to improve these crystal quality, I
will be very grateful.
> If seeding is the only obvious thing to try, any reference for the
seeding procedure will be highly appreciated.
>
> Thanks very much
> Nishant Varshney
> PhD student,
> National Chemical Laboratory,Pune,India
> --
> "The most difficult phase of  life is not when No one understands you;It
is when you don't understand yourself"




--
 patr...@douglas.co.ukDouglas Instruments Ltd.
 Douglas House, East Garston, Hungerford, Berkshire, RG17 7HD, UK
 Directors: Peter Baldock, Patrick Shaw Stewart

 http://www.douglas.co.uk
 Tel: 44 (0) 148-864-9090US toll-free 1-877-225-2034
 Regd. England 2177994, VAT Reg. GB 480 7371 36

Re: [ccp4bb] Improving microcrystals

[Patrick Shaw Stewart]

Samuel

Clearly you should try the "rMMS" random microseeding approach where
you add a seed stock made from the spherulites to a random screen.


See refs:

Acta Crystallographica section D63 (2007), 550–554.  On-line at
http://scripts.iucr.org/cgi-bin/paper?S0907444907007652
Cryst. Growth Des., 2011, 11 (8), pp 3432–3441. On-line at
http://pubs.acs.org/doi/abs/10.1021/cg2001442.
http://www.douglas.co.uk/SER-CAT09_1.html



On 25 August 2012 02:11, Samuel Johnson  wrote:
>
> Hi everyone,
>
>   I have been working on a protein for the past year. After a 
> number of trials at crystallizing the protein i have identified conditions 
> for getting spherulites/micro-crystaline material under micro batch method. I 
> have confirmed that the crystalline material is protein, by using Izit-dye 
> test. The condition is 50mM CaCl2, Mes pH 6.5 and 40% PEG 400. I will be 
> happy to get suggestions on improving conditions to obtain single crystals. I 
> have already tried varying a number of parameters like salt, precipitant 
> concentration and buffer pH but that didn't help.
>
> Thanks.




--
 patr...@douglas.co.ukDouglas Instruments Ltd.
 Douglas House, East Garston, Hungerford, Berkshire, RG17 7HD, UK
 Directors: Peter Baldock, Patrick Shaw Stewart

 http://www.douglas.co.uk
 Tel: 44 (0) 148-864-9090US toll-free 1-877-225-2034
 Regd. England 2177994, VAT Reg. GB 480 7371 36

Re: [ccp4bb] Off-topic: Best Scripting Language

[Patrick Shaw Stewart]

Like most computer users and many scientists I don't write scripts to
organize or analyse my data unless I get desperate.  I've used both Python
and Perl a few years ago, but it would take quite a lot of time and effort
and staring at on-line tutorials to get back into either of them right now.
 So I end up using massive Excel files that kind of work, but are a pain.
 I've noticed that quite a few structural biologists have the same problem.

I've never understood why there can't be a simple programming language that
is completely self-explanatory bercause it uses English sentences.  Our
robot scripting language uses syntax like

Dispense 0.5 * DropVol ul to TargetWells using ProteinSyringe

That is pretty obvious.


So why can't I have a language where I can write


Carry_out_a_sequence_where

x is 1 to 10

with_step_size 1 :

if
age of person(x) is_greater_than 50
then
print name of person(x) "is an old man (or woman)" .

Repeat_for_next x .


?


I don't care if it's efficient (anything is efficient compared to Excel) or
if it's easy to write big programs in.  All I care about is that it's easy
to get going.

Later on I can learn to write simply "Sequence" instead of
"Carry_out_a_sequence_where".  I could click a button that would make the
replacement to make my code more compact and readable to a trained eye.
 And of course  is_greater_than  could be written as  > .

Any intelligent school-child could understand it too, which would be
fantastic here in the UK where kids aren't taught to program any more.

Does such a language exist?





On 13 September 2012 17:08, James Stroud  wrote:

>
> On Sep 13, 2012, at 3:24 AM, Tim Gruene wrote:
>
> I have the impression that
> python programmers spend a lot of effort in trying to convince others
> that python is a "good" choice. Why bother rather than let people make
> their own decision?
>
>
> Someone asked.
>
> Plus, python programmers put no more effort than any other programmer.
> It's just that python has more advocates (for good reason) so the apparent
> effort is amplified.
>
> Don't hate us because our preferred programming language is beautiful.
>
> James
>
> --
> James Stroud
>
> http://www.jamesstroud.com
>
>


-- 
 patr...@douglas.co.ukDouglas Instruments Ltd.
 Douglas House, East Garston, Hungerford, Berkshire, RG17 7HD, UK
 Directors: Peter Baldock, Patrick Shaw Stewart

 http://www.douglas.co.uk
 Tel: 44 (0) 148-864-9090US toll-free 1-877-225-2034
 Regd. England 2177994, VAT Reg. GB 480 7371 36

Re: [ccp4bb] off topic: reproducing hits from organic solvents

[Patrick Shaw Stewart]

Peter

We make a 96-well plate that was originally made for microbatch-under-oil,
which has a large "moat" or well around the whole plate.

My old friend Lesley Haire had a lot of success with this plate for a
condition that contained isopropanol.

She set up the drops without isoprop, covered them with Al's Oils (silicone
mixed with paraffin oil from Hampton Research), then put water containing
the appropriate concentration of isoprop in the moat (in her case 10 - 20%).

THe isoprop diffused through the oil and into the drops.  Since the oil is
also saturated with isoprop it makes a very good barrier and stops the
isoprop from evaporating from the drops when you harvest your crystals.

As Lesley pointed out you can even set up a random screen without
isopropanol, then diffuse the isopropanol in afterwards.

Let me know if you - or anyone else - would like some samples of the
plate.  Unfortunately it won't fit on a Mosquito, but you can use it by
hand, see ref below.

Regarding your question below, bear in mind that water and oil can both go
through plastic tubes (slowly).

I hope it works for you

Patrick


Refs and info:
See http://www.douglas.co.uk/winner1.htm
http://www.douglas.co.uk/vb.htm
*Nature* *431* (2004), pp 481-485.



On 3 October 2012 17:37, Peter Hsu  wrote:

> Hi all,
>
> I recently got some hits from a Mosquito grown at 18C with PEG4000 and 10%
> propanol. I've tried reproducing these hits using the standard 24 well
> format with no success, even with playing with PEG and propanol
> concentrations. The initial screening solution was from a kit that's been
> sitting in the cold room for the better part of 2 years. Does anyone here
> have any tips or tricks in reproducing crystals grown from organic solvents?
>
> Many thanks in advance,
>
> Peter
>



-- 
 patr...@douglas.co.ukDouglas Instruments Ltd.
 Douglas House, East Garston, Hungerford, Berkshire, RG17 7HD, UK
 Directors: Peter Baldock, Patrick Shaw Stewart

 http://www.douglas.co.uk
 Tel: 44 (0) 148-864-9090US toll-free 1-877-225-2034
 Regd. England 2177994, VAT Reg. GB 480 7371 36

[ccp4bb] Plate crystals

[Patrick Shaw Stewart]

Jahan

It sounds as though the protein crystallizes well, so microseeding (done
the right way) is very likely to solve the problem.  Make a strong seed
stock with as much crystalline material as possible from several wells,
including different hits if possible.  Just mix them all together, but keep
PEG conditions separate from salt conditions (or you will get two layers).
 Make a set of serial dilutions from "neat" up to 1 in 100,000 and freeze
them at -80.  You need to seed into *random screens*, so that you can pick
up new conditions.  Then you should optimize two or three new conditions by
using the diluted seed stock.  For example, if you estimate that there are
1000 crystals in the drop, you use the 1:1000 dilution.

For info and references see http://www.douglas.co.uk/mms.htm


On 15 October 2012 23:01, Jahan Alikhajeh  wrote:

>
> Dear Friends,
>
> I am trying to crystalize a 70 kDa nasty protein but I got plate shape
> crystals with high mosaicity and useless diffraction (up to 4A).
> I tried to improve/optimize crystallization but either I got the same or
> nothing. I tried seeding but I had so many crystals without any
> improvement. Does anyone have better idea than routine optimization method
> in the lab? Thanks in advance.
>
> Jahan




-- 
 patr...@douglas.co.ukDouglas Instruments Ltd.
 Douglas House, East Garston, Hungerford, Berkshire, RG17 7HD, UK
 Directors: Peter Baldock, Patrick Shaw Stewart

 http://www.douglas.co.uk
 Tel: 44 (0) 148-864-9090US toll-free 1-877-225-2034
 Regd. England 2177994, VAT Reg. GB 480 7371 36




-- 
 patr...@douglas.co.ukDouglas Instruments Ltd.
 Douglas House, East Garston, Hungerford, Berkshire, RG17 7HD, UK
 Directors: Peter Baldock, Patrick Shaw Stewart

 http://www.douglas.co.uk
 Tel: 44 (0) 148-864-9090US toll-free 1-877-225-2034
 Regd. England 2177994, VAT Reg. GB 480 7371 36

Re: [ccp4bb] Stabilization of crystals and ligand exchange

[Patrick Shaw Stewart]

I say (of course I would!) why not try co-crystallization with random
microseeding using the crystals with the original ligand?

It usually allows you to control the number of crystals per drop too


On 18 October 2012 15:59, Dmitry Rodionov  wrote:

> Hi Sabine,
>
> Glutaraldehyde crosslinking worked pretty good for various soaks in my
> experience.
>
> J. Appl. Cryst. (1999). 32, 106-112[ doi:10.1107/S002188989801053X ]
> A gentle vapor-diffusion technique for cross-linking of protein crystals
> for cryocrystallography
> C. J. Lusty
>
> Best regards,
> Dmitry
>
> On 2012-10-17, at 12:26 PM, Sabine Schneider wrote:
>
> > Hi everyone,
> >
> > I am trying to get the structure of a protein-ligand complex were I need
> to exchange the ligand which it co-crystallises nicely with.
> > Problem: either they crack, disolve, turn brown,...  OR they still look
> very nice, well shaped but do not show a single reflection at the
> synchrotron!!!
> >
> >
> > Here is what I tried so far:
> >
> > 1) initially stabilising with higher precipitant (here PEG1500) before
> slowly transferring (*) it to the ligand-removal solution (= artifical
> mother liquor with higher PEG, ethylen glycol or glucose, but without
> initial ligand)
> >
> > (*) by slow exchange I mean : initially mixing drop solution with
> stabilising/ligand-removal solution and adding it back to the drop stepwise
> before fully transferring it. Or calculation wise I have fully exchange the
> solution to the new solution
> >
> > 2) here I let them ist over night (if they did not disolve, crack or
> whatever)
> > 3) slow exchange transfer to the artificial ML with the new ligand
> (10mM), left them over night and directly froze them
> >
> > 'Best' so far (crystals still looking nice but no reflection...) was
> slow exchange into higher PEG, than to higher PEG with ethylenglycol (30%
> and also adding ethylenglycol to the reservoir), let them sit for over
> night, before again slow exchange to the solution with the new ligand in
> higher PEG and 30% ethylen glycol.
> >
> > As I said here the crystals keep shape, but don't diffract at all
> anymore. Just freezing them with 30% ethylen glycol they diffract nicely to
> 2.5A on a home source. But already after step one they are sometimes not
> happy anymore.
> >
> > Co-crystallisation failed since when I add the ligand, which is not that
> soluble to the purified protein, everything crashed out of solution. I am
> thinking about to test adding the ligand to the diluted protein and
> concentrate it together. But I don't have that much ligand, since the
> synthesis is quite tedious The ligand can be dissolved in 30%
> ethylenglycol to ~50mM
> >
> > Thus I was wondering if someone has done successfully ligand exchange
> with glutaraldehyd stabilised xtals?
> > Or any ideas how to stabilise them? I appreciate any ideas or comments!
> >
> > Sorry for the lengthy email!
> >
> > Best,
> > Sabine
>



-- 
 patr...@douglas.co.ukDouglas Instruments Ltd.
 Douglas House, East Garston, Hungerford, Berkshire, RG17 7HD, UK
 Directors: Peter Baldock, Patrick Shaw Stewart

 http://www.douglas.co.uk
 Tel: 44 (0) 148-864-9090US toll-free 1-877-225-2034
 Regd. England 2177994, VAT Reg. GB 480 7371 36