Re: How to take command line argument and use it to run an upgrade script.

[wolf blaum]

> I'm a perl newby.
me too:-)  Right list, I assume.
> I'm looking on taking a command line argument from
> STDIN and use it for input to a script that upgrades
> software. Any examples would be greatly appreciated.

@ARGV holds your  command line arguments.

call: 
scriptname.pl Universe  42 douglas 'Zappod Beblebrox' 

#! /usr/bin/perl
use strict;
use warnings;
print "You called me with ", scalar @ARGV, " Arguments.\n";
if (@ARGV) {
  print " Param to script: $_\n" foreach (@ARGV);
}

Notice that there is a nice wa of processing command line args with the 
getopt:: modules from CPAN.

Also take a look at perldoc perlvar for detailed info about @ARGV, ARGV and 
$ARGV.

Hope that helps, Wolf


-- 
To unsubscribe, e-mail: [EMAIL PROTECTED]
For additional commands, e-mail: [EMAIL PROTECTED]
 

Re: complex data file parsing

[wolf blaum]

hi, 
> I know that each block always starts with and A in the first position of
> the first line and ends with a T in the last position of the last line.

isnt it a T in the first position of the last row of the set?

> I know that the second line starts with a B, and the data in the 5th space
> on this line is the e-mail address, which is what I ultimately want.
> However,...

only line with a B in the bigining in set?

> I am trying to get a list of email addresses for people who have ordered
> products that begin with ADV.  These can appear in multiple I lines.
> Therefore you can never predict how many lines make up 1 order block.

What about:

#! /usr/bin/perl
use strict;
use warnings;
my @email;

open (FH, "){   # read the next record
  my @fields = split ",|\n", $_;   # split at , or \n
  my $b_index;# 0 for every new record
  for (my $i=0; $i<=$#fields; $i++){
 if ($fields[$i] eq "B") {$b_index=$i; next;}
 elsif ($fields[$i] =~ /^ADV_.*/) {push @email, $fields[$b_index+4]; 
last;}
  }
}

works on the sample you provided.

$/ (see perlvar) is the record seperator, usually \n.

If really T would be the last char i the last row of the set, you could use "T
\n" as $/
The way I do it assumes that the first and only first line of each set beginns 
with an A (and falsly buts that A at the end of the privious record, but 
doesnt matter for the aim her, does it?)


The push assumes that there are always exactly 5 records between B and email 
and that this is the only line with a B in record (and comes before the lines 
with ADV_

lot of assumtions.

Im sure there is better ways to do that - might be a strat, though.

> "Online ordering is now available. Visit http://insidersadvantage.com for
> details."

Uh, given from your question, I better dont,, eh?

Good luck, Wolf


-- 
To unsubscribe, e-mail: [EMAIL PROTECTED]
For additional commands, e-mail: [EMAIL PROTECTED]
 

Re: How to take command line argument and use it to run an upgrade script.

[wolf blaum]

> My Compliments on a well done piece.

OT: 
see, a logical problem I have with newsgroups is that you learn most (at least 
I do)  by trying to explain things you think you understood to others - 
"beginning explainers" however make mistakes -
Thats of course not what you want in a newsgroup, since there is the one 
asking, who is learning too, whom you dont want to confuse with "slightly 
right" answers.

Nevertheless Im happy it seems this is a group were you can even learn how to 
explain (and what the group-iquette  is anyway).

Thanks for that, 
Wolf


-- 
To unsubscribe, e-mail: [EMAIL PROTECTED]
For additional commands, e-mail: [EMAIL PROTECTED]
 

Re: Need help comparing lines in two files

[wolf blaum]

> This very green newbie would like to compare two files, let's say File1
> and File2.   I
> want to put the difference from File2 only, into a new file, File3.

I had a very simliar problem about a week ago, which James answerd here:

http://groups.google.com/groups?q=Perl+looping+(a+lot+of)
+files&hl=en&lr=&ie=UTF-8&selm=28A16704-4AD3-11D8-9A03-000A95BA45F8%
40grayproductions.net&rnum=1

or try google groups "perl looping through (a lot of) files"

The only really difference is that I didnt want to compare one FILE2 to FILE1 
but 500.

However, be carefull on your filesize:
I settled reading one file into mem (as an array) and looping through the 
other ones using a while ()  reading the 500 files line by line.

> For example:
>
> File1.txt
> oranges
> apples
> bananas
>
> File2.txt
> apples
> kiwi
> bananas
>
> The result I want for File3 is the new entry in File2, which is kiwi.  (I
> don't care that oranges was in File1 and not File2.)
>
> I tried using a nested foreach loop structure, but I can't get that to
> work and I have a feeling using nested foreach's is not the way to go.

why not?

> I'm guessing somehow I should use hashs, but I've never used a hash for
> anything and I don't really know how to use a hash.  Can someone help ?

do you need to associate the contens of the line with a filename ore 
something? if not, use an array.

> Here's my feeble attempt:
>
> my $file1;
> my $file2;
>
> my @file1 = qw(oranges apples bananas);
> my @file2 = qw(apples kiwi bananas);
>
As Dan showed:

FILE2:
> foreach $file2 (@file2){
>foreach $file2 (@file2){
you may want 
 foreach my $file1(@file1){ 
here

> #print "$mastervob $tempvob \n";
> if ($file2 eq $file1) {
> last;   # I would like to go up to the
> toplevel "foreach" here, but I don't know how to do it
> }   # and I'm not sure this would even
> work.

as Dan said:
   
 next FILE2;

will do the job.


> else{
> print "$file2 \n";
> }
> }
> }

This doesent do what I assume you want: when you place the print in the inner 
loop.
Just look at the link above.

Hope thats a start, Wolf


-- 
To unsubscribe, e-mail: [EMAIL PROTECTED]
For additional commands, e-mail: [EMAIL PROTECTED]
 

Re: complex data file parsing

[wolf blaum]

Hi, 

> As far as your follow up question on the B lines, "only line with a B in
> the beginning in set?," I'm not sure if I understand.  If you mean that
> there will only be 1 line per order (set of lines A-T) with a B in the
> first position, you are correct.

yes, thats what I meant.
Sorry about my lazyness. Adittionally I get to correct all my embarassing 
typos...

> Also, as far as your assumption, "The way I do it assumes that the first
> and only first line of each set beginns with an A (and falsly buts that A
> at the end of the privious record, but
> doesnt matter for the aim her, does it?),"  I'm not sure what you mean by
> this either.  However, it sounds like you have it correct.  Lines that
> indicate the beginning of an order block, will only ever start with an A in
> the first position.

Well, what that $/="\nA" does is, it changes the amount of data the while 
() reads into $_
Usually that is a line - in your case, the change of $/ gets it to read a 
whole order into $_: from A, to T,. end of line here. Thats what you 
need. However, I cheat: it acctually reads from A,... to T, \nA, into $_, 
so even the (A,) belongs to the next record, it ends up in the privious one. 
Thats kind of wrong, given your record structure but does not matter for the 
purpous you described. See the print $_ in the code below.

> Finally, the final assumption, that "The push assumes that there are always
> exactly 5 records between B and email and that this is the only line with a
> B in record (and comes before the lines
> with ADV_".  I think that this is correct.  

well good:)

> I tested the script, and I was able to output e-mail addresses.  However,
> using the data that I posted, it does not quite output exactly what I need.
> Based on this sample of order.csv and the script that you sent me (I added
> the line "print @email" to view the output):
>
>   for (my $i=0; $i<=$#fields; $i++){
>  if ($fields[$i] eq "B") {$b_index=$i; next;}
>  elsif ($fields[$i] =~ /^ADV_.*/) {push @email, $fields[$b_index+4];
> last;}
1> print @email;
>  ):

>
> What is going wrong?  Am I trying to view the output incorrectly?

The line 1 is still in the for loop. So you print all emails seen so far for 
every field the split gave you.

Code with more debug in the right place:

---

#! /usr/bin/perl
use strict;
use warnings;

my @email;
open (FH, "){   # read the next record
  print "This record holdes:\n$_ \n"; 

  my @fields = split ",|\n", $_; # split at , or \n
  my $b_index; # 0 for every new record
  for (my $i=0; $i<=$#fields; $i++){
 if ($fields[$i] eq "B") {$b_index=$i; next;}
 elsif ($fields[$i] =~ /^ADV_.*/) {push @email, $fields[$b_index+4]; 
last;}
  } # end for

print "End of record.\n\n"
} # end while

print "@email";  #last line in script

-

On my box that prints the 2 emails you wanted.
I hope I didnt get something totally screwed.

Let me know if that does it or not. Thx, 
Wolf




-- 
To unsubscribe, e-mail: [EMAIL PROTECTED]
For additional commands, e-mail: [EMAIL PROTECTED]
 

Re: can i do it with perl ?

[wolf blaum]

>   I there,
Hi, 
>  I need to write a web database application using
> perl, and i need a way that when the users logs into
> the system  i download all the information regarding
> to the user to its local computer and make all the
> transaction locally.  After that, when the user logs
> out of the system all the information and transaction
> that were made by that user are then updated to the
> database server.   Can i do it with perl ?, which
> modules ?,  thanks.

Why does it have to be a web application? 
Or rather just a client/server thing?
What Database?
I didnt find a way to do the dishes yet, anything else I ever tried works in 
perl.

Just give us some more info.
Wolf


-- 
To unsubscribe, e-mail: [EMAIL PROTECTED]
For additional commands, e-mail: [EMAIL PROTECTED]
 

Re: can i do it with perl ?

[wolf blaum]

> Give me a little bit of time with a soldering iron, some wire, and a
> laptop connected to your home network and your dishwasher and that can
> be rectified.  :-D

I new that was a gentle list!
I just dont have a dishwasher :(
But given the traffic here I happily dont get much time to use dishes at all.

Have a nice weekend, Wolf


-- 
To unsubscribe, e-mail: [EMAIL PROTECTED]
For additional commands, e-mail: [EMAIL PROTECTED]
 

Re: From 5.6.1 to 5.8.2: how preserve installed modules?

[wolf blaum]

Hi, 

i ont want to get involved in the religios questions: for the rest:

> use PPM or CPAN.pm? - How can I get PPM to tell me everything that's
> installed?

ppm> query *   #gives you the list of installed modules
ppm> properties Mo::Dule  #gives you a detailed discriptio of that installed 
module

> Can anyone say what I would "break" by upgrading to 5.8.2?  Are there major
> CPAN modules known to become incompatible when moving to 5.8.2?

Not from the top of my head.
However, if you check 
http://aspn.activestate.com/ASPN/Modules/

and look for the ppm module status, youll find a nice table telling you which 
modules work in which version of activestate perl.
There is a lot of modules that dont work with 5.8. yet (like 
Mail::POP3Client).

Good luck, Wolf




--
To unsubscribe, e-mail: [EMAIL PROTECTED]
For additional commands, e-mail: [EMAIL PROTECTED]
 

Re: String concatenation qn

[wolf blaum]

For Quality purpouses, Ajey Kulkarni 's mail on Saturday 24 January 2004 17:52 
may have been monitored or recorded as:

> hi,.
hi
> i would like to quickly append a string to a variable.

> open NEWFH, "> $filename.new" or die "new procmailrc err";
> where $filename has /tmp/xyz
>
> Anything really silly here??

Nothing I didnt do wrong at least a thousand times:

open NEWFH, "> $filename".".new" or die "new procmailrc err";

will do it.

perldoc perlop:
Gory details of parsing quoted constructs

       When presented with something that might have several dif-
       ferent interpretations, Perl uses the DWIM (that's "Do
       What I Mean") principle to pick the most probable inter-
       pretation.  This strategy is so successful that Perl pro-
       grammers often do not suspect the ambivalence of what they
       write.  But from time to time, Perl's notions differ sub-
       stantially from what the author honestly meant.
-

This is one of the latter cases.

Wolf


--
To unsubscribe, e-mail: [EMAIL PROTECTED]
For additional commands, e-mail: [EMAIL PROTECTED]
 

Re: array push

[wolf blaum]

For Quality purpouses, Anthony J Segelhorst 's mail on Monday 26 January 2004 
17:17 may have been monitored or recorded as:

> How come when I push a variable to an array it puts one whitespace before
> the variables on all the lines except the first one?  I would except all
> the lines not to have the extra white space.
..
> print "@temparray";

Try print @temparay;

since you have a "\n" at the end of your array (btw: do you really want 
that?) , your records are seperated by something when you print them.
print " " puts a space in between the eleent as a convienience for people who 
dont have a "\n" at the end of their emelents.

hth, wolf


--
To unsubscribe, e-mail: [EMAIL PROTECTED]
For additional commands, e-mail: [EMAIL PROTECTED]
 

Re: Slices

[wolf blaum]

>
> @arary[3...] but this doesn't work?.

What about @array[3..$#array]

PS: @arary = typo?

Wolf


-- 
To unsubscribe, e-mail: [EMAIL PROTECTED]
For additional commands, e-mail: [EMAIL PROTECTED]
 

Re: array push

[wolf blaum]

For Quality purpouses, Rob Dixon 's mail on Tuesday 27 January 2004 12:42 may 
have been monitored or recorded as:

> Didn't you mean to put spaces before the last three records? This will be
> the result of
>
..
well - in Anthonys original mail there were spaces  - i just copied that.

> > Or did I totaly miss something.
>
> Maybe. I'm not sure where you're misunderstanding what I wrote. Anyway, I
> hope this helps.

ok - I think we are talking about the same thing here.
thx, wolf


-- 
To unsubscribe, e-mail: [EMAIL PROTECTED]
For additional commands, e-mail: [EMAIL PROTECTED]
 

Re: array push

[wolf blaum]

For Quality purpouses, Rob Dixon 's mail on Tuesday 27 January 2004 00:30 may 
have been monitored or recorded as:

> The right conclusion for the wrong reasons Wolf! The spaces are the result
> of interpolating the array into a string, and the presence of a newline on
> each array element is immaterial:
>
>   my @arr = ('A', 'B', 'C', 'D');
>   print "@arr\n";
>   print @arr, "\n";
>
> **OUTPUT
>
>   A B C D
>   ABCD

Hi Rob, 

well, maybe Im totally wrong here, but getting these results :

$last printed out
TMR2,mpd_gw,50,w32-ix86,client
TMR2,mpd_gw,50,w32-ix86,client
TMR2,mpd_gw,50,w32-ix86,client
TMR2,mpd_gw,50,w32-ix86,client


@temparray printed out
TMR2,mpd_gw,50,w32-ix86,client
 TMR2,mpd_gw,50,w32-ix86,client
 TMR2,mpd_gw,50,w32-ix86,client
 TMR2,mpd_gw,50,w32-ix86,client
 

from this code:

Code:
if (something){
$last = "$tmrname,$gateway_hash{$gateway},$version,$interp,$type\n";
        #print "$last";
        push(@temparray, $last);
} 

@temparray = sort @temparray;
print "@temparray";

Anthony asked, where the spaces came from, expecting the output of $last and 
@temparray to be the same.
Of course, you are right about the interpolation used before the print : i 
just meant to point out that the newlines AND the spaces in his print 
"@temparray" are a result of the quotes used with print, and his attachment 
of \n to $last before the push @temparray,$last -  without making it to 
complicated.
(Tim also hinted to $").

Or did I totaly miss something.

thx, wolf 










--
To unsubscribe, e-mail: [EMAIL PROTECTED]
For additional commands, e-mail: [EMAIL PROTECTED]
 

Re: goto command

[wolf blaum]

For Quality purpouses, Thomas Browner 's mail on Thursday 29 January 2004 
18:46 may have been monitored or recorded as:

> Does perl have a goto command. For example if you tell scrip to do
> something and it returns a 1 then it should go to a block of code that
> does something else.

Not talking about style (but in the TIMTOWTDI spirit):

from perldoc -f goto:

goto LABEL
   goto EXPR
   goto &NAME
   The "goto-LABEL" form finds the statement labeled
   with LABEL and resumes execution there.  It may
   not be used to go into any construct that requires
   initialization, such as a subroutine or a "fore-
   ach" loop.  It also can't be used to go into a
   construct that is optimized away, or to get out of
   a block or subroutine given to "sort".  It can be
   used to go almost anywhere else within the dynamic
   scope, including out of subroutines, but it's usu-
   ally better to use some other construct such as
   "last" or "die".  The author of Perl has never
   felt the need to use this form of "goto" (in Perl,
   that is--C is another matter).  (The difference
   being that C does not offer named loops combined
   with loop control.  Perl does, and this replaces
   most structured uses of "goto" in other lan-
   guages.)

hth, wolf


-- 
To unsubscribe, e-mail: [EMAIL PROTECTED]
For additional commands, e-mail: [EMAIL PROTECTED]
 

Re: Use and Require

[wolf blaum]

For Quality purpouses, Mallik 's mail on Thursday 29 January 2004 18:57 may 
have been monitored or recorded as:

> Dear Perl Gurus,

that must be someone else

>
> What is the difference between Use and Require.
>


try perldoc -f use on your box (or www.perldoc.com):

use Module VERSION LIST
   use Module VERSION
   use Module LIST
   use Module
   use VERSION
   Imports some semantics into the current package
   from the named module, generally by aliasing cer-
   tain subroutine or variable names into your pack-
   age.  It is exactly equivalent to

   BEGIN { require Module; import Module LIST; }

   except that Module must be a bareword.

   VERSION may be either a numeric argument such as
   5.006, which will be compared to $], or a literal
   of the form v5.6.1, which will be compared to $^V
   (aka $PERL_VERSION.  A fatal error is produced if
   VERSION is greater than the version of the current
   Perl interpreter; Perl will not attempt to parse
   the rest of the file.  Compare with "require",
   which can do a similar check at run time.

There is tons more infomation of how use/require are simliar/different.

Enjoy. Wolf




-- 
To unsubscribe, e-mail: [EMAIL PROTECTED]
For additional commands, e-mail: [EMAIL PROTECTED]
 

Re: New Perl User needs help with POST in perl

[wolf blaum]

For Quality purpouses, PerlDiscuss - Perl Newsgroups and mailing lists 's mail 
on Thursday 29 January 2004 23:49 may have been monitored or recorded as:
> I have written my HTML code to where it uses POST to collect information.
> Where do I start to write a script that collects the data from the web
> site, places the input into a dbm file, then places a 1 next to it like an
> array? Some of the data in the file will have zeros, while the ones that
> are inputted in the site will have a 1.
>

HI, 

try the CGI.pm modul (http://search.cpan.org).

It takes care of all your IO stuff. Use it in OO fashion (like below) or even 
in function oriented fashion (like explaind at cpan).

-snip---

#!/usr/bin/perl
#input_getter.pl

use strict;
use warnings;
use CGI qw /standard/;

my $cgi = new CGI;  #new CGI object
my @params=$cgi->param; #get all params (that came via post or get...)

print $cgi->header, #print a response
$cgi->start_html('Results'),
$cgi->h1('you entered:'),
$cgi->start_ul;

foreach (@params) { #I assume all you data come as 
#param1=value1¶m2=value2 format
#no arrays returned (as for multiple select 
boxes and so)
  print $cgi->li("$_ => ",$cgi->param($_));
}

print $cgi->end_ul,
$cgi->end_html;

--snap--

returns to the caller

--snip--


Content-Type: text/html; charset=ISO-8859-1


http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd";>
http://www.w3.org/1999/xhtml"; lang="en-US" 
xml:lang="en-US">Results
you entered:email =>  [EMAIL PROTECTED]

--snap

which looks pretty much like valid html.

However, as browsers only return parameters, for which values were entered, 
dont do something like using the foreach loop above in modified form to eter 
you data in a db, unless you have checked that all the parameters you expect 
are acctually there (by either doig it server side in your script or using a 
little ugly javascript client side).

Hope thats a start, Wolf




-- 
To unsubscribe, e-mail: [EMAIL PROTECTED]
For additional commands, e-mail: [EMAIL PROTECTED]
 

Re: Perl/Tk and portability

[wolf blaum]

For Quality purpouses, Gary Stainburn 's mail on Friday 30 January 2004 16:26 
may have been monitored or recorded as:
> Hi folks,
>

Hi Gary,

> As I've never looked at Tk before I would appreciate people's opinions on
> it. Specifically, how easy is it to develop, and how portable is it between
> the two platforms?

I havent read your privious thred, so I dont really know if this is helpful 
for you:

most of the scripts I ever wrote that I wanted to have a GUI for were scripts 
that needed (sometimes complicated) config files.
So what I did was writing qw/simle/ GUIs using Tk to produce these config 
files, that way keeping program logic and User Interface seperate (and easily 
exchangable). In that approach it is possible to do a little interactivity 
even when the "real" programm is running, but if you need to promt users for 
something ever second at runtime, thats probably to not a good idea.
However, the GUIs are pretty reusable and for these simple tasks pretty easy 
to write.

> Any comments about deploying on a Windows platform would also be
> appreciated (I want to provide it as a download, so simple install would be
> good). --

The pairs of script/gui I wrote so far worked fine on SuSe Linux 8.0 up and 
Win32 (didnt try other OS).
I once did a Win package for download using the tarma installer TI 
(www.tarma.com) which installed activestateperl if required and my script/GUI 
pair  - TI is freeware that produces a Win Installer for you. Worked fine.

If you only need to do a Win GUI, look at the GUI Loft, too. (www.banhof.se/
~johanl/perl/Loft/)
Thats a WYSIWYG GUI design tool, pretty delphi like, except that it doesent 
produce code but a design file which you can work with in you app, so you can 
click your GUI together and focus on the logic. Neat thing. 

As Joseph was pointing out, examples in the Tk docu are an endangerd species: 
Mastering Perl/Tk by Steve Lidie and Nacy Walsh is an extended zoo of these. 

Enjoy clicking around, Wolf


-- 
To unsubscribe, e-mail: [EMAIL PROTECTED]
For additional commands, e-mail: [EMAIL PROTECTED]
 

Re: Running Perl CGI from Windows

[wolf blaum]

For Quality purpouses, Jan Eden 's mail on Friday 30 January 2004 20:01 may 
have been monitored or recorded as:
> Hi all,
Hi
..
> But accessing the script from a Windows machine gives me the prepared error
> message. From the log I can see that all parameter values end up in the
> $name variable, along with the names of the second and third parameter. So
> the value of $name is:
>
> John Doe [EMAIL PROTECTED] message=This is the message
>
> Note that the first parameter's name does not appear.

What does your   tag look like?

Wolf





-- 
To unsubscribe, e-mail: [EMAIL PROTECTED]
For additional commands, e-mail: [EMAIL PROTECTED]
 

Re: Running Perl CGI from Windows

[wolf blaum]

For Quality purpouses, Jan Eden 's mail on Friday 30 January 2004 20:17 may 
have been monitored or recorded as:

Hi Jan

> Like this:
>
>  accept-charset="iso-8859-1"> ... 


Try enctype="application/x-www-form-urlencoded" instead.
I had the very same problem using the xitami webserver on WinOs.
Dont ask me were that problem comes from - no clue:-)

Hope that works, 
Wolf



-- 
To unsubscribe, e-mail: [EMAIL PROTECTED]
For additional commands, e-mail: [EMAIL PROTECTED]
 

Re: A little help please?

[wolf blaum]

For Quality purpouses, Joel 's mail on Saturday 31 January 2004 00:26 may have 
been monitored or recorded as:

Hi,

> I'm interested in learning to program perl, and I just got ActivePerl for
> Windows. I am running XP and  have a few questions. First off, how do I run
> the interpreter under Windows, preferably without the XP command prompt?

if you used the standard installer that ships with activeperl with the 
preselected options it will have set 
a) the path variable to the perl/bin directory
b) the association of .pl files with the interpreter.

(You may do both yourself under Systm Properties->Advanced->Environment 
Variables for a) and under Folder Options in the tools menue of the 
explore->File Types).

Once .pl files are assoc. with perl, dubble click on script.pl  will open a 
Command Prompt and feed your script to perl, which will subsequently run it.

However, youll probably only see any output if you script doesnt terminate 
without interaction, eg., waits for your input as its last action or so (or 
takes some time).

Thats not a problem if you call perl with your script manually from a cmd 
prompt (not the run thing under Win).

 > Also, when I opened perl, it looked like the command prompt. Is the command
> prompt accesable through perl? 
I dont understand that question.
Maybe thats the effect described above: your script is to quick for you to and 
once it ends it also terminates the promptwin (winOS does that, actually). 


>Finally is the "#!usr/bin/perl line
> necessary under XP?

Nope - but usefull.
it doesent do anything on Win (since the first line starting with #! isnt 
interpreted by command.com as it is by bash, sh or whatever shell on *NIX
and perl ignores it as a comment.

Put it keeps your scripts portable (eg, for the users of this list).

Enjoy looking around, 
Wolf


-- 
To unsubscribe, e-mail: [EMAIL PROTECTED]
For additional commands, e-mail: [EMAIL PROTECTED]
 

Re: Regarding Text Widget in Perl/Tk

[wolf blaum]

For Quality purpouses, zentara 's mail on Friday 30 January 2004 16:22 may 
have been monitored or recorded as:

Hi, 

neat trick! Great.
However, I have a, well, couriosity?

My script looks pretty much the same, except the print in &dosomething
(since it is acctually your script:-))

> Here is a set of programs, that do what you want.
> ##
> #!/usr/bin/perl -w
> use strict;
> use Tk;
> my $mw = new MainWindow;
>
> my $listbox = $mw->Scrolled("Listbox", -scrollbars => "osoe",
> -height => 5,
> -selectmode => "multiple")
> ->pack(-side => "left");
>
> my $start = $mw->Button( -text => 'Start', -command => \&start )->pack;
> $mw->Button( -text => 'Exit',  -command => \&exit )->pack;
>
>
> #start external command to pipe
> sub start {
> $start->configure(-state => 'disabled');
> open(C, "./read-own-stdout-piper 2>&1 |") or warn $!;
> $mw->fileevent( \*C, 'readable', \&doSomething );
>
> }
>
> sub doSomething {
> if ( eof(C) ) {# Child closed pipe
>   close(C);  # Close parent's part of pipe,
> # filevent is cancelled as well
>   wait;  # Avoid zombies
> return;
> }
> my $text = ;# Get text from child and put it into listbox
> print $text;  #only diffeerence.
   chomp($text);
> $listbox->insert( 'end', 'Got: ' . $text );
> $listbox->see('end');
> }
>
> MainLoop;
>
> __END__
> ##


and the called script looks different (but prints to STDOUT and has a $|++ for 
flush.

When I call the GUI from a command prompt opend under X I should see two 
parallel outputs, one in the terminal and one in the listbox, right.

I do see these outputs on both, but the one in the listbox  is way slower than 
the one to the console. However, the relation seams to be random (ie there is 
no, say constant 5 line adtvantage).
I also tried the 
tie @array, "Tk::Listbox", $listbox in &start and only call 
$listbox->see('end') in &dosomething with the result, that I get to see the 
whole output in the listbox at once and only when the callled script is 
finished.

Any Idea?

Thanks a lot, 
Wolf


-- 
To unsubscribe, e-mail: [EMAIL PROTECTED]
For additional commands, e-mail: [EMAIL PROTECTED]
 

Re: Regarding Text Widget in Perl/Tk

[wolf blaum]

For Quality purpouses, zentara 's mail on Saturday 31 January 2004 17:23 may 
have been monitored or recorded as:

>
> It's hard to say without showing us your script.

well, the called script (not the gui) is bout 500 lines...

> Try putting a "TK::after in the event loop to set the timing.

That works: no clue why, bu a great tip. Thanks.

Wolf


-- 
To unsubscribe, e-mail: [EMAIL PROTECTED]
For additional commands, e-mail: [EMAIL PROTECTED]
 

Re: Make this into a script to parse?

[wolf blaum]

For Quality purpouses, Lone Wolf 's mail on Thursday 05 February 2004 00:52 
may have been monitored or recorded as:
> I'm back to dealing with the main issue of a badly formatted file being
> brought down from an archaic system and needing to be cleaned up before
> being passed to another user or a database table.  I have the code

I assume by saying you are back that you are talking ofyour thread from 12/17: 
"get rid of whitesace around pipes??".

> below, which pulls the whole file in and parse it line by line.  That
> problem is still that when the stuff is done parsing the file, the file
> still has a ton of white spaces left in it.

did you try something like
my @fields = split /\s*\|\s*/, $line; 
as suggested by James, Jeff and Randy?
Why didnt it work - the problem looks still pretty much the same, does it?

> What I would like to do is when I first open the file (another piece of
> this massive script) is tell it to just run a sub program on each piece
> that does the same thing as the stuff below, unfortunately I am not sure
> of the way to do this.

Frankly, after a while of looking at your code Im still not sure what you want 
do - that might be due to my ignorance, but you would really help me (and I 
guess others too) understand, if you could post  some sample data before they 
go into your program and a line of how you expect thme to look like after 
they were processed by your code - I guess that would make it easier to 
figure out, where what goes how (or so).

Wolf


-- 
To unsubscribe, e-mail: [EMAIL PROTECTED]
For additional commands, e-mail: [EMAIL PROTECTED]
 

Re: (U) What are the best Perl books out there ... More than 1 is fin e ... list as many as you like

[wolf blaum]

Hi, 
I like:

Learning Perl by Randal Schwartz & Tom Phoenix as a good introduction with 
tons of further references

Programing Perl by Larry Wall, Tom Christiansen and Jon Orwant as the ultimate 
refernce and pillow

Mastering Perl/Tk by Steve Lidie and Nancy Walsh for times when I dont have 
access to this mailing list and zentaras hints

The Perl Cookbook by Tom Christiansen and Nathan Torkington for when I was to 
lasy to think for myself (or wanted to get depressed by how much better one 
could solve the problem Ive been working on in hunderts of lines)

And even though I never read it in the linear way: Mastering regular 
expressions by Jeffrey Friedl 

Not to forget: perldoc perltoc or www.perldoc.com

and The Hitchhickers Guide to the Galaxy and Last Chance to see by Douglas 
Adams. 

I guess others would recomend The Lord of the rings too.

Good night:-)
Wolf



-- 
To unsubscribe, e-mail: [EMAIL PROTECTED]
For additional commands, e-mail: [EMAIL PROTECTED]
 

Re: removing all elements in an array

[wolf blaum]

For Quality purpouses, Markham, Richard 's mail on Thursday 05 February 2004 
04:27 may have been monitored or recorded as:

> How can I simply remove all elements in an array, given that the array
> is global and a procedure defines the elements to where the total
> number of elements in this array could be very well be less.
>
> I have tried @array = (); but this seems to affect the arrary in that
> it wont take any element assignments afterwards.
>

well 
---snip---
#!/usr/bin/perl
use strict;
use warnings;
my @array=qw/1 2 3 4 5 6 a s d f g/;

print "Length for blank: ", scalar @array,"\n";
print "$_ " foreach (@array);
@array=();
print "\nLength after blank: ", scalar @array,"\n";

---snap---

does it.

@array=(); is the way to go:
I guess your proble is somewhere else.

> Do I need to iterate through each element and blank the out?

"...making easy thigs easy and hard things possible" - heavans no!

wolf


-- 
To unsubscribe, e-mail: [EMAIL PROTECTED]
For additional commands, e-mail: [EMAIL PROTECTED]
 

Re: Make this into a script to parse?

[wolf blaum]

For Quality purpouses, Lone Wolf 's mail on Thursday 05 February 2004 04:23 
may have been monitored or recorded as:

Hi
 
> Thank goodness I never said I had perfect code, because I would
> definitely be lying.

no worries - I post code to get feedback. Thats the whole ideaof learning it.

> I attached 2 files, one the beginning data, the other the .sql file that
> I load into MySQL database.  The files are about 3000 lines before and
> after so I cut out the first 30 lines and put them in the files to the
> list.

Ok - then, again: Do not read these files into mem at once unless you really 
have to (which should be close to never).

here is a script that uses your given data:

---snip---
#!/usr/bin/perl

use strict;
use warnings;
my (@fields, $lng);

opendir INDIR , "./sql" or die "Can't open dir with before files:$!";

foreach my $infile (grep {!/^\./} readdir INDIR) {
#read all the files in your home/sql dir
#read only files that do not start with a .
  my ($i,$rec);

  open INFILE, "<./sql//$infile" or die "Can't open $infile: $!";
  open OUTFILE, ">./${infile}.out" or die "Can't open ${infile}.out at home: 
$!";
  while () {
   $rec++;
   chomp;
   @fields = split /\s*\|\s*/, $_;
   $fields[0] =~ s/^\s+//; 
   #there is probably a way to get rid of the trailing spaces in the first 
entry using split,I just couldnt think of any.

   $lng = @fields unless $lng; #set $lng for first record
   print "The following record: $i has ", scalar @fields, " fields as compared 
to $lng fields in the first record! Skip. : $_\n" and next unless $lng == 
@fields;
#poor quality control of your input data: check if all reords have the same 
number of fields or skip and print record otherwise.
   $i++;
   print OUTFILE $i;
   print OUTFILE "|$_" foreach (@fields);
   print OUTFILE "|$fields[0]\n"; #your trailing ID
  }
  close INFILE;
  close OUTFILE;
  print "Read $rec records from ./sql/$infile and printed $i into ./
${infile}.out\n";
}
closedir INDIR;
---snap---

A couple of hints:

The script reads all files in the sql subdir of your home dir and produces the 
corrosponding filname.out in your homedir.

the split splits as written by Jeff et al.
I coulndt think of a better way to substtute the leading spaces for the first 
field.
Anyone better suggestions?

you end up with a final \n in each outfile.

You rewrite it into a sub by substititing the line
foreach my $infile (grep {!/^\./} readdir INDIR) {
with

sub whatever{
...
foreach my $infile (@_) {

and call th sub with
&whatever ("file1", "file2", ...);

of course you may want to change the open statements to, if you dont have your 
infiles in ./sql

Hope that gets you started, Wolf







-- 
To unsubscribe, e-mail: [EMAIL PROTECTED]
For additional commands, e-mail: [EMAIL PROTECTED]
 

Re: Make this into a script to parse?

[wolf blaum]

For Quality purpouses, wolf blaum 's mail on Thursday 05 February 2004 06:07 
may have been monitored or recorded as:

> The script reads all files in the sql subdir of your home dir and produces
> the corrosponding filname.out in your homedir.

shame on me: of course it reads all the files in the sub dir sql of the 
CURRENT DIR, not the home dir. use ~/ if you want your homedir...

Well, if been here a while...

Something else i forgot: why do you need the count on the beginning of the 
line? I hope not as a unique (primary) key for the dbtable you feed that 
into.There should be an AUTO_INCREMENT in your DB for that.
And talking about DBs: 
According to te 3rd rule of Normalisation as outlined by e.f.codd of ibm in 
the 1970s: (to that i was arround at this time...)

"An Entity is said to be in 3rd normal form if it is allready in 2nd normal 
form and no nonidentifying attributs are dependent on any other 
nonidentifying attributs."

The repeat of a value like $fields[0] clearly violates this rule.
See www.databasejournal.com/sqletc/article.php/1428511
on Db Design.

Good night, wolf


-- 
To unsubscribe, e-mail: [EMAIL PROTECTED]
For additional commands, e-mail: [EMAIL PROTECTED]
<http://learn.perl.org/> <http://learn.perl.org/first-response>

Re: Remote script execution

[wolf blaum]

For Quality purpouses, Thind, Aman 's mail on Thursday 05 February 2004 06:24 
may have been monitored or recorded as:
> Hello Friends,
Hi

> I want to write a script that when executed will get lots of details from
> 10 different Unix(AIX) and Windows(XP) boxes and generate a report.
>
> The details to be gathered about the machines include :
>
> 1) Names and versions of all the softwares on the machines.
>
> 2) Disk space usage.
>
> Etc...

my ideas:

either see if you can get these information from each of these machines by 
establishing a telnet or ssh connection to them and remotly executing 
commands (maybe own perlscripts) on the remote machines - Net::Telnet 
from CPAN allows you client side connections using the telnet protocol.
Net::SSH goes for ssh.

Or - but that gets complicated: write client and server side software using 
IO::Socket and establish your own commands.

Since you will probably need OS depending software on the remote machines 
anyway to get you infos I would go with the first solution.

Also take a look  at the available remote backup solutions on the net: maybe 
you find something to modify.

But maybe you first want to see how OS dependend your queries are and what 
"lots" means: your network admin might appreciate the idea of localy 
generating the reports   and sending them to the query machine at once 
instead of generating them by remotly executing commands.

I think, whether you go with a centralisied or local solution depends on how 
often you expect to change the details you want to query and the frequency in 
which new systems and OSs are added to your net.
If seldom or never, you might think of generating the reports localy and 
mailing them independently to the query machine (eg, via email). 
If frequently, then you might not want to run arround and change your local 
scripts everytime - see first ideas.

You see: it gets out of hand - i better stop here.

good luck, Wolf


-- 
To unsubscribe, e-mail: [EMAIL PROTECTED]
For additional commands, e-mail: [EMAIL PROTECTED]
 

Re: Script to parse files

[wolf blaum]

For Quality purpouses, LoneWolf 's mail on Friday 06 February 2004 16:57 may 
have been monitored or recorded as:
> I've been working with this since wolf and jeff and john sent me some
> stuff, I think I actually based everything on wolf's code excerpts.  I'm
> sure my final code is going to not be perfect, but at least I have the
> piece of mind of knowing that I can get this thing some better then it was.
>  I'm still not sure on making it a sub that I can use on anything, but I'll
> deal with that issue another day.

easy: (notice: thats the same script as priviously but has the parse in a 
sub:)

---snip---
#!/usr/bin/perl

use strict;
use warnings;
my (@fields, $lng);

sub whatever {

 if (@_) {
 
 foreach my $infile (@_) {
 
  my ($i,$rec);

  open INFILE, "$infile" or die "Can't open $infile: $!";
  open OUTFILE, "${infile}.out" or die "Can't open ${infile}.out at home: 
$!";
  while () {
   $rec++;
   chomp;
  [EMAIL PROTECTED] = split /\s*\|\s*/, $_;
   $fields[0] =~ s/^\s+//; 
   #there is probably a way to get rid of the trailing spaces in the first 
entry using split,I just couldnt think of any.

   $lng = @fields unless $lng; #set $lng for first record
   print "The following record: $i has ", scalar @fields, " fields as compared 
to $lng fields in the first record! Skip. : $_\n" and next unless $lng == 
@fields;
#poor quality control of your input data: check if all reords have the same 
number of fields or skip and print record otherwise.
   $i++;
   print OUTFILE $i;
   print OUTFILE "|$_" foreach (@fields);
   print OUTFILE "|$fields[0]\n"; #your trailing ID
  }
  close INFILE;
  close OUTFILE;
  print "Read $rec records from ./sql/$infile and printed $i into ./
${infile}.out\n";
} #end foreach
return 1;
}
else {return undef;}
} #end sub whatever

---snap---


call it with &whatever('path/to/firstfile', 'path/to/secondfile',...)

Enjoy, Wolf


--
To unsubscribe, e-mail: [EMAIL PROTECTED]
For additional commands, e-mail: [EMAIL PROTECTED]
 

Re: Reg. string matching using reg-exp

[wolf blaum]

For Quality purpouses, Balaji Thoguluva 's mail on Friday 06 February 2004 
20:44 may have been monitored or recorded as:
> Hi,
>  I am a novice to perl programming. When I execute the following code,
> I get always "No Match". I guess my reg-exp is correct. I also tried
> changing $line= "INVITE sip:[EMAIL PROTECTED] SIP/2.0"; to have double
> quotes and a backslash char before @ symbol. Even then it gives me No
> Match. I appreciate your help.
>
> #!/usr/bin/perl -w
> my $line= 'INVITE sip:[EMAIL PROTECTED] SIP/2.0';
> if($line =~ /^\s*(\w+)\s*(.*)\s+(sip\/\d+\.\d+)\s*\r\n/i)

Do you have the \r\n at the end of $line?
Wolf


-- 
To unsubscribe, e-mail: [EMAIL PROTECTED]
For additional commands, e-mail: [EMAIL PROTECTED]
 

Re: Script to parse files

[wolf blaum]

For Quality purpouses, wolf blaum 's mail on Friday 06 February 2004 20:15 may 
have been monitored or recorded as:

> easy: (notice: thats the same script as priviously but has the parse in a
> sub:)
>
> ---snip---
> #!/usr/bin/perl
>
> use strict;
> use warnings;
> my (@fields, $lng);


... and that my (@fields, $lng); belings in the sub
wolf


-- 
To unsubscribe, e-mail: [EMAIL PROTECTED]
For additional commands, e-mail: [EMAIL PROTECTED]
<http://learn.perl.org/> <http://learn.perl.org/first-response>

Re: How to Implement a BNF syntax in perl?

[wolf blaum]

For Quality purpouses, Balaji Thoguluva 's mail on Friday 06 February 2004 
18:49 may have been monitored or recorded as:

> Hi,

Hi
> I have a long BNF (Backus-naur form) for parsing a protocol message.
> Suppose I want to implement a BNF like this
>
> Response = Status-line
>*(message-header)
>CRLF
>[Message-body]
>
> status-Line = SIP-Version SP Status-Code SP Reason-Phrase CRLF
> SP = space character
> ..
> .
>
> Like this I have a very long BNF. How can I implement this BNF and 
> parse a message that satisfies this BNF in perl ? Any suggestions would be
> of great help to me.

Maybe Config::Natural is good to you.

Wolf


-- 
To unsubscribe, e-mail: [EMAIL PROTECTED]
For additional commands, e-mail: [EMAIL PROTECTED]
 

Re: Which is better, opening and closing, or a massive file opening and a massive closing?

[wolf blaum]

For Quality purpouses, [EMAIL PROTECTED] 's mail on Wednesday 11 February 
2004 22:08 may have been monitored or recorded as:

Hi, 

> I'm still working on the script, though it is cleaning up even better, I
> even have it running cleaner by dumping anything not matching some specs.
> What I am trying to figure out though is this:
>
> I have 42 places for the output to go, 1 of those is a constant dump, the
> others are all based on whether or not there is data in a field.  If the
> data is in the field, the data writes to a file with the same name as the
> data checked.  If not then it writes to a global catch-all.

If I recall your last mail correctly you were opening a lot of file handles, 
than running into the switch kind of thing and than closing all the files 
again.
That was: a lot of system calls (open) to eventually write to a few of the 
files in the SWITCH (the accumulated ifs) and then again a lot of sys calls 
to closethem, where you have actually writen to only a few of the opend 
files.

That sounds slow.
Wiggins allready suggested

if (grep $fields[4] == $_, @cities) {
  $tmptxt = $fields[10];
}
else {
  $tmptxt = '1-' . $fields[10];
}

for the first SWITCH like construct.
For the second one id say, make an array of your filenames and use the contend 
of filed[11] as index, like:

my @file_names=qw (/home/multifax/everyone /home/multifax/
pack-fishbait .);

if (defined $file_name[$fields[11] - 102]) {
  open OUTFILE ">${file_name[$fields[11] - 102]}" or die "Cant open 
${file_name[$fields[11] - 102]}:$!";

  print OUTFILE "[EMAIL PROTECTED]"; #your trailing ID
  close OUTFILE; 
 }
else {
  open OUTFILE ">default.out" or die "Cant open default.out :$!";
  print OUTFILE "[EMAIL PROTECTED]"; #your trailing ID
  close OUTFILE; 
}

However, this assumes that you have continous values from 102 upwards in 
$fields[11] - if not, come up with a formula that gives you the index of the 
wanted filename in @file_names depending on $fields[11]or use a hash instead:

$file_name{102}="whatever/filename/you.want";

I suggest you tell us, what the logic behind all these different files is, ie, 
what goes where of which cause: maybe someone can come up with a hash 
structure that incoorporates this knowledge.
Dont open and close 42 files if you only will ever print to 2 of them.

Enjoy, Wolf






--
To unsubscribe, e-mail: [EMAIL PROTECTED]
For additional commands, e-mail: [EMAIL PROTECTED]
 

Re: Checking for calling context

[wolf blaum]

> Hey there,
Hi
> I have a set of functions that send an XML element, wait for a response,
> parse the response, and return it. However, there are often cases where
> the resulting XML is never used, and so parsing it is pointless. Is
> there a way that a sub can tell where the result is going to go, so that
> it can not do the parsing if the result is going to be immediatly
> discarded?
>
If you are asking how to teel between:

$var=⊂
and
⊂

- not that I know.
However, there is a way to tell who asked for the result:
read perldoc -f caller

but why dont you pass a parameter to the sub that tells it?

Wolf


-- 
To unsubscribe, e-mail: [EMAIL PROTECTED]
For additional commands, e-mail: [EMAIL PROTECTED]
 

Re: can't bind a reference using Tk

[wolf blaum]

On Monday 23 February 2004 18:31, Michael Ragsdale generously enriched virtual 
reality by making up this one:

..

Hi Mike, 

> my $ent =$right->Entry(-width=>8,-background=>'white')->pack(-side=>'left'); 
^line 1

> my $go = $right->Button(-text=>'Get
> Data',-command=>sub{compute($ent)})->pack(-side=>'top');

^line2

> MainLoop();
>
> sub compute {
>  my $data_source = "DBI:Oracle:host=*..***.***;sid=";
>
>  my $dbh = DBI->connect($data_source,"*","**")
>  or die "Cannot connect to $data_source; $DBI::errstr\n";
>
>  my $sth = $dbh->prepare(qq(SELECT cuid, cuname
> FROM fcustomer
> WHERE cuid = ?)) or die "Cannot prepare
> query: $DBI::errstr\n";
>
>  $sth->execute($_[0]) or die "Cannot execute query: $DBI::errstr\n";
^line 3

>
>  my @row = $sth->fetchrow_array;
>
>  $id_txt->configure(-text=>$row[0]);
>  $name_txt->configure(-text=>$row[1]);
>  $sth->finish();
>  $dbh->disconnect;
> }
>
> When I enter an id in the Entry widget and click on the button, I get the
> following error message:
..

> I've tried to dereference $ent by sending $$ent but that didn't work either
> and gave me the error of "not a SCALAR reference".  Any suggestions
> welcome.

In line 1 you create an Entry Widget object $ent.
In line 2 you pass that object to sub compute when the button is pressed.
And in line three you expect a number (whatever was enterd into $ent).
This

sub compute {

my $msg = " You passed ".$_[0]->get()." to compute.";
$main->messageBox(-message=>"$msg", -type=>'OK',-icon=>'info');

}

works.

However, dont pass the object - pass a refernece to it in line 2, like:
my $go = $right->Button(-text=>'Get Data',-command=>sub{compute(\
$ent)})->pack(-side=>'top');

and use $$_[0]->get in compute

OR:

associate a (global) variable with the entry widget in line 1 like:

my $entryvar;
my $ent =$right->Entry(-width=>8,-background=>'white', - textvariable => \
$entryvar)->pack(-side=>'left'); 

This way  you allways end up having the actual value shown in $entryvar.
You get a new global, but you dont have to pass an object (or a reference to 
one) if you dont need to for other reasons.

HTH, 
Wolf







-- 
To unsubscribe, e-mail: [EMAIL PROTECTED]
For additional commands, e-mail: [EMAIL PROTECTED]
 

Re: can't bind a reference using Tk

[wolf blaum]

On Tuesday 24 February 2004 04:29, Michael Ragsdale generously enriched 
virtual reality by making up this one:

..

> >However, dont pass the object - pass a refernece to it in line 2, like:
> >my $go = $right->Button(-text=>'Get Data',-command=>sub{compute(\
> >$ent)})->pack(-side=>'top');
> >
> >and use $$_[0]->get in compute
>
> I see the advantages of passing by reference, however, when I added the \
> to pass the reference of $ent and the $ to dereference $_[0], it no longer
> worked.  These were the only two changes and it left me with...
>
> my $go = $right->Button(-command=>sub{compute(\$ent)})->pack;
>
> sub compute{
>  my $input = $$_[0]->get();
>  $sth->execute($input) or die.
> }
>
> The error was "can't call method get on an undefined value".  Now I'm
> really confused.  Why would passing the object work, but passing the
> reference and then dereferencing in the sub doesn't?


my fault:

my $input = ${$_[0]}->get();

should work.
I usually use something like :

my $passed_ref=shift;
and then work from there on.

Enjoy: wolf




-- 
To unsubscribe, e-mail: [EMAIL PROTECTED]
For additional commands, e-mail: [EMAIL PROTECTED]
 

Re: Perl Newbie

[wolf blaum]

On Tuesday 24 February 2004 15:49, Peterson, Darren - Contractor.Westar 
generously enriched virtual reality by making up this one:

> Hello, all.  I'm as green a Perl programmer as can be.  As a matter of
> fact, I am green in OO programming and network communications.  I spent 12
> years maintaining FORTRAN code on 1970's mainframe computers.  I do love
> FORTRAN...

welcome to perl then:-)

> But my boss has asked me to coordinate app execution on a handful of mixed
> boxes on a small LAN.  The boxes are W2K and Linux.  A network savvy friend
> of mine suggested Perl.  As I work through a tutorial (Beginning Perl @
> learn.perl.org, anyone have chapter 11?) on Perl starting this morning,
> what I really need immediate help with is TCP communication between a
> master app and a slave app.  As a base upon which to build I would like to
> set up a script on one box that throws a message, any message, through any
> port to a script on another box.  The second script should loop until
> message is received, then print and die.

Look at 

http://modperl.com:9000/perl_networking/source/ch5/

for code examples.
That is code from Lincoln Steins excellent book Network Programming with Perl.
Briefly: read about file handles the non OO way.
Then read about IO::File and IO::Socket.
Both inherit most (all) methods from IO::Handle, thus making the scource of 
your input / the destination of your output pretty arbitrary. ie: reading 
from a socket is no more difficult than reading from a file.
and: www.perldoc.com

Enjoy, Wolf


-- 
To unsubscribe, e-mail: [EMAIL PROTECTED]
For additional commands, e-mail: [EMAIL PROTECTED]
 

Re: Is there an etc. command in perl?

[wolf blaum]

On Wednesday 25 February 2004 21:52, Joel generously enriched virtual reality 
by making up this one:

Hi, 

> Is there an et cetera type command in perl? Specifically, what I want to do
> is to go from

is there an etc command in any other programing language? 

>
> while (1) {
> my $num = shift @numarray;
> if ($num % 2==0) {
>
> and if the modulus of 2 is 0, find the modulus of 3 and so on. Can anyone
> give me some suggestions?
>

What about this one:

---snip---

#! /usr/bin/perl

use strict;
use warnings;

my @numarray=qw/2 6 13 18 24 33 120/;

foreach (@numarray){
  print "\nMODing $_: ";
  for (my $i=1; $i>0;$i++){
print "$i ";
print " doesnt MOD it." and last if ($_ % $i != 0);
print "MODs ";
  }
}
print "\n";


---snap---

prints 

---snip---

#~> ./mod.pl

MODing 2: 1 MODs 2 MODs 3  doesnt MOD it.
MODing 6: 1 MODs 2 MODs 3 MODs 4  doesnt MOD it.
MODing 13: 1 MODs 2  doesnt MOD it.
MODing 18: 1 MODs 2 MODs 3 MODs 4  doesnt MOD it.
MODing 24: 1 MODs 2 MODs 3 MODs 4 MODs 5  doesnt MOD it.
MODing 33: 1 MODs 2  doesnt MOD it.
MODing 120: 1 MODs 2 MODs 3 MODs 4 MODs 5 MODs 6 MODs 7  doesnt MOD it.

---snap---

on my box.

Is that what you want?
May I ask what you are planning to do?

Enjoy, Wolf


-- 
To unsubscribe, e-mail: [EMAIL PROTECTED]
For additional commands, e-mail: [EMAIL PROTECTED]
 

Re: Pattern matching problem

[wolf blaum]

On Wednesday 25 February 2004 17:35, Henry Todd generously enriched virtual 
reality by making up this one:

Hi, 

> I'm having trouble counting the number of specific substrings within a
> string. I'm working on a bioinformatics coursework at the moment, so my
> string looks like this:
>
> $sequence = "caggaactttcggaagaccatgta";
>
> I want to count the number of occurrences of each pair of letters, for
> example:
>
> Number of occurrences of "aa"
> Number of occurrences of "gt"
> Number of occurrences of "cc"
>
> This is how I'm counting the number of "cc" pairs at the moment ($cc is
> my counter variable):
>
> $cc++ while $sequence =~ /cc/gi;
>

As I understand Biology, there is 4 nucleotid acids which gives 4**2 
combinaions for dupplets. So you need 8 vars to count the occourence of all 
douplets. Worse for triplets. (24)
As I understand genetics, triplets are what matters, since the rma 
transcriptase reads triplets as code of amino acids. 
You might give my updates un my biol. knowledge:-)

To make your code reusable in upcomming classworks I suggest:

---snip---

#! /usr/bin/perl

use strict;
use warnings;


my %wmers;
my $sequence = "caggaactttcggaagaccatgta";
my $wordsize = 2;

for (my $i=0;$i < length($sequence) - $wordsize;$i++){
  $wmers{substr($sequence,$i,$wordsize)}++;
}

foreach (keys %wmers) {
 print "$_ => $wmers{$_}\n";
} 

---snap---

prints on my box:

---snip---

#~> ./gataca.pl
at => 1
ct => 2
ag => 2
tt => 1
cc => 4
aa => 2
gt => 1
ga => 3
tg => 1
ca => 2
tc => 2
gg => 2
cg => 1
ac => 2

---snap---

The Idea is simple: imitate the rma transcriptase (I know you are talking 
about dna, but does that matter?) by sliding a $wordsize window over the 
sequenze.
For each window content inc the value of the corosponding hash field, create 
if necessary.

I bet, there is  a smarter solution using pos and regexes and a character 
class [gatc]{ $wordsize} - that would even make the thing usable for proteins 
by changing the character class to the protein alphabet

But im getting OT her - maybe I should have done something else for a 
living:-)

Enjoy (and reproduce), Wolf


-- 
To unsubscribe, e-mail: [EMAIL PROTECTED]
For additional commands, e-mail: [EMAIL PROTECTED]
 

Re: Pattern matching problem

[wolf blaum]

On Thursday 26 February 2004 12:28, Henry Todd generously enriched virtual 
reality by making up this one:

> On 2004-02-26 00:43:21 +, [EMAIL PROTECTED] (Wolf Blaum) said:
> > As I understand Biology, there is 4 nucleotid acids which gives 4**2
> > combinaions for dupplets. So you need 8 vars to count the occourence of
> > all douplets. Worse for triplets. (24)
> > As I understand genetics, triplets are what matters, since the rma
> > transcriptase reads triplets as code of amino acids. You might give my
> > updates un my biol. knowledge:-)
>
> Wolf -
>
> It's been a while since my A-Level biology days, but I believe you're
> correct. However, this particular coursework was to create two programs
> for a different purpose than I think you're imagining:

Hi, 

as  you can tell form my mail it has been a while since my basic math classes, 
too: 4**2 =8? 4**3=24?  Uhuh...
However, the real bug was 
for (my $i=0;$i < length($sequence) - $wordsize;$i++){
which should be 
for (my $i=0;$i <= length($sequence) - $wordsize;$i++){
beause it misses the last douplet/triplet/... otherwise.

> transition.pl: returns tables of transition probabilities for plus and
> minus models (exon and non-exon regions) as well as beta values
> (log-odds ratios) to compare the two models.
>
> The transition probability for AT for example (the probability that
> adenine will be followed by thymine) is calculated thus:
>
> tp(AT) = |AT| / |A_|
>
> The total number of occurrences of "AT" divided by the total number of
> "A" followed by anything.
>
> The program can also write the transition probabilities to a file to be
> used as input for the other program...

ok - but once you end up with a hash containing all the douplets as there keys 
and frequency as values that should be doable as long as you know the members 
of your alphabet. 
I dont know if there is such a thing as transition probabilitis for codons (ie 
triplets) as well - if there is, then this should manifest as transition 
probilities for amino accids. In that case, creating the hash of wmers is 
done by just feeding the script another sequence. The only thing to change 
would be add knowledge about the AA alphabet to your script.

> simulation.pl: which asks the user to specify the length of the
> sequence they want, then generates it according to the model file used
> as input (by simulating a Markov chain). So if you supply a file
> containing the transition probabilities of a typical exon (coding)
> region, the simulation will use them to generate a typical exon
> sequence.

This gets really of topic:
Just interested: How do you choose which Letter to start with since there is 
no tp for nothing folowed by whatever?

Sounds like a fun problem:)

G'day, Wolf




-- 
To unsubscribe, e-mail: [EMAIL PROTECTED]
For additional commands, e-mail: [EMAIL PROTECTED]
<http://learn.perl.org/> <http://learn.perl.org/first-response>

Re: Array question

[wolf blaum]

On Friday 27 February 2004 01:18, Chris generously enriched virtual reality by 
making up this one:

> Hi Guys,
>
> I have a problem with e-mail address's and an array. I have some code that
> will be a documentation spider to go through all our technical
> documentation, extract e-mail address's and attempt to sort and exclude
> certain e-mails/patterns. All documentation is in plain text, so no
> filters, etc are needed.
>
> The first array will have every e-mail address found pushed into it.
>
> The second array will be an "exclude" array, in which I would like to
> search through, and remove from the "email" array, if found.
>
> The following code will loop through the "email" array and the "exclude"
> array, and successfully removes the emails from the "email" array that are
> specified in the "exclude" array:
>
> my %found = ();
> foreach (@emails) { $found{$_}++ };
> foreach (@exclude) { exists $found{$_} and delete $found{$_} }
>
> BUT, if I print out the hash with this:
> foreach my $key (keys %found) {
> print "$key\n";
> }
>
> The output comes up messed up for example:
> chris.com
>
> instead of:
> [EMAIL PROTECTED]

hi, 

this one: 

---snip---
#! /usr/bin/perl

use strict;
use warnings;

my @emails = qw/[EMAIL PROTECTED] [EMAIL PROTECTED] [EMAIL PROTECTED]/;
my @exclude = qw/[EMAIL PROTECTED] [EMAIL PROTECTED] [EMAIL PROTECTED]/;

my %found = ();
foreach (@emails) { $found{$_}++; }
foreach (@exclude) { exists $found{$_} and delete $found{$_}; }

foreach my $key (keys %found) {
  print "$key\n";
}

---snap---

prints on my box 


---snip---

#~> ./douglas_in_bloom_county.pl
[EMAIL PROTECTED]
[EMAIL PROTECTED]

---snap---

so I think your @emails doesnt hold what you think it does.
How do you [EMAIL PROTECTED]

> Why is this happening? Also, if I wanted to add for example: info without
> @domain.xxx to the "exclude" array, how can I remove any e-mail in the
> "emails" array based on a partial match?
>

You could replace 

foreach (@exclude) { exists $found{$_} and delete $found{$_}; }

with 

foreach my $key (keys %found) {
  foreach (@exclude) {
delete $found{$key} if $key=~/$_/;
  }
}

and add zappod to @exclude (no xxx).
However, this takes the whole sense of using a hash in the problem so instead 
of looping over the keys, loop over @email and @exclude.
Or someone suggests a smarter way whih I would be interested in!

Wolf


-- 
To unsubscribe, e-mail: [EMAIL PROTECTED]
For additional commands, e-mail: [EMAIL PROTECTED]
 

Re: Help with Radio_group

[wolf blaum]

On Sunday 29 February 2004 17:20, [EMAIL PROTECTED] generously enriched 
virtual reality by making up this one:

Hi

> I have a script that processes a form input. What I want to do is this:

I assume you are talking about a html form.

> I have form elements:
>
> -radio_group1
> -radio_group2
>
> -textfield: takes 6 digits depending on the user' selection.
>
> I want the textfield to be populated with 00 if the user select
> radio_group2.
>
> Any idea on how to do that and thanks in advance!

---snip---

#! /usr/bin/perl
use strict;
use warnings;
use CGI qw(:standard);

my $p = new CGI;
my $myself =$p->url;
my $text;

if ($p->param){
 if ($p->param('radio') eq 'take') {$text=$p->param('textfield');}
 else {$text='00';}
  print
  $p->start_html('Results'),
  $p->h1('Results'),
  $p->p("$text"),
  $p->end_html;
}
else {
  print
  $p->start_html('Form'),
  $p->start_form(), #defaults are this script, post, x-www-urlencoded
  $p->textfield(-name=>'textfield'),
  $p->radio_group(-name=>'radio', -values=>['take','delete']),
  $p->submit,
  $p->end_form,
  $p->end_html;
}

---snap---

prints a form with two radiobuttons (in the same group, 'radio') if the script 
s caled  without parameters.
If parameters are returned, $text is set to the content of your texfield if 
radio=take, otherwise $txt is se to '00'.

Read the CPAN docu for the CGI module if you need help with it - tons of 
examples.

Enjoy, Wolf



-- 
To unsubscribe, e-mail: [EMAIL PROTECTED]
For additional commands, e-mail: [EMAIL PROTECTED]
 

Re: Help with Radio_group

[wolf blaum]

On Monday 01 March 2004 02:06, wolf blaum generously enriched virtual reality 
by making up this one:

> On Sunday 29 February 2004 17:20, [EMAIL PROTECTED] generously
> enriched virtual reality by making up this one:
>
> Hi
>
> > I have a script that processes a form input. What I want to do is this:
>
> I assume you are talking about a html form.
>
> > I have form elements:
> >
> > -radio_group1
> > -radio_group2
> >
> > -textfield: takes 6 digits depending on the user' selection.
> >
> > I want the textfield to be populated with 00 if the user select
> > radio_group2.
> >
> > Any idea on how to do that and thanks in advance!
>
> ---snip---
>
> #! /usr/bin/perl
> use strict;
> use warnings;
> use CGI qw(:standard);
>
> my $p = new CGI;
> my $myself =$p->url;
> my $text;


print $p->header;

Sorry, I forgot. Wolf


-- 
To unsubscribe, e-mail: [EMAIL PROTECTED]
For additional commands, e-mail: [EMAIL PROTECTED]
<http://learn.perl.org/> <http://learn.perl.org/first-response>

Re: Forking

[wolf blaum]

On Wednesday 03 March 2004 20:47, Price, Jason generously enriched virtual 
reallity by making up this one:

Hi 

> Thanks for the input - it's quite helpful.  

and nice:-)

> However, I don't fully
> understand some of the code - maybe you could help clear it up for me.  The
> parts I'm unclear on are:
>
> - the usage of "pipe READER, WRITER", and then the subsequent references to
> READER and WRITER.

pipe takes two filehandles: a readhandle and a writehandle. all children 
inherit filehandles of the parent process as a copy.
Now the children close the readhandle, since they only want to repord back to 
the parent and make the writehandle the default filehandle for output using 
the select command.

The parent on the other hand doesnt need the writehandle and reads from the 
readhandle until eof, which occours after every child has closed the 
readhandle(by exiting) - the OS keeps track of the handle and closes it only 
after the last process using it closed it.


> - the usage of $|

$| > 0 enables autoflush, ie turns buffering off and thus gives you a "hot 
pipe" - eg., STDOUT is usally line bufferd. Default for $| is 0.  

> - "1 while wait() > 0"

translates to: "Do nothing while i still have children out there." wait() 
waits for the child to teminate and returns its pid once it died.

>
> Hmm...I guess that's the majority of the script.  :)  I can follow what it
> does, but I'm not entirely sure why it does it.
>
> Also, is there any way I can self-contain the output from each child
> process?

what about prependin a "$$ says:" to each line of child output and doing a 
m //  in the parent process?
(Not to smart but all I can come up with and less complicated then having 
seperate handles for each child :-)
Id be interested in how you solf that.

HTH, Wolf

> Thanks.
>
> Jason
>
> -Original Message-
> From: Bob Showalter [mailto:[EMAIL PROTECTED]
> Sent: Wednesday, March 03, 2004 1:17 PM
> To: 'Price, Jason'; '[EMAIL PROTECTED]'
> Subject: RE: Forking
>
> Price, Jason wrote:
> > Not sure if this is the right list for this - if it's not, please
> > direct me to the proper list.
>
> You've come to the right place.
>
> > Anyway, I'm trying to get my hands around forking, and was hoping you
> > all could help me out.  Basically, I'm trying to find a way to fire
> > off a remote script on numerous boxes in parallel, returning their
> > results to the parent script.  Here's the basic flow I'm after:
> >
> > 1.  User brings up web page for an on-demand report.  Provides user
> > input, hits submit, which fires off the parent script.
> > 2.  Parent script takes user input, and fires off a remote script
> > located on all servers provided by user input.
> > 3.  Remote scripts return results to an array in the parent script.
> > 4.  Parent script compiles results and formats output for web display.
> >
> > The process currently works, but runs each remote server in series,
> > which takes a considerable amount of time.  I've had a hell of a time
> > finding a good explanation of forking, and I only seem to be able to
> > figure out how to fork one process at a time.  I'm also unsure if the
> > parent can utilize variables populated in a child, or if they're
> > completely independent after the fork.
>
> No. The parent cannot see any variables in the child. You need to use some
> form of IPC to communicate between the processes. I would suggest using a
> pipe. Here's an example of a parent that forks off three children, and then
> reads data back from the children through a common pipe:
>
>   #!/usr/bin/perl
>
>   use strict;
>   $| = 1;
>   my $nc = 3; # number of children to create
>   pipe READER, WRITER;# pipe for communication
>
>   for my $c (1 .. $nc) {
>   # create a child process
>   defined(my $pid = fork) or die "Couldn't fork: $!";
>   next if $pid;   # parent loops to create next child
>
>   # child does it's thing and writes back to parent through pipe
>   close READER;
>   select WRITER;
>   $| = 1;
>   print "Hello, I am child $c, and my PID is $$\n";
>   sleep rand(5) + 1;
>   print "Goodbye from child $c\n";
>   exit;   # child exits (IMPORTANT!)
>   }
>
>   # parent reads from children
>   # pipe will close when last child exits
>   close WRITER;
>   while() {
>   print $_;
>   }
>
>   1 while wait() > 0;   # reap all exit statuses
>
> Sample output:
>
>   $ perl myscript.pl
>   Hello, I am child 1, and my PID is 16774
>   Hello, I am child 2, and my PID is 16775
>   Hello, I am child 3, and my PID is 16776
>   Goodbye from child 2
>   Goodbye from child 1
>   Goodbye from child 3
>
> If you need explanation of any of that, let me know.


-- 
To unsubscribe, e-mail: [EMAIL PROTECTED]
For additional commands, e-mail: [EMAIL PROTECTED]
 

Re: Forking

[wolf blaum]

On Wednesday 03 March 2004 21:57, Bob Showalter generously enriched virtual 
reallity by making up this one:

Hi, 

> > - "1 while wait() > 0"
>
> That just reaps the exit statuses to prevent zombies; the children have
> already exited (otherwise the loop wouldn't have exited.) You might want
> the exit statuses or not. You can also usually use $SIG{CHLD} = 'IGNORE'
> prior to the forking loop if you don't care about exit statuses. see
> "perldoc perlipc"

Uh, I appologize - anyway, could you explain that last part to me?
Do you create zombies if you dont handle the exit status of you child by 
either wait()ing or setting the signal handler? An what does that zombie do 
anyway.

Thx, wolf


-- 
To unsubscribe, e-mail: [EMAIL PROTECTED]
For additional commands, e-mail: [EMAIL PROTECTED]
 

Re: Passing Data Between Servers

[wolf blaum]

On Thursday 04 March 2004 22:26, Tim generously enriched virtual reallity by 
making up this one:
>
> Paul,
> "Network Programming with Perl" by Stein is a good place to start. It
> discusses forking children, blocking and non-blocking I/O, among others,
> which will be considerations you'll want to make.


...and at least the scripts are available on the net:
http://modperl.com:9000/perl_networking

Have fun, Wolf


-- 
To unsubscribe, e-mail: [EMAIL PROTECTED]
For additional commands, e-mail: [EMAIL PROTECTED]
 

Re: Checking filenames? [:: ?Kinda Solved? ::]

[wolf blaum]

On Friday 05 March 2004 02:03, Sumit Kaur generously enriched virtual reallity 
by making up this one:

> Hi,

Hi,

> I have to write my first Perl script . This scripts Searches for rare =
> codons in nucleotide sequence . The nucleotide sequence is entered by =
> the user in the format "ATTGCAA.." and then the program breaks this =
> sequence in the groups of three alphabets like ATT,GCA...so no.=20
>
> Please suggest .

I first of all suggest you use new subject line...
Then: read Learning perl by Randal Schwartz and Tom Phoenix and tell us if you 
are learning perl as a first language or allready know about control 
structures, filehandles and regluar expressions

Then: what do you mean by "rare" - do you want the program to figure out, what 
the least frequent codons are and list/count/whatever them or do you have a 
prior definition of rare. Further (given your example above):

ATTGCAA
ATT
   TTG
      TGC

are all these codons or do you assume your user supplied sequence starts 
somewhere you know and goes on in triplets from there on? (That is, does the 
user supply only exons starting with the start tripplet?)

Once you get past the first steps: look at the bioperl modules at cpan and at 
www.Bioperl.org

Enjoy  -Wolf


--
To unsubscribe, e-mail: [EMAIL PROTECTED]
For additional commands, e-mail: [EMAIL PROTECTED]
 

Re: Checking filenames? [:: ?Kinda Solved? ::]

[wolf blaum]

On Friday 05 March 2004 02:03, Sumit Kaur generously enriched virtual reallity 
by making up this one:

> Hi,

Hi,

> I have to write my first Perl script . This scripts Searches for rare =
> codons in nucleotide sequence . The nucleotide sequence is entered by =
> the user in the format "ATTGCAA.." and then the program breaks this =
> sequence in the groups of three alphabets like ATT,GCA...so no.=20
>
> Please suggest .

I first of all suggest you use new subject line...
Then: read Learning perl by Randal Schwartz and Tom Phoenix and tell us if you 
are learning perl as a first language or allready know about control 
structures, filehandles and regluar expressions

Then: what do you mean by "rare" - do you want the program to figure out, what 
the least frequent codons are and list/count/whatever them or do you have a 
prior definition of rare. Further (given your example above):

ATTGCAA
ATT
   TTG
  TGC

are all these codons or do you assume your user supplied sequence starts 
somewhere you know and goes on in triplets from there on? (That is, does the 
user supply only exons starting with the start tripplet?)

Once you get past the first steps: look at the bioperl modules at cpan and at 
www.Bioperl.org

Enjoy  -Wolf



-- 
To unsubscribe, e-mail: [EMAIL PROTECTED]
For additional commands, e-mail: [EMAIL PROTECTED]
 

Re: Perl IDE

[wolf blaum]

On Friday 05 March 2004 18:26, Alexander Douglas generously enriched virtual 
reallity by making up this one:

> Hello
Hello

> I am new to perl and hence needs some help..
>
> 1) Is there a good IDE to build perl forms for web.

Emacs, VIM :-)
Use the CGI module.

> 2) If i have to connect perl to firebird database just the DBI module from
> perl is enough or do i need any more drivers, The OS is solaris and linux
> with wiindows clients for developement.


DBI implements the API to Database programing in perl and is database 
independet.
For each seperate database you want to work on using DBI you further need the 
appropriate DB driver module:
DBD::InterBase for Interbase and Firbird RDBMS available via CPAN.

Enjoy - Wolf


-- 
To unsubscribe, e-mail: [EMAIL PROTECTED]
For additional commands, e-mail: [EMAIL PROTECTED]
 

Re: Perl IDE

[wolf blaum]

On Friday 05 March 2004 18:26, Alexander Douglas generously enriched virtual 
reallity by making up this one:

> Hello
Hello

> I am new to perl and hence needs some help..
>
> 1) Is there a good IDE to build perl forms for web.

Emacs, VIM :-)
Use the CGI module.

> 2) If i have to connect perl to firebird database just the DBI module from
> perl is enough or do i need any more drivers, The OS is solaris and linux
> with wiindows clients for developement.


DBI implements the API to Database programming in perl and is database 
independet.
For each seperate database you want to work on using DBI you further need the 
appropriat DB driver module:
DBD::InterBase for Interbase and Firbird RDBMS available via CPAN.

Enjoy - Wolf




-- 
To unsubscribe, e-mail: [EMAIL PROTECTED]
For additional commands, e-mail: [EMAIL PROTECTED]
 

RE: RegEx Troubles

[Wolf Blaum]

>Given this in $_
>Most popular title searches:HREF="/title/tt0244365/">"Enterprise" (2001)"
>
>why would this regex not put digits in $1 ?
>
>$data2 =~ /popular title searches:<\/p>HREF=\"\/title\/tt(\d*)\/\">/
>

Hi, 

Snip---

$data2='Most popular title searches:"Enterprise" (2001)"';
$data2 =~ /popular title searches:<\/p>/;
print $1;

endSnip---

prints 0244365

If that's what you are looking for.

If you realy have the html in $_, why do you bind $data2 to the regex?
That way you try to find [regex] in $data2. 

HTH, 
wolf


-- 
To unsubscribe, e-mail: [EMAIL PROTECTED]
For additional commands, e-mail: [EMAIL PROTECTED]
 

Re: printf

[wolf blaum]

Am Montag, 22. Dezember 2003 20:17 schrieb Perl:

> i know what " %9.1f" would have done in this case.
> but how does " %9.2g" round off ?

the FORMAT notation used by prinf, sprintf, ... can be found on 
http://www.perldoc.com/perl5.8.0/pod/func/sprintf.html

which gives:
%e  a floating-point number, in scientific notation
%f  a floating-point number, in fixed decimal notation
%g  a floating-point number, in %e or %f notation

Just in case: scientific notation is something like XeY which means X times 10 
to the poxer of  Y (power first!)

HTH, wolf


--
To unsubscribe, e-mail: [EMAIL PROTECTED]
For additional commands, e-mail: [EMAIL PROTECTED]
 

Re: printf

[wolf blaum]

Am Montag, 22. Dezember 2003 20:17 schrieb Perl:

> i know what " %9.1f" would have done in this case.
> but how does " %9.2g" round off ?

the FORMAT notation used by prinf, sprintf, ... can be found on 
http://www.perldoc.com/perl5.8.0/pod/func/sprintf.html

which gives:
%e  a floating-point number, in scientific notation
%f  a floating-point number, in fixed decimal notation
%g  a floating-point number, in %e or %f notation

Just in case: scientific notation is something like XeY which means X times 10 
to the poxer of  Y (power first!)

HTH, wolf


-- 
To unsubscribe, e-mail: [EMAIL PROTECTED]
For additional commands, e-mail: [EMAIL PROTECTED]
 

wannabie asks Mail::POP3Client && Mail::Audit

[wolf blaum]

Hi, 
Im new (here|to perl) and would like to start of with that:

My script should replace attachmends in mails: however, i cant find any atts.

Script first:
 --
#! /usr/bin/perl

use strict;
use warnings;
use Mail::POP3Client;
use Mail::Audit qw(Attach);

my $pop=new Mail::POP3Client(USER => "you",
  PASSWORD => "youpass",
  HOST => "your.server");

for (my $i=1; $i<= $pop->Count();$i++) {
   my @mail = $pop->Retrieve($i);
   my $mailref = [EMAIL PROTECTED];
   my $mail = Mail::Audit->new(data => $mailref);   
   print "From: ", $mail->from,"\nSubject: ",$mail->subject, "\n";

#try to find Content-type: multipart/mixed; boundary= in mail header 
#manually
   foreach (@$mailref){ 
 /^(Content-type:)\s+/i and print "$_\n";
   }

#let Mail::Audit:Attachments try
   print "Att-no: ", $mail->num_attachments, "\n";
   my $atts = $mail->attachments;
   foreach (@$atts){
 print "size: ",$_->size,"\nfilename: ",$_->filename,"\n";
   }


} #for all mails in inbox

$pop->Close();

---

Since I dont want the Mail::Audit object to use my local inbox but the pop 
retrieved data I pass the array ref to it.

The problem:
even though a print join ("\n",[EMAIL PROTECTED]); shows me there are "Content-type: 
multipart\mixed" headers my first attempt to find them manually fails and 
gives me only the "Content-type: text/plain" or "..application/blabla" lines 
from the mail body of multi part mails.

Second attempt to identify atts via Mail::Audit::Attachment fails too.

All mail headers of the retrieved messages do carry a "MIME-version: 1.0" line 
as required by Mail::Audit::Attachment.

All the other print froms and so work fine 

What am I doing wrong?
Better solutions?

Thanks a lot, Wolf


-- 
To unsubscribe, e-mail: [EMAIL PROTECTED]
For additional commands, e-mail: [EMAIL PROTECTED]
 

Re: wannabie asks Mail::POP3Client && Mail::Audit

[wolf blaum]

Follow-up:

> The problem:
> even though a print join ("\n",[EMAIL PROTECTED]); shows me there are
> "Content-type: multipart\mixed" headers my first attempt to find them
> manually fails and gives me only the "Content-type: text/plain" or
> "..application/blabla" lines from the mail body of multi part mails.

ok, i solved that one: 
my $mail = Mail::Audit->new(data => $mailref);
strangely eats the array up so I dont have anything for my manual attempt 
left.
The strange thing: It only eats the header, the body is still there: couldnt 
find anything in the docu of Mail::Audit that mentions that.
So droping the construction of that object (and its use) lets me identify the 
Content-type  option in the header manually or  by using the Mail::Header 
object, which parses the header and makes it accessible in standariezed form.


However:

> Second attempt to identify atts via Mail::Audit::Attachment fails too.
>

That still holds valid: I cant the heck use te Mail::Audit class as I would 
like to: seems like I cant use it at all...
Whats wrong here? My code? My understanding? My carma?

Thanks, Wolf


-- 
To unsubscribe, e-mail: [EMAIL PROTECTED]
For additional commands, e-mail: [EMAIL PROTECTED]
 

Re: Reading/Writing Hash to Excel

[wolf blaum]

Hi, 
> I have successfully extracted the data I need and I am attempting to write
> the data into rows in excel.
>

well, there is  wonderful (as most of them:-) CPAN Module called:
Spreadsheet::WriteExcel that allows you to write in excel files, create 
additional worksheets and that sort of stuff.

There is also a module (alpha) called DBI::Excel which allows you to use the 
DBI Interface on Excel sheets quering in SQL if you like that better: 
however, at least up to my knowledge it doesent support multiple worksheets.

My favourite method  to export data to excel or something else is nevertheless 
using printf and "\t" to write tab delimited files which you might find 
importable basically everywhere.

> I would like to loop through the data starting with customer number and
> continue until I reach another customer number, at which time I would like
> to start a new row.
>
> I have included the sample data (results from extraction) as a attachment.
>

I didnt find your privious thread so i might leave the calls of either way up 
to someone who knows that code.

wolf

ps: hope you arent a cowboys fan:-/


-- 
To unsubscribe, e-mail: [EMAIL PROTECTED]
For additional commands, e-mail: [EMAIL PROTECTED]
 

looping through (a lot of) files

[wolf blaum]

Hi there, 

I do have one type A file, that holds about 25.000 A-ids, one per line.
Furher I have 500 type B files in a dir that hold 10-500 B-ids each, one per 
line.
All files are -T
Now i want to generate 500 type C files, corrosponding to the b files:

each B-id, that occours in a B-type file AND the A-type file should go into 
the corrosponding C-file. 

Each A id is unique in the A file, each B-id is unique in its file BUT NOT i 
all the Bfiles: each B id may occure in one or more B files.

Im lookin for a fast and memory concious way to do that.

I guess, there might be better ideas then 

foreach bfile in B-file-dir
  foreach b-id in Bfile
foreach a-id in Afile
  print to Cfile and next Bfile if a_id eq b_id

thank a lot, wolf




-- 
To unsubscribe, e-mail: [EMAIL PROTECTED]
For additional commands, e-mail: [EMAIL PROTECTED]
 

Re: IO File Problems

[wolf blaum]

> hi there,

hi | servus,

> 2) now i have to merge this strings with strings from a file. in this file
> there are many configuration sections.
> the section i need looks like this:
>
> [WHITELIST]
> [EMAIL PROTECTED]
> [EMAIL PROTECTED]
> [EMAIL PROTECTED]
>
> so i need to get all adresse under the [whitelist] tag into an array and
> merge them with my other array.
>
> i need to move the filepointer unter the tag - than cut the digit number
> and the "=" out - put the email adress in a array and 

I assume @emails to be your array.

#!/usr/bin/perl
use strict;
use warnings;

my @emails=get_db_emails;

open (FH, "){
  next unless (/\[WHITELIST\]/);
  my $inlist=1;
  while ($inlist){
chomp ($_=);
if (/^\d+=(.*)/) {push @emails, $1;}
else {$in_list=0;}
  }
}


Yes, this is very dirty and only works if the whitelist.txt file looks like 
you showed - however, it can hold multiple [WHITELIST] sections.
A section is assumed to end on the first line found that doesent hold the
digits=email pair.

Note that you shouldnt try to verify email syntax yourself (unless you want to 
spend weeks implementing the rfc822 and related).There is a Email::Valid 
modul at CPAN that does not only check the syntaxx but also if there is a MX 
server in that domain accepting email.

> calc to the digit
> number of the last entry +1.

I didnt get what you want here - sorry.

> sorry 4 my bad english but i am from austria :)

Nevermind, great skiing over there! Send me a mail in german (or austrian:-) 
if you need further help.

Hope thats a start, Wolf



-- 
To unsubscribe, e-mail: [EMAIL PROTECTED]
For additional commands, e-mail: [EMAIL PROTECTED]
 

edit pdf

[Wolf Blaum]

hi there,

I have a pile of pdf documents which may or may not contain email adresses.
Now I do have to mask the [EMAIL PROTECTED] adresses into something like xyAT
whereever.dot

I looked at CAM::PDF and PDF::API2 -
my CAM::PDF code would look like

foreach my $file (@todo){
  my $doc=CAM::PDF->new($file);
  my $pagenumber = $doc->numPages();
  for (my $i=1; $i=$pagenumber; $i++){
my $page=$doc->getPageContent($i);
$page =~ s/\@/AT/;
$doc->setPageContent($page);
  }
  $doc->save();
}

That however keeps on repeating a loop somewhere in CAM::PDF forever:

--snip--
ET Tw ( ) TjTD25 0.75 re fw ( ) [EMAIL PROTECTED]) Tjrite.de/) Tj)
Tjanke Kinder, CVK) Tjj
Use of uninitialized value in hash element at
/usr/lib/perl5/site_perl/5.8.5/CAM/PDF.pm line 2811.
Argument "BT\r70.5 49.5  TD\r0 0 0 rg \r/F0 9.75  Tf\r-0.2025  Tc ..." isn't
numeric in numeric lt (<) at /usr/lib/perl5/site_perl/5.8.5/CAM/PDF.pm line
2060.
ET Tw ( ) TjTD25 0.75 re fw ( ) [EMAIL PROTECTED]) Tjrite.de/) Tj)
Tjanke Kinder, CVK) Tjj
Use of uninitialized value in length at
/usr/lib/perl5/site_perl/5.8.5/CAM/PDF.pm line 3600.
Argument "BT\r70.5 49.5  TD\r0 0 0 rg \r/F0 9.75  Tf\r-0.2025  Tc ..." isn't
numeric in numeric lt (<) at /usr/lib/perl5/site_perl/5.8.5/CAM/PDF.pm line
2060.
--snap--

With PDF::API2 I manage to get a PDF::API2::Content::Text object
-> just that I cant find out what to do with it. How the heck do I find out
whether there are emails to be masked in that obj?

Does anybody
 - know where to find documentation an a PDF::API2::Content::Text obj?
 - know why ma CAM::PDF call end in an endless loop
 - have any other idea how to replace certain strings in a pdf?
 - know a docu on how pdf works - which I obviously dont know...


Thanks a lot in advance,
Wolf









-- 
To unsubscribe, e-mail: [EMAIL PROTECTED]
For additional commands, e-mail: [EMAIL PROTECTED]
http://learn.perl.org/

Re: 4 questions

[Wolf Blaum]

> Is there a 'bible' out there to read?

Depending on you level of faith:
"learning perl" by randal schwartz & tom phoenix
"the camel book" by Larry wall

bless you, wolf


-- 
To unsubscribe, e-mail: [EMAIL PROTECTED]
For additional commands, e-mail: [EMAIL PROTECTED]
http://learn.perl.org/

Re: a regular expression issue

[Wolf Blaum]

hi,

#!/usr/bin/perl
use strict;
use warnings;

my $file;
my @xfiles;

@xfiles = ("canada", "cane", "cane02", "ca.e.02", "canine",
".hidden");

foreach $file (@xfiles){

#want canada only for this iteration
if ($file =~ /(canada)/){print "$file\n  - end first if -  \n";}

#wb: (expression) groups what you want to find - ie dont search for c,a,n,d...
but for the whole word "canada" , no next required since if you match
canada, elsif wil not be executed (thats what else means, right?)

#then want cane, canine, ca.e.02
elsif ($file =~ /(^cane$)|(canine)|(ca.e.02)/){ print "$file\n"; }
  }

#wb: same as above, | lists alternatives, ie either "cane" or "canine" or ..
^ matches beginning of word, $ matches end



Cheers, Wolf


-- 
To unsubscribe, e-mail: [EMAIL PROTECTED]
For additional commands, e-mail: [EMAIL PROTECTED]
http://learn.perl.org/