genome  

Messages by Thread

• • Re: [Genome] extract SINE/LINE/ALU information Gu, Lei
  • Re: [Genome] extract SINE/LINE/ALU information Greg Roe
• [Genome] cgi hgEncodeVocab Elena Grassi
  • Re: [Genome] cgi hgEncodeVocab Brooke Rhead
• [Genome] help on displaying a selection matrix and on trackDb.txt deqiang sun
  • Re: [Genome] help on displaying a selection matrix and on trackDb.txt Brooke Rhead
• [Genome] FW: http://hgdownload.cse.ucsc.edu/goldenPath/mm8/database/refFlat.txt.gz Vlad Kustanovich
  • Re: [Genome] FW: http://hgdownload.cse.ucsc.edu/goldenPath/mm8/database/refFlat.txt.gz Brooke Rhead
  • Re: [Genome] FW: http://hgdownload.cse.ucsc.edu/goldenPath/mm8/database/refFlat.txt.gz Vlad Kustanovich
• [Genome] Updating dbSNP Laura Reinholdt
  • Re: [Genome] Updating dbSNP Brooke Rhead
• [Genome] DGAP track for Genome Browser Quade, Bradley Joseph,M.D.,Ph.D.
  • Re: [Genome] DGAP track for Genome Browser Brooke Rhead
• [Genome] liftover error with bed or genomic coordinate position LU Zen
  • Re: [Genome] liftover error with bed or genomic coordinate position Galt Barber
• [Genome] GO and Kegg Carsten Raabe
  • Re: [Genome] GO and Kegg Brooke Rhead
• [Genome] genes with disparate loci in refFlat Rusch, Michael
  • Re: [Genome] genes with disparate loci in refFlat Brooke Rhead
  • Re: [Genome] genes with disparate loci in refFlat Rusch, Michael
  • Re: [Genome] genes with disparate loci in refFlat Brooke Rhead
• [Genome] Programmatically download custom track image Jing Gao
  • Re: [Genome] Programmatically download custom track image Luvina Guruvadoo
• [Genome] get genes informations having ensemblID with mysql query Rispoli Rossella
  • Re: [Genome] get genes informations having ensemblID with mysql query Hiram Clawson
• [Genome] gff3ToPred Padron, Alejandro (NIH/NIAID) [F]
  • Re: [Genome] gff3ToPred Luvina Guruvadoo
  • [Genome] gff3ToPred Padron, Alejandro (NIH/NIAID) [F]
• [Genome] I need your help on genome browser Yonghoon Cha
  • Re: [Genome] I need your help on genome browser Luvina Guruvadoo
• [Genome] Batch genome sequence/PCR queries Tar Viturawong
  • Re: [Genome] Batch genome sequence/PCR queries Luvina Guruvadoo
  • Re: [Genome] Batch genome sequence/PCR queries Tar Viturawong
  • Re: [Genome] Batch genome sequence/PCR queries Brooke Rhead
• [Genome] intersection problems Lucia Franchini
  • Re: [Genome] intersection problems Luvina Guruvadoo
• [Genome] txCdsPredict dongdong zhaoweiming
  • Re: [Genome] txCdsPredict Luvina Guruvadoo
• [Genome] how to get a merged list of coding exons of a gene Rehman, Atteeq (NIH/NIDCD) [F]
  • Re: [Genome] how to get a merged list of coding exons of a gene Luvina Guruvadoo
• [Genome] BED detail file Lawrence Mckechnie
  • Re: [Genome] BED detail file Hiram Clawson
• [Genome] BEd format Lawrence Mckechnie
  • Re: [Genome] BEd format Luvina Guruvadoo
• [Genome] Does the refMrna.fa contain splicing sequences? xue lin
  • Re: [Genome] Does the refMrna.fa contain splicing sequences? Katrina Learned
  • Re: [Genome] Does the refMrna.fa contain splicing sequences? Katrina Learned
• [Genome] Fw: Re: about defined regions of Table Browser 郭志云
  • Re: [Genome] Fw: Re: about defined regions of Table Browser Katrina Learned
  • Re: [Genome] Fw: Re: about defined regions of Table Browser Katrina Learned
• [Genome] Byte-range request 206.. Tim Owens
  • Re: [Genome] Byte-range request 206.. Katrina Learned
• [Genome] Error when adding a track data hub John Tate
  • Re: [Genome] Error when adding a track data hub Katrina Learned
• [Genome] Neandertal and Denisova Assembly and Analysis Tracks. Tomas Lovera
  • Re: [Genome] Neandertal and Denisova Assembly and Analysis Tracks. Katrina Learned
  • Re: [Genome] Neandertal and Denisova Assembly and Analysis Tracks. Tomas Lovera
  • Re: [Genome] Neandertal and Denisova Assembly and Analysis Tracks. Luvina Guruvadoo
  • Re: [Genome] Neandertal and Denisova SNP alleles (Corrected Copy). Tomas Lovera
  • Re: [Genome] Neandertal and Denisova SNP alleles (Corrected Copy). Luvina Guruvadoo
• [Genome] liftOver mapping between hg18 and hg19 Matteo D'antonio
  • Re: [Genome] liftOver mapping between hg18 and hg19 Katrina Learned
  • Re: [Genome] liftOver mapping between hg18 and hg19 Katrina Learned
• [Genome] Fwd: download list of human non-coding RNAs from UCSC Yuan Tian
  • Re: [Genome] Fwd: download list of human non-coding RNAs from UCSC Vanessa Kirkup Swing
• [Genome] download list of human non-coding RNAs from UCSC Yuan Tian
  • Re: [Genome] download list of human non-coding RNAs from UCSC Vanessa Kirkup Swing
• [Genome] Fasta Sequence barnesd8
  • Re: [Genome] Fasta Sequence Vanessa Kirkup Swing
  • Re: [Genome] Fasta Sequence barnesd8
  • Re: [Genome] Fasta Sequence Katrina Learned
• [Genome] URL for multiple custom tracks LU Zen
  • Re: [Genome] URL for multiple custom tracks Vanessa Kirkup Swing
  • Re: [Genome] URL for multiple custom tracks LU Zen
  • Re: [Genome] URL for multiple custom tracks Vanessa Kirkup Swing
  • Re: [Genome] URL for multiple custom tracks Vanessa Kirkup Swing
  • Re: [Genome] URL for multiple custom tracks LU Zen
• [Genome] Why TACCTTGGCTGTGTTTCCGATATTCTTGGAGGTTGT is not mappable to mouse genome by blat? Peng Yu
  • Re: [Genome] Why TACCTTGGCTGTGTTTCCGATATTCTTGGAGGTTGT is not mappable to mouse genome by blat? Vanessa Kirkup Swing
• [Genome] blat output Fathepure, Shakuntala
  • Re: [Genome] blat output Galt Barber
• [Genome] Question about different spectra comparison (not previously asked) Alexander Belostotsky
  • Re: [Genome] Question about different spectra comparison (not previously asked) Alexander Belostotsky
  • Re: [Genome] Question about different spectra comparison (not previously asked) Hiram Clawson
  • Re: [Genome] Question about different spectra comparison (not previously asked) Vanessa Kirkup Swing
• [Genome] Reproducing phastCons placental mammal conserved elements Daniel Halligan
  • Re: [Genome] Reproducing phastCons placental mammal conserved elements Pauline Fujita
• [Genome] ENCODE RBP track annotation Carsten Raabe
  • Re: [Genome] ENCODE RBP track annotation Pauline Fujita
• [Genome] Regarding dog annotation database Arumilli Meharji
  • Re: [Genome] Regarding dog annotation database Pauline Fujita
• [Genome] Human Transcriptome Size Kim Spradling
  • Re: [Genome] Human Transcriptome Size Mingfeng Li
  • Re: [Genome] Human Transcriptome Size Pauline Fujita
• [Genome] help with ucsc Elham Mohammadi
  • Re: [Genome] help with ucsc Pauline Fujita
• [Genome] PhyloP off by one errors? daniel.gaffney
  • Re: [Genome] PhyloP off by one errors? Cook, Malcolm
  • Re: [Genome] PhyloP off by one errors? Daniel Gaffney
  • Re: [Genome] PhyloP off by one errors? Hiram Clawson
• [Genome] about defined regions of Table Browser 郭志云
  • Re: [Genome] about defined regions of Table Browser Pauline Fujita
• [Genome] byte-range error on url uploads Palle Villesen (BiRC)
  • Re: [Genome] byte-range error on url uploads Galt Barber
  • Re: [Genome] byte-range error on url uploads Galt Barber
  • Re: [Genome] byte-range error on url uploads Palle Villesen (BiRC)
  • Re: [Genome] byte-range error on url uploads Galt Barber
• [Genome] errors in Decipher database betsy hirsch
  • Re: [Genome] errors in Decipher database Greg Roe
• [Genome] GFF custom track not loading Julien Lagarde
  • Re: [Genome] GFF custom track not loading Luvina Guruvadoo
• [Genome] byte-range error on url uploads Sean O'Keeffe
  • Re: [Genome] byte-range error on url uploads Sean O'Keeffe
  • Re: [Genome] byte-range error on url uploads Greg Roe
• [Genome] Does each mRNA from the refMran.fa contains 3'UTR xue lin
  • Re: [Genome] Does each mRNA from the refMran.fa contains 3'UTR Greg Roe
• [Genome] Fwd: Gene Information for a List of Protein GI Numbers Kim Spradling
  • Re: [Genome] Fwd: Gene Information for a List of Protein GI Numbers Katrina Learned
• [Genome] about cDNA sequences waise quarni
  • Re: [Genome] about cDNA sequences Luvina Guruvadoo
• [Genome] query limits to ucsc mysql database dmitrijs lvovs
  • Re: [Genome] query limits to ucsc mysql database Luvina Guruvadoo
• [Genome] How to download PhyloP and PhastCons scores Casper Shyr
  • Re: [Genome] How to download PhyloP and PhastCons scores Luvina Guruvadoo
• [Genome] searching for integration sites Ben Cohen
  • Re: [Genome] searching for integration sites Luvina Guruvadoo
• Re: [Genome] Fwd: Problem displaying ISCA custom tracks Hiram Clawson
  • Re: [Genome] Fwd: Problem displaying ISCA custom tracks Viren Patel
• [Genome] Unanswered Questions Rina T. Greenblatt
  • Re: [Genome] Unanswered Questions Vanessa Kirkup Swing
• [Genome] error with custom track upload Elizabeth Ashley
  • Re: [Genome] error with custom track upload Vanessa Kirkup Swing
• [Genome] rs62624477 annotation Tin, Adrienne
  • Re: [Genome] rs62624477 annotation Pauline Fujita
• [Genome] table with GenBank features Andrew Yee
  • Re: [Genome] table with GenBank features Pauline Fujita
• [Genome] Genome Build Patch Version Licon, Abel
  • Re: [Genome] Genome Build Patch Version Pauline Fujita
• Re: [Genome] liftover hg19 to hg18 Nandini B
  • Re: [Genome] liftover hg19 to hg18 Pauline Fujita
  • Re: [Genome] liftover hg19 to hg18 Nandini B
• [Genome] Probe Coordinates for the Affymetrix U133 2.0 plus array Gates, Casey
  • Re: [Genome] Probe Coordinates for the Affymetrix U133 2.0 plus array Luvina Guruvadoo
  • Re: [Genome] Probe Coordinates for the Affymetrix U133 2.0 plus array Gates, Casey
  • Re: [Genome] Probe Coordinates for the Affymetrix U133 2.0 plus array Vanessa Kirkup Swing
• [Genome] Coordinates of unigene clusters Vickie S
  • Re: [Genome] Coordinates of unigene clusters Luvina Guruvadoo
• [Genome] liftOver: xenTro2 to newer X. tropicalis Genome Yong Kong
  • Re: [Genome] liftOver: xenTro2 to newer X. tropicalis Genome Luvina Guruvadoo
• [Genome] editing the range of useScore Elizabeth Ashley
  • Re: [Genome] editing the range of useScore Galt Barber
• [Genome] map.chain mm8-mm9 Delafontaine Julien
  • Re: [Genome] map.chain mm8-mm9 Luvina Guruvadoo
• [Genome] question about the parameters Anne LE MOUEL
  • Re: [Genome] question about the parameters Luvina Guruvadoo
• [Genome] conservation scores phastCons46way.placental Emmanouela Repapi
  • Re: [Genome] conservation scores phastCons46way.placental Hiram Clawson
• [Genome] Differences between "TableBrowser" and "hgdownload" Assaf Gordon
  • Re: [Genome] Differences between "TableBrowser" and "hgdownload" Brian Raney
• [Genome] BAM files Nayeck, Jaykar (NIH/NICHD) [V]
  • Re: [Genome] BAM files Greg Roe
• Re: [Genome] bigWigMerge Luvina Guruvadoo
• [Genome] histone modification markers tracks Emmanouela Repapi
  • Re: [Genome] histone modification markers tracks Greg Roe
• [Genome] Questions re RefSeq data in UCSC genome database Reece Hart
  • Re: [Genome] Questions re RefSeq data in UCSC genome database Luvina Guruvadoo
  • Re: [Genome] Questions re RefSeq data in UCSC genome database Reece Hart
• [Genome] bed files for entire chromosomes Minou Bina
  • Re: [Genome] bed files for entire chromosomes Katrina Learned
  • [Genome] bed files for entire chromosomes Minou Bina
  • Re: [Genome] bed files for entire chromosomes Greg Roe
  • Re: [Genome] bed files for entire chromosomes Minou Bina
  • Re: [Genome] bed files for entire chromosomes Pauline Fujita
• [Genome] finding microsatelllite loci in mouse genome Ann Eileen Miller Baker
  • Re: [Genome] finding microsatelllite loci in mouse genome Katrina Learned
  • [Genome] Fwd: finding microsatelllite loci in mouse genome Ann Eileen Miller Baker
  • Re: [Genome] Fwd: finding microsatelllite loci in mouse genome Luvina Guruvadoo
• [Genome] Repeat consensus sequence for hg19 Daofeng Li
  • Re: [Genome] Repeat consensus sequence for hg19 Katrina Learned
  • Re: [Genome] Repeat consensus sequence for hg19 Daofeng Li
  • Re: [Genome] Repeat consensus sequence for hg19 Katrina Learned
• [Genome] UCSC has only one mouse genome sequence? Ann Eileen Miller Baker
  • Re: [Genome] UCSC has only one mouse genome sequence? Katrina Learned
• [Genome] oligoMatch Hunter Richards
  • Re: [Genome] oligoMatch Hiram Clawson
• [Genome] BAM track with custom color tag doesn't show read-names Assaf Gordon
  • Re: [Genome] BAM track with custom color tag doesn't show read-names Brian Raney
• [Genome] RefSeq gene model, transcript version numbers? Sandeep Sanga
  • Re: [Genome] RefSeq gene model, transcript version numbers? Vanessa Kirkup Swing
• [Genome] super vs scaffold coordinates & D. willistoni on the browser. Jaaved Mohammed
  • Re: [Genome] super vs scaffold coordinates & D. willistoni on the browser. Vanessa Kirkup Swing
  • Re: [Genome] super vs scaffold coordinates & D. willistoni on the browser. Jaaved Mohammed
  • Re: [Genome] super vs scaffold coordinates & D. willistoni on the browser. Greg Roe
  • Re: [Genome] super vs scaffold coordinates & D. willistoni on the browser. Jaaved Mohammed
  • Re: [Genome] super vs scaffold coordinates & D. willistoni on the browser. Greg Roe
• [Genome] Where can I find the relationship between TF and TF target genes? hyunjung kang
  • Re: [Genome] Where can I find the relationship between TF and TF target genes? Vanessa Kirkup Swing
• [Genome] Hg19 tables Diego F. Pereira
  • Re: [Genome] Hg19 tables Vanessa Kirkup Swing
  • Re: [Genome] Hg19 tables Diego F. Pereira

• Earlier messages
• Later messages