genome  

Messages by Date

• 2011/10/17 [Genome] Local use of genome browser Eduardo Gade Gusmão
• 2011/10/17 [Genome] UCSC abbasiam
• 2011/10/16 Re: [Genome] about Denisova genomes Ya Hu
• 2011/10/15 Re: [Genome] Would you please update the Ensembl gene database? Hiram Clawson
• 2011/10/15 [Genome] Would you please update the Ensembl gene database? deqiang sun
• 2011/10/15 Re: [Genome] failure with custom track database Ann Zweig
• 2011/10/15 Re: [Genome] error in uploading wig files Ann Zweig
• 2011/10/15 Re: [Genome] UCSC problem Ann Zweig
• 2011/10/15 [Genome] failure with custom track database Sergei Ryazansky
• 2011/10/15 [Genome] error in uploading wig files Thomas Dunlop
• 2011/10/15 [Genome] UCSC problem parun
• 2011/10/14 Re: [Genome] regarding hg18 annotation file Luvina Guruvadoo
• 2011/10/14 Re: [Genome] bedToBigBed Galt Barber
• 2011/10/14 [Genome] Interpreting the Cluster Score of a Transcription Factor ChIP-seq data page Hoyle, Diego
• 2011/10/14 [Genome] bedToBigBed 沖 真弥
• 2011/10/14 [Genome] bed15 into bigBed Ania Lorenc
• 2011/10/14 [Genome] Problem with Table Browser bery
• 2011/10/14 Re: [Genome] Fwd: Log odds score for any conserved element in a gene Steve Heitner
• 2011/10/13 Re: [Genome] largest human genes Luvina Guruvadoo
• 2011/10/13 Re: [Genome] phastCons scores and download Luvina Guruvadoo
• 2011/10/13 Re: [Genome] hit statistics for the UCSC Genome Browser Hiram Clawson
• 2011/10/13 [Genome] hit statistics for the UCSC Genome Browser Vince Forgetta
• 2011/10/13 Re: [Genome] Fwd: Log odds score for any conserved element in a gene Steve Heitner
• 2011/10/13 [Genome] Fwd: Log odds score for any conserved element in a gene Libia Pava
• 2011/10/13 [Genome] Sus scr Elham Mohammadi
• 2011/10/13 [Genome] phastCons scores and download Carsten Raabe
• 2011/10/13 [Genome] largest human genes Lucia Franchini
• 2011/10/12 [Genome] gene-PECAM1 position Wang, Hongwei
• 2011/10/12 Re: [Genome] pig genome version Luvina Guruvadoo
• 2011/10/12 Re: [Genome] BED detail format Dedeepya Vaka
• 2011/10/12 Re: [Genome] Help: HGStyle-v258.css does not exist! Luvina Guruvadoo
• 2011/10/12 Re: [Genome] Log odds score for any conserved element in a gene Steve Heitner
• 2011/10/12 Re: [Genome] regarding hg18 annotation file Lakshmi Vara Prasad Koneru
• 2011/10/12 Re: [Genome] 17 mouse strain genomes on UCSC GB? Luvina Guruvadoo
• 2011/10/12 Re: [Genome] Question about frequency of SNPs track updates Luvina Guruvadoo
• 2011/10/12 Re: [Genome] Snp132 Exceptions Luvina Guruvadoo
• 2011/10/12 [Genome] BED detail format Dedeepya Vaka
• 2011/10/12 [Genome] two questions Gu, Lei
• 2011/10/11 [Genome] Log odds score for any conserved element in a gene Libia Pava
• 2011/10/11 Re: [Genome] Question regarding ENCODE ChIP-seq tracks Luvina Guruvadoo
• 2011/10/11 [Genome] Snp132 Exceptions Sam, Lee
• 2011/10/11 Re: [Genome] genomic project Luvina Guruvadoo
• 2011/10/11 Re: [Genome] .bed file assistance Greg Roe
• 2011/10/11 [Genome] 17 mouse strain genomes on UCSC GB? Corbo, Joseph
• 2011/10/11 [Genome] Question about frequency of SNPs track updates Norman Goodacre
• 2011/10/11 [Genome] .bed file assistance Nadine Berry
• 2011/10/11 [Genome] Help: HGStyle-v258.css does not exist! Minho Chae
• 2011/10/10 Re: [Genome] error in bed file format after liftOver from hg18 to hg19 Hiram Clawson
• 2011/10/10 [Genome] error in bed file format after liftOver from hg18 to hg19 oz solomon
• 2011/10/10 Re: [Genome] extract SINE/LINE/ALU information Gu, Lei
• 2011/10/09 Re: [Genome] genomic project yishay pinto
• 2011/10/09 [Genome] pig genome version dongdong zhaoweiming
• 2011/10/09 [Genome] Question regarding ENCODE ChIP-seq tracks Vijay G. Sankaran
• 2011/10/08 Re: [Genome] Inconsistencies in Genome Browser and Table Brooke Rhead
• 2011/10/08 Re: [Genome] Inconsistencies in Genome Browser and Table Luqman Hakim Bin Abdul Hadi
• 2011/10/07 Re: [Genome] genes with disparate loci in refFlat Rusch, Michael
• 2011/10/07 Re: [Genome] cgi hgEncodeVocab Brooke Rhead
• 2011/10/07 Re: [Genome] GO and Kegg Brooke Rhead
• 2011/10/07 Re: [Genome] genes with disparate loci in refFlat Brooke Rhead
• 2011/10/07 Re: [Genome] incorporation of "sessions" into publications? Brooke Rhead
• 2011/10/07 Re: [Genome] Updating dbSNP Brooke Rhead
• 2011/10/07 Re: [Genome] extract SINE/LINE/ALU information Brooke Rhead
• 2011/10/07 [Genome] incorporation of "sessions" into publications? chuck
• 2011/10/07 Re: [Genome] Inconsistencies in Genome Browser and Table Brooke Rhead
• 2011/10/07 Re: [Genome] I need your help on genome browser Luvina Guruvadoo
• 2011/10/07 [Genome] Inconsistencies in Genome Browser and Table Luqman Hakim Bin Abdul Hadi
• 2011/10/07 [Genome] extract SINE/LINE/ALU information Gu, Lei
• 2011/10/07 Re: [Genome] Does the refMrna.fa contain splicing sequences? Katrina Learned
• 2011/10/07 Re: [Genome] Fw: Re: about defined regions of Table Browser Katrina Learned
• 2011/10/07 [Genome] cgi hgEncodeVocab Elena Grassi
• 2011/10/06 Re: [Genome] help on displaying a selection matrix and on trackDb.txt Brooke Rhead
• 2011/10/06 Re: [Genome] FW: http://hgdownload.cse.ucsc.edu/goldenPath/mm8/database/refFlat.txt.gz Vlad Kustanovich
• 2011/10/06 Re: [Genome] Batch genome sequence/PCR queries Brooke Rhead
• 2011/10/06 Re: [Genome] FW: http://hgdownload.cse.ucsc.edu/goldenPath/mm8/database/refFlat.txt.gz Brooke Rhead
• 2011/10/06 [Genome] help on displaying a selection matrix and on trackDb.txt deqiang sun
• 2011/10/06 Re: [Genome] genomic project Brooke Rhead
• 2011/10/06 Re: [Genome] DGAP track for Genome Browser Brooke Rhead
• 2011/10/06 [Genome] FW: http://hgdownload.cse.ucsc.edu/goldenPath/mm8/database/refFlat.txt.gz Vlad Kustanovich
• 2011/10/06 [Genome] Updating dbSNP Laura Reinholdt
• 2011/10/06 Re: [Genome] Batch genome sequence/PCR queries Tar Viturawong
• 2011/10/06 [Genome] DGAP track for Genome Browser Quade, Bradley Joseph,M.D.,Ph.D.
• 2011/10/06 Re: [Genome] liftover error with bed or genomic coordinate position Galt Barber
• 2011/10/06 Re: [Genome] genomic project yishay pinto
• 2011/10/06 [Genome] liftover error with bed or genomic coordinate position LU Zen
• 2011/10/06 [Genome] GO and Kegg Carsten Raabe
• 2011/10/06 [Genome] genes with disparate loci in refFlat Rusch, Michael
• 2011/10/05 Re: [Genome] intersection problems Luvina Guruvadoo
• 2011/10/05 Re: [Genome] Batch genome sequence/PCR queries Luvina Guruvadoo
• 2011/10/05 Re: [Genome] byte-range error on url uploads Galt Barber
• 2011/10/05 Re: [Genome] Programmatically download custom track image Luvina Guruvadoo
• 2011/10/05 [Genome] gff3ToPred Padron, Alejandro (NIH/NIAID) [F]
• 2011/10/05 Re: [Genome] gff3ToPred Luvina Guruvadoo
• 2011/10/05 [Genome] Programmatically download custom track image Jing Gao
• 2011/10/05 Re: [Genome] txCdsPredict Luvina Guruvadoo
• 2011/10/05 Re: [Genome] ENCODE RBP track annotation Pauline Fujita
• 2011/10/05 Re: [Genome] Neandertal and Denisova Assembly and Analysis Tracks. Luvina Guruvadoo
• 2011/10/05 Re: [Genome] get genes informations having ensemblID with mysql query Hiram Clawson
• 2011/10/05 Re: [Genome] how to get a merged list of coding exons of a gene Luvina Guruvadoo
• 2011/10/05 [Genome] get genes informations having ensemblID with mysql query Rispoli Rossella
• 2011/10/05 [Genome] gff3ToPred Padron, Alejandro (NIH/NIAID) [F]
• 2011/10/05 [Genome] I need your help on genome browser Yonghoon Cha
• 2011/10/05 [Genome] Batch genome sequence/PCR queries Tar Viturawong
• 2011/10/05 [Genome] intersection problems Lucia Franchini
• 2011/10/05 [Genome] txCdsPredict dongdong zhaoweiming
• 2011/10/04 [Genome] how to get a merged list of coding exons of a gene Rehman, Atteeq (NIH/NIDCD) [F]
• 2011/10/04 Re: [Genome] BED detail file Hiram Clawson
• 2011/10/04 [Genome] BED detail file Lawrence Mckechnie
• 2011/10/04 Re: [Genome] BEd format Luvina Guruvadoo
• 2011/10/04 [Genome] BEd format Lawrence Mckechnie
• 2011/10/03 Re: [Genome] Neandertal and Denisova Assembly and Analysis Tracks. Tomas Lovera
• 2011/10/03 Re: [Genome] Does the refMrna.fa contain splicing sequences? Katrina Learned
• 2011/10/03 Re: [Genome] Fasta Sequence Katrina Learned
• 2011/10/03 Re: [Genome] Fw: Re: about defined regions of Table Browser Katrina Learned
• 2011/10/03 Re: [Genome] Question about different spectra comparison (not previously asked) Vanessa Kirkup Swing
• 2011/10/03 Re: [Genome] rs62624477 annotation Pauline Fujita
• 2011/10/03 [Genome] Does the refMrna.fa contain splicing sequences? xue lin
• 2011/10/03 Re: [Genome] Fasta Sequence barnesd8
• 2011/10/03 [Genome] Fw: Re: about defined regions of Table Browser 郭志云
• 2011/10/02 Re: [Genome] help with ucsc Pauline Fujita
• 2011/10/02 Re: [Genome] Reproducing phastCons placental mammal conserved elements Pauline Fujita
• 2011/10/02 Re: [Genome] Question about different spectra comparison (not previously asked) Hiram Clawson
• 2011/10/02 Re: [Genome] Question about different spectra comparison (not previously asked) Alexander Belostotsky
• 2011/09/30 Re: [Genome] Byte-range request 206.. Katrina Learned
• 2011/09/30 [Genome] Byte-range request 206.. Tim Owens
• 2011/09/30 Re: [Genome] about defined regions of Table Browser Pauline Fujita
• 2011/09/30 Re: [Genome] liftOver mapping between hg18 and hg19 Katrina Learned
• 2011/09/30 Re: [Genome] Error when adding a track data hub Katrina Learned
• 2011/09/30 Re: [Genome] liftOver mapping between hg18 and hg19 Katrina Learned
• 2011/09/30 Re: [Genome] URL for multiple custom tracks LU Zen
• 2011/09/30 Re: [Genome] Neandertal and Denisova Assembly and Analysis Tracks. Katrina Learned
• 2011/09/30 [Genome] Error when adding a track data hub John Tate
• 2011/09/30 [Genome] Neandertal and Denisova Assembly and Analysis Tracks. Tomas Lovera
• 2011/09/30 [Genome] liftOver mapping between hg18 and hg19 Matteo D'antonio
• 2011/09/29 Re: [Genome] searching for integration sites Luvina Guruvadoo
• 2011/09/29 Re: [Genome] blat output Galt Barber
• 2011/09/29 Re: [Genome] Why TACCTTGGCTGTGTTTCCGATATTCTTGGAGGTTGT is not mappable to mouse genome by blat? Vanessa Kirkup Swing
• 2011/09/29 Re: [Genome] Fasta Sequence Vanessa Kirkup Swing
• 2011/09/29 Re: [Genome] Fwd: download list of human non-coding RNAs from UCSC Vanessa Kirkup Swing
• 2011/09/29 [Genome] Fwd: download list of human non-coding RNAs from UCSC Yuan Tian
• 2011/09/29 Re: [Genome] download list of human non-coding RNAs from UCSC Vanessa Kirkup Swing
• 2011/09/29 [Genome] download list of human non-coding RNAs from UCSC Yuan Tian
• 2011/09/29 Re: [Genome] URL for multiple custom tracks Vanessa Kirkup Swing
• 2011/09/29 [Genome] Fasta Sequence barnesd8
• 2011/09/29 Re: [Genome] URL for multiple custom tracks Vanessa Kirkup Swing
• 2011/09/29 Re: [Genome] URL for multiple custom tracks LU Zen
• 2011/09/29 Re: [Genome] URL for multiple custom tracks Vanessa Kirkup Swing
• 2011/09/29 [Genome] URL for multiple custom tracks LU Zen
• 2011/09/29 Re: [Genome] Fwd: Gene Information for a List of Protein GI Numbers Katrina Learned
• 2011/09/29 Re: [Genome] PhyloP off by one errors? Hiram Clawson
• 2011/09/29 [Genome] Why TACCTTGGCTGTGTTTCCGATATTCTTGGAGGTTGT is not mappable to mouse genome by blat? Peng Yu
• 2011/09/29 [Genome] blat output Fathepure, Shakuntala
• 2011/09/29 Re: [Genome] PhyloP off by one errors? Daniel Gaffney
• 2011/09/29 [Genome] Question about different spectra comparison (not previously asked) Alexander Belostotsky
• 2011/09/28 Re: [Genome] byte-range error on url uploads Palle Villesen (BiRC)
• 2011/09/28 Re: [Genome] byte-range error on url uploads Galt Barber
• 2011/09/28 Re: [Genome] byte-range error on url uploads Galt Barber
• 2011/09/28 Re: [Genome] query limits to ucsc mysql database Luvina Guruvadoo
• 2011/09/28 Re: [Genome] Regarding dog annotation database Pauline Fujita
• 2011/09/28 Re: [Genome] Human Transcriptome Size Pauline Fujita
• 2011/09/28 Re: [Genome] Human Transcriptome Size Mingfeng Li
• 2011/09/28 Re: [Genome] PhyloP off by one errors? Cook, Malcolm
• 2011/09/28 Re: [Genome] about cDNA sequences Luvina Guruvadoo
• 2011/09/28 Re: [Genome] errors in Decipher database Greg Roe
• 2011/09/28 [Genome] Reproducing phastCons placental mammal conserved elements Daniel Halligan
• 2011/09/28 [Genome] ENCODE RBP track annotation Carsten Raabe
• 2011/09/28 [Genome] Regarding dog annotation database Arumilli Meharji
• 2011/09/28 [Genome] Human Transcriptome Size Kim Spradling
• 2011/09/28 [Genome] help with ucsc Elham Mohammadi
• 2011/09/28 [Genome] PhyloP off by one errors? daniel.gaffney
• 2011/09/28 [Genome] about defined regions of Table Browser 郭志云
• 2011/09/28 [Genome] byte-range error on url uploads Palle Villesen (BiRC)
• 2011/09/27 Re: [Genome] byte-range error on url uploads Greg Roe
• 2011/09/27 Re: [Genome] super vs scaffold coordinates & D. willistoni on the browser. Greg Roe
• 2011/09/27 [Genome] errors in Decipher database betsy hirsch
• 2011/09/27 Re: [Genome] Get repeatmasked refseq? Greg Roe
• 2011/09/27 Re: [Genome] error message Pauline Fujita
• 2011/09/27 [Genome] GFF custom track not loading Julien Lagarde
• 2011/09/26 Re: [Genome] Does each mRNA from the refMran.fa contains 3'UTR Greg Roe
• 2011/09/26 [Genome] byte-range error on url uploads Sean O'Keeffe
• 2011/09/26 Re: [Genome] byte-range error on url uploads Sean O'Keeffe
• 2011/09/26 Re: [Genome] How to download PhyloP and PhastCons scores Luvina Guruvadoo
• 2011/09/26 [Genome] Does each mRNA from the refMran.fa contains 3'UTR xue lin
• 2011/09/25 [Genome] Fwd: Gene Information for a List of Protein GI Numbers Kim Spradling
• 2011/09/25 [Genome] about cDNA sequences waise quarni
• 2011/09/25 [Genome] query limits to ucsc mysql database dmitrijs lvovs
• 2011/09/25 [Genome] How to download PhyloP and PhastCons scores Casper Shyr
• 2011/09/25 [Genome] searching for integration sites Ben Cohen
• 2011/09/23 Re: [Genome] Fwd: Problem displaying ISCA custom tracks Viren Patel
• 2011/09/23 Re: [Genome] Fwd: Problem displaying ISCA custom tracks Hiram Clawson
• 2011/09/23 Re: [Genome] Time and space complexity Vanessa Kirkup Swing
• 2011/09/22 Re: [Genome] Unanswered Questions Vanessa Kirkup Swing
• 2011/09/22 Re: [Genome] table with GenBank features Pauline Fujita
• 2011/09/22 Re: [Genome] Probe Coordinates for the Affymetrix U133 2.0 plus array Vanessa Kirkup Swing
• 2011/09/22 [Genome] Time and space complexity Michele Angelo Perrotta
• 2011/09/22 Re: [Genome] error with custom track upload Vanessa Kirkup Swing
• 2011/09/22 [Genome] Unanswered Questions Rina T. Greenblatt
• 2011/09/22 [Genome] error with custom track upload Elizabeth Ashley
• 2011/09/22 Re: [Genome] Probe Coordinates for the Affymetrix U133 2.0 plus array Gates, Casey
• 2011/09/21 Re: [Genome] Genome Build Patch Version Pauline Fujita
• 2011/09/21 Re: [Genome] bed files for entire chromosomes Pauline Fujita

• Earlier messages
• Later messages